Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029981 Escherichia coli strain 99-3165 chromosome, complete genome 11 crisprs NA 0 12 0 0
CP029982 Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP029979 Escherichia coli strain 99-3165 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP029980 Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP029981
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_1 965888-966139 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_2 1369061-1369272 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_3 1395162-1395435 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_4 2564011-2564134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_5 3186408-3186499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_6 3329554-3329637 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_7 3463137-3463281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_8 3711505-3711601 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_9 3842764-3842908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_10 3876098-3876241 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029981_11 4186549-4186681 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029981_5 5.1|3186434|40|CP029981|CRISPRCasFinder 3186434-3186473 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP029981_11 11.1|4186566|42|CP029981|PILER-CR 4186566-4186607 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP029981_11 11.2|4186625|40|CP029981|PILER-CR 4186625-4186664 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 0 1.0
CP029981_3 3.9|1395375|32|CP029981|CRT 1395375-1395406 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 1 0.969
CP029981_4 4.1|2564054|38|CP029981|CRISPRCasFinder 2564054-2564091 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229407-229464 3 0.948
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239901-239958 3 0.948
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230813-230870 3 0.948
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211783-211840 3 0.948
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 JQ288021 Salmonella phage SPN3UB, complete genome 39451-39481 4 0.871
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MH370364 Salmonella phage S107, complete genome 29961-29991 4 0.871
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MH370382 Salmonella phage S135, complete genome 29961-29991 4 0.871
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MH370383 Salmonella phage S137, complete genome 29961-29991 4 0.871
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 46320-46350 4 0.871
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 CP031732 Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence 106829-106859 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 JQ288021 Salmonella phage SPN3UB, complete genome 39451-39481 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MH370364 Salmonella phage S107, complete genome 29961-29991 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MH370382 Salmonella phage S135, complete genome 29961-29991 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MH370383 Salmonella phage S137, complete genome 29961-29991 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 46320-46350 4 0.871
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 CP031732 Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence 106829-106859 4 0.871
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 CP031732 Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence 106828-106859 4 0.875
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229205-229262 4 0.931
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239699-239756 4 0.931
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230611-230668 4 0.931
CP029981_10 10.1|3876141|58|CP029981|CRISPRCasFinder 3876141-3876198 58 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211581-211638 4 0.931
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MT074430 Salmonella phage pink, complete genome 39867-39897 5 0.839
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NC_022752 Salmonella phage SETP13, complete genome 32824-32854 5 0.839
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 KY176369 Salmonella phage STP03, complete genome 33515-33545 5 0.839
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MT074430 Salmonella phage pink, complete genome 39867-39897 5 0.839
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NC_022752 Salmonella phage SETP13, complete genome 32824-32854 5 0.839
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 KY176369 Salmonella phage STP03, complete genome 33515-33545 5 0.839
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 JQ288021 Salmonella phage SPN3UB, complete genome 39451-39482 5 0.844
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MH370364 Salmonella phage S107, complete genome 29960-29991 5 0.844
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MH370382 Salmonella phage S135, complete genome 29960-29991 5 0.844
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MH370383 Salmonella phage S137, complete genome 29960-29991 5 0.844
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 46320-46351 5 0.844
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MT774487 Salmonella phage MG40, complete genome 21748-21778 6 0.806
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 JF974294 Aeromonas phage pIS4-A genomic sequence 3122-3152 6 0.806
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NC_021534 Vibrio phage pYD38-A genomic sequence 22143-22173 6 0.806
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MK422452 Klebsiella phage ST13-OXA48phi12.2, complete genome 711-741 6 0.806
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MT774487 Salmonella phage MG40, complete genome 21748-21778 6 0.806
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 JF974294 Aeromonas phage pIS4-A genomic sequence 3122-3152 6 0.806
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NC_021534 Vibrio phage pYD38-A genomic sequence 22143-22173 6 0.806
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MK422452 Klebsiella phage ST13-OXA48phi12.2, complete genome 711-741 6 0.806
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MT074430 Salmonella phage pink, complete genome 39866-39897 6 0.812
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NC_022752 Salmonella phage SETP13, complete genome 32823-32854 6 0.812
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 KY176369 Salmonella phage STP03, complete genome 33515-33546 6 0.812
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP017294 Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence 287556-287587 6 0.812
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 63616-63646 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 89139-89169 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 KY749247 Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence 6605-6635 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NC_047875 Salmonella phage UPF_BP1, complete genome 34432-34462 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 219120-219150 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 308963-308993 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 136399-136429 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 165928-165958 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 239059-239089 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 15259-15289 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 212209-212239 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 14232-14262 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 27947-27977 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 145038-145068 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 22242-22272 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 121446-121476 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 29623-29653 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 196979-197009 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 14194-14224 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 98867-98897 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 328711-328741 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 257027-257057 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 318755-318785 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 254185-254215 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 28253-28283 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 247615-247645 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 147480-147510 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 14189-14219 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 117411-117441 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 117046-117076 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 14193-14223 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 43102-43132 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 14232-14262 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 56837-56867 7 0.774
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 106308-106338 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 63616-63646 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 89139-89169 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 KY749247 Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence 6605-6635 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NC_047875 Salmonella phage UPF_BP1, complete genome 34432-34462 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 219120-219150 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 308963-308993 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 136399-136429 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 165928-165958 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 239059-239089 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 15259-15289 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 212209-212239 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 14232-14262 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 27947-27977 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 145038-145068 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 22242-22272 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 121446-121476 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 29623-29653 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 196979-197009 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 14194-14224 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 98867-98897 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 328711-328741 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 257027-257057 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 318755-318785 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 254185-254215 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 28253-28283 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 247615-247645 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 147480-147510 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 14189-14219 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 117411-117441 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 117046-117076 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 14193-14223 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 43102-43132 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 14232-14262 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 56837-56867 7 0.774
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 106308-106338 7 0.774
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MT774487 Salmonella phage MG40, complete genome 21747-21778 7 0.781
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 JF974294 Aeromonas phage pIS4-A genomic sequence 3122-3153 7 0.781
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NC_021534 Vibrio phage pYD38-A genomic sequence 22142-22173 7 0.781
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 278005-278036 7 0.781
CP029981_3 3.9|1395375|32|CP029981|CRT 1395375-1395406 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
CP029981_2 2.6|1369212|32|CP029981|CRISPRCasFinder,CRT 1369212-1369243 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP029981_3 3.1|1395192|31|CP029981|CRISPRCasFinder 1395192-1395222 31 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 24380-24410 8 0.742
CP029981_3 3.4|1395193|31|CP029981|PILER-CR 1395193-1395223 31 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 24380-24410 8 0.742
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 63616-63647 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 89139-89170 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 KY749247 Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence 6605-6636 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NC_047875 Salmonella phage UPF_BP1, complete genome 34431-34462 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 219120-219151 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 308963-308994 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 136398-136429 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 165927-165958 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 239058-239089 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 15259-15290 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 212209-212240 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 14232-14263 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 27946-27977 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 145037-145068 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 22241-22272 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 121446-121477 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 29623-29654 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 196979-197010 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 14194-14225 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 98867-98898 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 328710-328741 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 257026-257057 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 318754-318785 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 254185-254216 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 28253-28284 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 247615-247646 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 147479-147510 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 14189-14220 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 117411-117442 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 117046-117077 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 14193-14224 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 43102-43133 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 14232-14263 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 56836-56867 8 0.75
CP029981_3 3.6|1395192|32|CP029981|CRT 1395192-1395223 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 106307-106338 8 0.75
CP029981_2 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT 1369151-1369182 32 KU686197 Synechococcus phage S-CAM3 isolate 0808SB25, complete genome 123678-123709 9 0.719
CP029981_2 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT 1369151-1369182 32 KU686199 Synechococcus phage S-CAM3 isolate 1010CC42, complete genome 123684-123715 9 0.719
CP029981_2 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT 1369151-1369182 32 KU686198 Synechococcus phage S-CAM3 isolate 0910TB04, complete genome 123668-123699 9 0.719
CP029981_3 3.9|1395375|32|CP029981|CRT 1395375-1395406 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
CP029981_3 3.9|1395375|32|CP029981|CRT 1395375-1395406 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
CP029981_9 9.1|3842807|59|CP029981|CRISPRCasFinder 3842807-3842865 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
CP029981_9 9.1|3842807|59|CP029981|CRISPRCasFinder 3842807-3842865 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 5.1|3186434|40|CP029981|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 11.1|4186566|42|CP029981|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 11.2|4186625|40|CP029981|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

catggcgtagaaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
****************************************

4. spacer 3.9|1395375|32|CP029981|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 1, identity: 0.969 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
***********************.********

5. spacer 4.1|2564054|38|CP029981|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.948 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttt	Protospacer
 .**************.*****************************************

7. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.948 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttt	Protospacer
 .**************.*****************************************

8. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.948 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttt	Protospacer
 .**************.*****************************************

9. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.948 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttt	Protospacer
 .**************.*****************************************

10. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

11. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

12. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

13. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

14. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgccggatgagtg	Protospacer
********************** *.***  *

15. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to CP031732 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.871 

--agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
ataccagcc--tgccggtagagcctggtgatgg	Protospacer
  * *****  ********* ************

16. spacer 3.4|1395193|31|CP029981|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

17. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

18. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

19. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaat	Protospacer
************************.*** .

20. spacer 3.4|1395193|31|CP029981|PILER-CR matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgccggatgagtg	Protospacer
********************** *.***  *

21. spacer 3.4|1395193|31|CP029981|PILER-CR matches to CP031732 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.871 

--agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
ataccagcc--tgccggtagagcctggtgatgg	Protospacer
  * *****  ********* ************

22. spacer 3.6|1395192|32|CP029981|CRT matches to CP031732 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875 

--agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
ataccagcc--tgccggtagagcctggtgatggt	Protospacer
  * *****  ********* *************

23. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 4, identity: 0.931 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttc	Protospacer
 .**************.****************************************.

24. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 4, identity: 0.931 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttc	Protospacer
 .**************.****************************************.

25. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 4, identity: 0.931 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttc	Protospacer
 .**************.****************************************.

26. spacer 10.1|3876141|58|CP029981|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 4, identity: 0.931 

tgcgcgtcttatcaggtctacaaattcccgcgccatccgtaggccggataaggcgttt	CRISPR spacer
aacgcgtcttatcaggcctacaaattcccgcgccatccgtaggccggataaggcgttc	Protospacer
 .**************.****************************************.

27. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MT074430 (Salmonella phage pink, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

28. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NC_022752 (Salmonella phage SETP13, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

29. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to KY176369 (Salmonella phage STP03, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

30. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MT074430 (Salmonella phage pink, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

31. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NC_022752 (Salmonella phage SETP13, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

32. spacer 3.4|1395193|31|CP029981|PILER-CR matches to KY176369 (Salmonella phage STP03, complete genome) position: , mismatch: 5, identity: 0.839 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaat	Protospacer
************************. ** .

33. spacer 3.6|1395192|32|CP029981|CRT matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 5, identity: 0.844 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaatg	Protospacer
************************.*** .

34. spacer 3.6|1395192|32|CP029981|CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 5, identity: 0.844 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaatg	Protospacer
************************.*** .

35. spacer 3.6|1395192|32|CP029981|CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 5, identity: 0.844 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaatg	Protospacer
************************.*** .

36. spacer 3.6|1395192|32|CP029981|CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 5, identity: 0.844 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgatgaaatg	Protospacer
************************.*** .

37. spacer 3.6|1395192|32|CP029981|CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgccggatgagtgg	Protospacer
********************** *.***  *

38. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cccagccagtgccggtagtgcctgatgaaat	Protospacer
  **********************.*** .

39. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatg	Protospacer
 ********.************ ***.*  *

40. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatg	Protospacer
 ********.************ ***.*  *

41. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MK422452 (Klebsiella phage ST13-OXA48phi12.2, complete genome) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg-	CRISPR spacer
agcagccagcgccggtagtgcc-ggtagtacc	Protospacer
*********.************ ***..*.

42. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cccagccagtgccggtagtgcctgatgaaat	Protospacer
  **********************.*** .

43. spacer 3.4|1395193|31|CP029981|PILER-CR matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatg	Protospacer
 ********.************ ***.*  *

44. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatg	Protospacer
 ********.************ ***.*  *

45. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MK422452 (Klebsiella phage ST13-OXA48phi12.2, complete genome) position: , mismatch: 6, identity: 0.806 

agcagccagtgccggtagtgcctggtgatgg-	CRISPR spacer
agcagccagcgccggtagtgcc-ggtagtacc	Protospacer
*********.************ ***..*.

46. spacer 3.6|1395192|32|CP029981|CRT matches to MT074430 (Salmonella phage pink, complete genome) position: , mismatch: 6, identity: 0.812 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaatg	Protospacer
************************. ** .

47. spacer 3.6|1395192|32|CP029981|CRT matches to NC_022752 (Salmonella phage SETP13, complete genome) position: , mismatch: 6, identity: 0.812 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaatg	Protospacer
************************. ** .

48. spacer 3.6|1395192|32|CP029981|CRT matches to KY176369 (Salmonella phage STP03, complete genome) position: , mismatch: 6, identity: 0.812 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagtgcctgaagaaatg	Protospacer
************************. ** .

49. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP017294 (Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

--agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
gtaccggcc--tgccggtagtgcctgatgatcgt	Protospacer
  * *.***  ***************.**** **

50. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagcgccggtagtgcctccagaaaa	Protospacer
*********.*************   ** ..

51. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagcgccagtagtgcctgatagtta	Protospacer
*********.***.**********.*..* .

52. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to KY749247 (Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagcgtctgcgaacgc	Protospacer
******************.*.***  .*.*

53. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagtcagcgccggtagtgcctgaggaaat	Protospacer
*****.***.**************. ** .

54. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

55. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

56. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

57. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

58. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

59. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

60. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

61. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

62. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

63. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

64. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

65. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

66. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

67. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

68. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

69. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

70. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

71. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

72. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

73. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

74. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

75. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

76. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

77. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

78. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

79. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

80. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

81. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

82. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

83. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

84. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

85. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagcgccggtagtgcctccagaaaa	Protospacer
*********.*************   ** ..

86. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagcgccagtagtgcctgatagtta	Protospacer
*********.***.**********.*..* .

87. spacer 3.4|1395193|31|CP029981|PILER-CR matches to KY749247 (Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagccagtgccggtagcgtctgcgaacgc	Protospacer
******************.*.***  .*.*

88. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
agcagtcagcgccggtagtgcctgaggaaat	Protospacer
*****.***.**************. ** .

89. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

90. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

91. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

92. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

93. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

94. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

95. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

96. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

97. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

98. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

99. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

100. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

101. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

102. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

103. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

104. spacer 3.4|1395193|31|CP029981|PILER-CR matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

105. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

106. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

107. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

108. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

109. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

110. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

111. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

112. spacer 3.4|1395193|31|CP029981|PILER-CR matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

113. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

114. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

115. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

116. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

117. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

118. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

119. spacer 3.4|1395193|31|CP029981|PILER-CR matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.774 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagc	Protospacer
 ********.** ***********. ** *

120. spacer 3.6|1395192|32|CP029981|CRT matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 7, identity: 0.781 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cccagccagtgccggtagtgcctgatgaaatg	Protospacer
  **********************.*** .

121. spacer 3.6|1395192|32|CP029981|CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.781 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatgg	Protospacer
 ********.************ ***.*  *

122. spacer 3.6|1395192|32|CP029981|CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.781 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgccggtagtgccgggtaaatgg	Protospacer
 ********.************ ***.*  *

123. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 7, identity: 0.781 

--agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
attccggcc--tgccggtagagcctggtgattgt	Protospacer
    *.***  ********* ********** **

124. spacer 3.9|1395375|32|CP029981|CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781 

gacgcactggatgcgatgatggatatcacttg-	CRISPR spacer
gacgcactgtatgcaatgatgga-atcggaggc	Protospacer
********* ****.******** ***.   *

125. spacer 2.6|1369212|32|CP029981|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

126. spacer 3.1|1395192|31|CP029981|CRISPRCasFinder matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagtgccggtagttcctcctgccat	Protospacer
 ****************** ***  ** ..

127. spacer 3.4|1395193|31|CP029981|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

agcagccagtgccggtagtgcctggtgatgg	CRISPR spacer
cgcagccagtgccggtagttcctcctgccat	Protospacer
 ****************** ***  ** ..

128. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagcgccggtagtgcctccagaaaag	Protospacer
*********.*************   ** ..

129. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagcgccagtagtgcctgatagttac	Protospacer
*********.***.**********.*..* ..

130. spacer 3.6|1395192|32|CP029981|CRT matches to KY749247 (Salmonella enterica subsp. enterica serovar Paratyphi B plasmid R1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagccagtgccggtagcgtctgcgaacgca	Protospacer
******************.*.***  .*.*

131. spacer 3.6|1395192|32|CP029981|CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
agcagtcagcgccggtagtgcctgaggaaatc	Protospacer
*****.***.**************. ** . .

132. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

133. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

134. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

135. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

136. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

137. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

138. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

139. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

140. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

141. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

142. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

143. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

144. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

145. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

146. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

147. spacer 3.6|1395192|32|CP029981|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

148. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

149. spacer 3.6|1395192|32|CP029981|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

150. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

151. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

152. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

153. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

154. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

155. spacer 3.6|1395192|32|CP029981|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

156. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

157. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

158. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

159. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

160. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

161. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

162. spacer 3.6|1395192|32|CP029981|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 8, identity: 0.75 

agcagccagtgccggtagtgcctggtgatggt	CRISPR spacer
cgcagccagcgcaggtagtgcctgaagaagcc	Protospacer
 ********.** ***********. ** * .

163. spacer 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 9, identity: 0.719 

tcactgtatacccaactattggagatcatgta	CRISPR spacer
caactgtatacgaaactattggagacccagat	Protospacer
. *********  ************.*  *

164. spacer 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 9, identity: 0.719 

tcactgtatacccaactattggagatcatgta	CRISPR spacer
caactgtatacgaaactattggagacccagat	Protospacer
. *********  ************.*  *

165. spacer 2.5|1369151|32|CP029981|CRISPRCasFinder,CRT matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 9, identity: 0.719 

tcactgtatacccaactattggagatcatgta	CRISPR spacer
caactgtatacgaaactattggagacccagat	Protospacer
. *********  ************.*  *

166. spacer 3.9|1395375|32|CP029981|CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggccgaggc	Protospacer
******** ************** ..*.

167. spacer 3.9|1395375|32|CP029981|CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggcagaagc	Protospacer
******** ************** .. .

168. spacer 9.1|3842807|59|CP029981|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831 

-cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc	CRISPR spacer
tcagtgcac-gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctc	Protospacer
 *.* ****  **.**************************** ************   .*

169. spacer 9.1|3842807|59|CP029981|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814 

cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc-	CRISPR spacer
ggtacggctttttgccggatgcggcgtaaacgccttatccggcctacggtt-tggtgcga	Protospacer
 * *  .*** ****************.*********************** ***..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage