Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028431 Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence 0 crisprs NA 0 0 1 0
CP028429 Escherichia coli strain RM9131 chromosome, complete genome 2 crisprs DinG,PrimPol,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas14i 0 5 14 0
CP028430 Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence 0 crisprs DEDDh 0 0 4 0

Results visualization

1. CP028431
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2288 : 38062 49 Escherichia_phage(36.36%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028429
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028429_1 3304864-3305197 TypeI-E I-E
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028429_2 3330899-3331293 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028429_1 1.1|3304893|32|CP028429|CRT 3304893-3304924 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP028429_1 1.2|3304954|32|CP028429|CRT,PILER-CR,CRISPRCasFinder 3304954-3304985 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP028429_1 1.1|3304893|32|CP028429|CRT 3304893-3304924 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP028429_1 1.1|3304893|32|CP028429|CRT 3304893-3304924 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP028429_2 2.1|3330928|32|CP028429|CRISPRCasFinder 3330928-3330959 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP028429_1 1.1|3304893|32|CP028429|CRT 3304893-3304924 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP028429_1 1.3|3305015|32|CP028429|CRT,PILER-CR,CRISPRCasFinder 3305015-3305046 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP028429_1 1.4|3305076|32|CP028429|CRT,PILER-CR,CRISPRCasFinder 3305076-3305107 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP028429_1 1.4|3305076|32|CP028429|CRT,PILER-CR,CRISPRCasFinder 3305076-3305107 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|3304893|32|CP028429|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 1.2|3304954|32|CP028429|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 1.1|3304893|32|CP028429|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

4. spacer 1.1|3304893|32|CP028429|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

5. spacer 2.1|3330928|32|CP028429|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

6. spacer 1.1|3304893|32|CP028429|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

7. spacer 1.3|3305015|32|CP028429|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

8. spacer 1.4|3305076|32|CP028429|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

9. spacer 1.4|3305076|32|CP028429|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 326300 : 336628 11 Enterobacteria_phage(20.0%) transposase NA
DBSCAN-SWA_2 550426 : 630318 74 Escherichia_phage(33.33%) capsid,transposase,protease,head,tRNA,tail NA
DBSCAN-SWA_3 849743 : 869068 28 Enterobacteria_phage(54.55%) transposase,holin,integrase attL 854983:854997|attR 868384:868398
DBSCAN-SWA_4 1079722 : 1122281 62 Escherichia_phage(37.93%) protease,lysis,transposase,holin NA
DBSCAN-SWA_5 1345857 : 1414540 76 Stx2-converting_phage(33.96%) capsid,lysis,transposase,terminase,holin,head,integrase,tRNA,tail attL 1340951:1340965|attR 1347432:1347446
DBSCAN-SWA_6 1515756 : 1588778 79 Enterobacteria_phage(45.1%) lysis,transposase,terminase,holin,protease,portal,tail NA
DBSCAN-SWA_7 1649162 : 1744923 121 Escherichia_phage(40.45%) capsid,lysis,transposase,holin,terminase,head,integrase,tRNA,tail attL 1707871:1707930|attR 1738616:1739927
DBSCAN-SWA_8 1943032 : 1995797 63 Stx2-converting_phage(45.65%) capsid,lysis,transposase,terminase,holin,portal,head,tail NA
DBSCAN-SWA_9 2131564 : 2169648 46 Enterobacteria_phage(86.11%) capsid,transposase,terminase,holin,portal,plate,tRNA,tail NA
DBSCAN-SWA_10 2389271 : 2476130 108 Enterobacteria_phage(35.48%) capsid,lysis,transposase,terminase,holin,portal,head,tail NA
DBSCAN-SWA_11 2714031 : 2775556 57 Enterobacteria_phage(23.08%) capsid,lysis,transposase,holin,terminase,integrase attL 2744610:2744645|attR 2776496:2776531
DBSCAN-SWA_12 3125282 : 3209907 90 Enterobacteria_phage(68.52%) lysis,transposase,terminase,portal,integrase,tRNA,tail attL 3193264:3193279|attR 3216711:3216726
DBSCAN-SWA_13 3281435 : 3288575 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_14 4830867 : 4881238 55 Enterobacteria_phage(38.89%) capsid,lysis,terminase,holin,head,integrase,tRNA,tail attL 4872436:4872450|attR 4885180:4885194
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP028430
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15963 14 Salmonella_phage(71.43%) transposase NA
DBSCAN-SWA_2 20286 : 78973 72 Salmonella_phage(84.13%) terminase,tRNA,tail,capsid,transposase NA
DBSCAN-SWA_3 84341 : 104640 23 Salmonella_phage(88.89%) tail,transposase NA
DBSCAN-SWA_4 107984 : 116380 6 Salmonella_phage(83.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage