CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Target MGE spacer number	Prophage number
CP030108	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2, complete sequence	0 crisprs	NA	0	0
CP030107	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence	1 crisprs	NA	2	0
CP030109	Acinetobacter baumannii strain DA33382 plasmid pDA33382-85, complete sequence	0 crisprs	NA	0	0
CP030106	Acinetobacter baumannii strain DA33382 chromosome, complete genome	0 crisprs	DEDDh,csa3,cas3,WYL,cas6f,cas7f,cas5f,cas8f,cas3f,cas1	0	7

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP030107_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP030107_1

359-483

Orphan

Consensus_repeat	Method
ATATGTGGACACTTACCTTGCAA	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP030107_1

>merge|CP030107|1|359-483|CRISPRCasFinder
ATATGTGGACACTTACCTTGCAATATGTGGACACTTACCTTGCAAGATTTTTTCAATATGTGGACACTTACCTTGCAAGTACTGACAAAAAAAATATTGTCCATAAAACAGCATTTACCTTGCAA

>CP030107|1|1|359-483|CRISPRCasFinder
ATATGTGGACACTTACCTTGCAA	TATGTGGACACTTACCTTGCAAGATTTTTTCA
ATATGTGGACACTTACCTTGCAA	GTACTGACAAAAAAAATATTGTCC
ATAAAACAGCATTTACCTTGCAA

>CP030107.1|AXB17573.1|572_1514_+|replication-initiation-protein
MKDLIVKDNALINASYNLDLVEQRLILLSIIEARESGKGINANDPLTIHAESYINHFNVHRNTAYQALKDACKDLFARQFSYQEQRGKGIANITSRWVSQIAYIDNTASVELIFAPAIIPLITRLEEQFTSYELQQIKGLSTAYAIRLYELLIAWRSTGKTPIIETQELRRKLGVLDGEYKMIADFKKRVFEPSIKQINEHTDITVKSEQHKTGRSITGFSFRFKQKAQPKLEQKTDPKRDPNTPDFFVEMTDAQRHLFGNKLAHDARVQSEYSHLIGTGSYEDFAKLLADMLAEEQHFKMFYPLLVEHGYKA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP030107_1	1.1\|382\|32\|CP030107\|CRISPRCasFinder	382-413	32	NZ_CP030107	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence	382-413	0	1.0
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP030107	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence	437-460	0	1.0
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP025885	Escherichia coli strain 503440 plasmid p503440_68, complete sequence	59591-59614	3	0.875
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP037863	Citrobacter sp. LY-1 plasmid unnamed2, complete sequence	79717-79740	3	0.875
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP012835	Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence	27552-27575	3	0.875
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP024882	Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence	20053-20076	3	0.875
CP030107_1	1.2\|437\|24\|CP030107\|CRISPRCasFinder	437-460	24	NZ_CP024977	Escherichia coli strain CV839-15 plasmid pCV839-15-p3, complete sequence	7765-7788	3	0.875
CP030107_1	1.1\|382\|32\|CP030107\|CRISPRCasFinder	382-413	32	NZ_CP030107	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence	360-391	5	0.844
CP030107_1	1.1\|382\|32\|CP030107\|CRISPRCasFinder	382-413	32	NZ_CP030107	Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence	415-446	7	0.781

1. spacer 1.1|382|32|CP030107|CRISPRCasFinder matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 0, identity: 1.0

tatgtggacacttaccttgcaagattttttca	CRISPR spacer
tatgtggacacttaccttgcaagattttttca	Protospacer
********************************

2. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtactgacaaaaaaaatattgtcc	CRISPR spacer
gtactgacaaaaaaaatattgtcc	Protospacer
************************

3. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP025885 (Escherichia coli strain 503440 plasmid p503440_68, complete sequence) position: , mismatch: 3, identity: 0.875

gtactgacaaaaaaaatattgtcc	CRISPR spacer
tttctgataaaaaaaatattgtcc	Protospacer
 * ****.****************

4. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP037863 (Citrobacter sp. LY-1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

gtactgacaaaaaaaatattgtcc	CRISPR spacer
tttctgataaaaaaaatattgtcc	Protospacer
 * ****.****************

5. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 3, identity: 0.875

gtactgacaaaaaaaatattgtcc	CRISPR spacer
tttctgataaaaaaaatattgtcc	Protospacer
 * ****.****************

6. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 3, identity: 0.875

gtactgacaaaaaaaatattgtcc	CRISPR spacer
tttctgataaaaaaaatattgtcc	Protospacer
 * ****.****************

7. spacer 1.2|437|24|CP030107|CRISPRCasFinder matches to NZ_CP024977 (Escherichia coli strain CV839-15 plasmid pCV839-15-p3, complete sequence) position: , mismatch: 3, identity: 0.875

gtactgacaaaaaaaatattgtcc	CRISPR spacer
tttctgataaaaaaaatattgtcc	Protospacer
 * ****.****************

8. spacer 1.1|382|32|CP030107|CRISPRCasFinder matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 5, identity: 0.844

tatgtggacacttaccttgcaagattttttca	CRISPR spacer
tatgtggacacttaccttgcaatatgtggaca	Protospacer
********************** ** *   **

9. spacer 1.1|382|32|CP030107|CRISPRCasFinder matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 7, identity: 0.781

tatgtggacacttaccttgcaagattttttca	CRISPR spacer
tatgtggacacttaccttgcaagtactgacaa	Protospacer
***********************  .*  . *

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

2. CP030106

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity

Prophage detection

Region

Region Position

Protein_number

Hit_taxonomy

Key_proteins

Att_site

Prophage annotation

DBSCAN-SWA_1

122295 : 136881

Acinetobacter_phage(50.0%)

The bacterium proteins that are colored denote the protein is present at specific phage-related keywords (such as 'capsid', 'head', 'integrase', 'plate', 'tail', 'fiber', 'coat', 'transposase', 'portal', 'terminase', 'protease' or 'lysin' and 'tRNA')

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB13988.1\|122295_122640_-	hypothetical protein	A0A0P0IYD2	Acinetobacter_phage	7.4e-38	78.8
AXB13989.1\|122636_123146_-	hypothetical protein	A0A0P0I8H3	Acinetobacter_phage	1.1e-32	85.1
AXB13990.1\|123142_123679_-	hypothetical protein	NA	NA	NA	NA
AXB13991.1\|123671_123851_-	hypothetical protein	NA	NA	NA	NA
AXB13992.1\|123851_124142_-	hypothetical protein	NA	NA	NA	NA
AXB13993.1\|124282_125311_-	ead/Ea22-like family protein	A0A2I7QY11	Vibrio_phage	3.8e-13	29.0
AXB13994.1\|125323_126004_-	3'-5' exonuclease	NA	NA	NA	NA
AXB13995.1\|126178_126550_-	hypothetical protein	A0A0D4DCB5	Acinetobacter_phage	6.4e-11	40.0
AXB17389.1\|126546_126876_-	hypothetical protein	NA	NA	NA	NA
AXB13996.1\|126956_127295_-	hypothetical protein	A0A0P0ZGH3	Escherichia_phage	1.6e-13	39.3
AXB13997.1\|127489_127774_-	hypothetical protein	NA	NA	NA	NA
AXB13998.1\|127777_128542_-	S24 family peptidase	A0A0P0I8E0	Acinetobacter_phage	1.6e-77	63.0
AXB13999.1\|128677_128881_+	transcriptional regulator	NA	NA	NA	NA
AXB14000.1\|128916_129291_+	hypothetical protein	NA	NA	NA	NA
AXB14001.1\|129324_129525_+	hypothetical protein	NA	NA	NA	NA
AXB14002.1\|129521_129707_+	hypothetical protein	NA	NA	NA	NA
AXB14003.1\|129703_130159_+	hypothetical protein	NA	NA	NA	NA
AXB14004.1\|130155_130794_+	hypothetical protein	M1F3E2	Salmonella_phage	9.0e-29	39.9
AXB14005.1\|130790_131765_+	phosphoadenosine phosphosulfate reductase	A4JX51	Burkholderia_virus	2.7e-77	47.7
AXB14006.1\|131770_132157_+	hypothetical protein	NA	NA	NA	NA
AXB14007.1\|132153_133632_+	DNA cytosine methyltransferase	A0A1I9KFD6	Aeromonas_phage	9.7e-135	53.3
AXB14008.1\|133635_134679_+	hypothetical protein	A0A2H4J580	uncultured_Caudovirales_phage	4.3e-28	52.8
AXB14009.1\|134675_135440_+	AAA family ATPase	A0A0D4DBZ2	Acinetobacter_phage	1.0e-63	48.8
AXB14010.1\|135436_135970_+	hypothetical protein	NA	NA	NA	NA
AXB14011.1\|136425_136881_+	hypothetical protein	A0A0P0HSF5	Acinetobacter_phage	2.2e-53	68.9

DBSCAN-SWA_2

273863 : 285533

Acinetobacter_phage(30.0%)

head

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB14144.1\|273863_274322_+	hypothetical protein	A0A0P0HSF5	Acinetobacter_phage	2.0e-30	46.6
AXB14145.1\|274630_274975_+	hypothetical protein	NA	NA	NA	NA
AXB14146.1\|275722_276205_+	DUF2280 domain-containing protein	A0A0P0HSK4	Acinetobacter_phage	2.2e-67	85.8
AXB14147.1\|276182_277673_+	helicase	I3PGT7	Xanthomonas_phage	1.4e-88	41.2
AXB14148.1\|277681_279016_+	DUF1073 domain-containing protein	M4SN90	Psychrobacter_phage	3.7e-85	40.0
AXB14149.1\|278960_279773_+\|head	phage head morphogenesis protein	M4T3R2	Psychrobacter_phage	2.7e-54	42.1
AXB14150.1\|279852_280041_+	DUF2158 domain-containing protein	NA	NA	NA	NA
AXB14151.1\|280081_280714_+	hypothetical protein	U5U717	Lactobacillus_phage	2.8e-06	24.5
AXB14152.1\|280767_281967_+	DUF2213 domain-containing protein	A0A2I7R2U8	Vibrio_phage	2.0e-21	28.5
AXB14153.1\|281985_282456_+	hypothetical protein	M4T3R5	Psychrobacter_phage	8.1e-19	41.8
AXB14154.1\|282459_282951_+	hypothetical protein	NA	NA	NA	NA
AXB14155.1\|282947_283946_+	fibronectin type III domain-containing protein	NA	NA	NA	NA
AXB14156.1\|284006_284993_-	right-handed parallel beta-helix repeat-containing protein	U5PSS0	Bacillus_phage	5.7e-14	31.7
AXB14157.1\|285143_285533_+	hypothetical protein	A0A0P0I8L9	Acinetobacter_phage	1.1e-64	96.9

DBSCAN-SWA_3

1441950 : 1462858

Acinetobacter_phage(42.11%)

head,tail,integrase

attL 1446818:1446833|attR 1468777:1468792

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB15202.1\|1441950_1444029_-	carbohydrate-binding protein	A0A1B1IW99	uncultured_Mediterranean_phage	8.8e-33	27.3
AXB15203.1\|1444028_1444589_-	hypothetical protein	A0A1B1IRI7	uncultured_Mediterranean_phage	9.0e-25	37.4
AXB15204.1\|1444900_1445800_-	hypothetical protein	A0A1B1IRE8	uncultured_Mediterranean_phage	5.0e-17	27.7
AXB15205.1\|1445811_1446435_-	hypothetical protein	NA	NA	NA	NA
AXB15206.1\|1446427_1446913_-	hypothetical protein	NA	NA	NA	NA
1446818:1446833	attL	NA	NA	NA	NA
AXB15207.1\|1446909_1448553_-\|head,tail	phage head-tail adapter protein	A0A2H4J3N6	uncultured_Caudovirales_phage	7.3e-123	44.6
AXB15208.1\|1448554_1448785_-	hypothetical protein	NA	NA	NA	NA
AXB15209.1\|1448784_1449108_-	hypothetical protein	NA	NA	NA	NA
AXB15210.1\|1449381_1449585_-	hypothetical protein	NA	NA	NA	NA
AXB15211.1\|1449574_1449811_-	hypothetical protein	NA	NA	NA	NA
AXB15212.1\|1449807_1450131_-	hypothetical protein	NA	NA	NA	NA
AXB15213.1\|1450134_1450467_-	hypothetical protein	E2GLW0	Acinetobacter_phage	2.0e-11	44.7
AXB15214.1\|1450459_1450645_-	hypothetical protein	A0A0D4DCN1	Acinetobacter_phage	2.5e-24	96.4
AXB15215.1\|1450710_1450890_-	hypothetical protein	A0A0D4DCD9	Acinetobacter_phage	1.0e-22	83.1
AXB15216.1\|1450882_1451263_-	hypothetical protein	A0A068CDI0	Acinetobacter_phage	8.0e-09	33.8
AXB15217.1\|1451259_1451916_-	hypothetical protein	A0A0N7IRF9	Acinetobacter_phage	1.2e-121	93.1
AXB15218.1\|1451912_1452317_-	hypothetical protein	NA	NA	NA	NA
AXB15219.1\|1452334_1452754_-	hypothetical protein	H2DE79	Erwinia_phage	5.5e-27	50.8
AXB15220.1\|1452740_1453106_-	hypothetical protein	NA	NA	NA	NA
AXB15221.1\|1453954_1454827_-	hypothetical protein	A0A2H4J580	uncultured_Caudovirales_phage	6.7e-43	39.3
AXB15222.1\|1454866_1455202_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA
AXB15223.1\|1455210_1455393_-	hypothetical protein	NA	NA	NA	NA
AXB15224.1\|1455504_1456188_+	helix-turn-helix domain-containing protein	A0A1I9KG86	Aeromonas_phage	6.9e-27	39.2
AXB15225.1\|1456205_1456697_+	hypothetical protein	NA	NA	NA	NA
AXB15226.1\|1456891_1457083_+	hypothetical protein	NA	NA	NA	NA
AXB15227.1\|1457082_1457280_+	hypothetical protein	NA	NA	NA	NA
AXB15228.1\|1457279_1457600_+	hypothetical protein	NA	NA	NA	NA
AXB15229.1\|1457592_1458348_+	hypothetical protein	I2GUJ1	Acinetobacter_phage	1.8e-60	53.5
AXB15230.1\|1458344_1458731_+	hypothetical protein	NA	NA	NA	NA
AXB15231.1\|1458730_1458958_+	hypothetical protein	I2GUH8	Acinetobacter_phage	5.4e-21	70.6
AXB15232.1\|1458967_1459741_+	phage recombination protein Bet	A0A088CBI3	Shigella_phage	4.0e-55	63.7
AXB15233.1\|1459721_1460330_+	exonuclease	A0A2H4J882	uncultured_Caudovirales_phage	4.6e-83	75.8
AXB15234.1\|1460326_1460644_+	hypothetical protein	NA	NA	NA	NA
AXB15235.1\|1460654_1461035_+	hypothetical protein	NA	NA	NA	NA
AXB15236.1\|1461031_1461334_+	hypothetical protein	A0A2I7QNA8	Vibrio_phage	7.8e-07	35.7
AXB15237.1\|1461330_1461516_+	hypothetical protein	A0A1X9SFM6	Acinetobacter_phage	5.2e-30	100.0
AXB15238.1\|1461551_1461842_+	DNA-binding protein	NA	NA	NA	NA
AXB15239.1\|1461838_1462858_-\|integrase	site-specific integrase	A0A0R6PHH4	Moraxella_phage	1.9e-68	43.1
1468777:1468792	attR	NA	NA	NA	NA

DBSCAN-SWA_4

1496128 : 1551765

Acinetobacter_phage(86.84%)

transposase,terminase,head,capsid,tRNA,tail

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB17442.1\|1496128_1496857_-\|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	NA	NA	NA	NA
AXB15272.1\|1496961_1497741_+	ferredoxin--NADP reductase	NA	NA	NA	NA
AXB15273.1\|1497795_1498665_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA
AXB15274.1\|1498894_1500361_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA
AXB15275.1\|1500417_1501788_+	U32 family peptidase	Q6DW11	Phage_TP	9.0e-127	63.1
AXB15276.1\|1501790_1502054_+	(4Fe-4S)-binding protein	A0A1B1IWY9	uncultured_Mediterranean_phage	7.7e-19	50.6
AXB15277.1\|1502290_1502620_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA
AXB15278.1\|1503477_1504191_-	histidine ABC transporter permease HisM	NA	NA	NA	NA
AXB15279.1\|1504187_1504877_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA
AXB15280.1\|1504968_1505754_-	ABC transporter substrate-binding protein	NA	NA	NA	NA
AXB15281.1\|1505928_1506960_-	LysR family transcriptional regulator	NA	NA	NA	NA
AXB15282.1\|1507157_1508378_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA
AXB15283.1\|1508384_1511564_+	multidrug efflux RND transporter permease subunit	S5VTK5	Leptospira_phage	3.3e-63	21.5
AXB15284.1\|1511576_1513025_+	RND transporter	NA	NA	NA	NA
AXB15285.1\|1513065_1514319_-	serine hydroxymethyltransferase	A0A219Y950	Aeromonas_phage	2.3e-97	52.3
AXB15286.1\|1514379_1514532_+	hypothetical protein	NA	NA	NA	NA
AXB15287.1\|1514564_1515794_-	alpha/beta fold hydrolase	NA	NA	NA	NA
AXB15288.1\|1516043_1516730_+	3'-5' exonuclease	A0A059VJT9	Pseudomonas_phage	1.8e-35	41.6
AXB15289.1\|1516877_1517510_+	hypothetical protein	NA	NA	NA	NA
AXB15290.1\|1517767_1517956_-	hypothetical protein	A0A1B1P9F8	Acinetobacter_phage	1.1e-27	96.7
AXB15291.1\|1518252_1518774_+	DUF4760 domain-containing protein	NA	NA	NA	NA
AXB15292.1\|1518940_1519495_-	lysozyme	A0A068CDE9	Acinetobacter_phage	1.3e-79	79.9
AXB15293.1\|1519484_1519703_-	hypothetical protein	NA	NA	NA	NA
AXB15294.1\|1519699_1520056_-	hypothetical protein	NA	NA	NA	NA
AXB15295.1\|1520122_1523569_-	hypothetical protein	J7HXG3	Acinetobacter_phage	0.0e+00	98.2
AXB15296.1\|1523561_1523924_-	hypothetical protein	A0A0P0J0A2	Acinetobacter_phage	1.4e-50	78.3
AXB15297.1\|1523920_1524427_-	DUF1833 domain-containing protein	J7HXQ5	Acinetobacter_phage	3.8e-91	98.2
AXB15298.1\|1524426_1524825_-	hypothetical protein	J7I0X8	Acinetobacter_phage	3.1e-72	97.7
AXB15299.1\|1524961_1525669_-	hypothetical protein	NA	NA	NA	NA
AXB15300.1\|1525695_1526340_-	hypothetical protein	NA	NA	NA	NA
AXB15301.1\|1526329_1527061_-	hypothetical protein	NA	NA	NA	NA
AXB15302.1\|1527529_1531837_-\|tail	phage tail tape measure protein	A0A0D4DC37	Acinetobacter_phage	0.0e+00	97.1
AXB15303.1\|1531914_1532190_-	hypothetical protein	NA	NA	NA	NA
AXB15304.1\|1532208_1532730_-	DUF4468 domain-containing protein	A0A0P0I8L3	Acinetobacter_phage	7.8e-63	67.8
AXB15305.1\|1532816_1533053_-	transcriptional regulator	NA	NA	NA	NA
AXB15306.1\|1533261_1534191_+	ORF6N domain-containing protein	A0A0P0J0J7	Acinetobacter_phage	4.7e-87	86.5
AXB15307.1\|1534305_1535016_-	DUF3800 domain-containing protein	NA	NA	NA	NA
AXB15308.1\|1535309_1535639_-	hypothetical protein	A0A1B1P9F7	Acinetobacter_phage	3.5e-29	62.4
AXB15309.1\|1535566_1536082_-	hypothetical protein	A0A0N7IRG3	Acinetobacter_phage	1.1e-72	98.5
AXB15310.1\|1536151_1537069_-	hypothetical protein	A0A0P0IL42	Acinetobacter_phage	1.5e-162	94.4
AXB15311.1\|1537164_1538262_-\|tail	phage tail protein	A0A0N7IRE5	Acinetobacter_phage	7.1e-74	41.0
AXB15312.1\|1538261_1538612_-	hypothetical protein	J7I469	Acinetobacter_phage	1.4e-52	88.9
AXB15313.1\|1538707_1538926_-	hypothetical protein	A0A0D4DC29	Acinetobacter_phage	1.5e-31	95.8
AXB15314.1\|1538927_1539371_-	hypothetical protein	A0A0D4DBX3	Acinetobacter_phage	4.4e-67	86.4
AXB15315.1\|1539327_1539696_-	HK97 gp10 family phage protein	A0A0D4DBN1	Acinetobacter_phage	2.6e-52	80.3
AXB17443.1\|1539667_1540072_-	hypothetical protein	A0A0P0IKR8	Acinetobacter_phage	2.2e-65	91.7
AXB15316.1\|1540080_1540449_-	glutamate 5-kinase	A0A0P0I456	Acinetobacter_phage	1.2e-62	95.1
AXB15317.1\|1540450_1540840_-	hypothetical protein	A0A0D4DC24	Acinetobacter_phage	7.3e-66	98.4
AXB15318.1\|1540844_1541510_-	stress-responsive nuclear envelope protein	J7I4P7	Acinetobacter_phage	2.6e-111	96.8
AXB15319.1\|1541575_1542532_-\|capsid	phage capsid protein	A0A0D4DBM4	Acinetobacter_phage	4.8e-175	97.5
AXB15320.1\|1542559_1543327_-	hypothetical protein	J7I0W4	Acinetobacter_phage	4.6e-120	100.0
AXB15321.1\|1543440_1543632_-	hypothetical protein	A0A0P0IKM2	Acinetobacter_phage	1.7e-28	100.0
AXB15322.1\|1543849_1544092_-	hypothetical protein	A0A0D4DC19	Acinetobacter_phage	3.6e-39	100.0
AXB17444.1\|1544190_1544469_-	hypothetical protein	A0A0P0I8B5	Acinetobacter_phage	1.5e-44	100.0
AXB15323.1\|1544618_1545581_-\|transposase	IS30 family transposase	NA	NA	NA	NA
AXB15324.1\|1545704_1546808_-\|head	phage head morphogenesis protein	A0A0D4DBL9	Acinetobacter_phage	2.7e-206	100.0
AXB15325.1\|1546809_1548261_-	DUF4055 domain-containing protein	A0A0D4DCP1	Acinetobacter_phage	3.2e-284	99.6
AXB15326.1\|1548257_1549685_-\|terminase	terminase	J7I460	Acinetobacter_phage	7.6e-270	100.0
AXB15327.1\|1549674_1550145_-	DUF2280 domain-containing protein	A0A0D4DC15	Acinetobacter_phage	3.0e-82	100.0
AXB15328.1\|1550203_1550845_-	hypothetical protein	A0A0D4DBV4	Acinetobacter_phage	6.7e-125	98.1
AXB15329.1\|1550813_1551248_-	hypothetical protein	A0A0P0IVP9	Acinetobacter_phage	3.4e-80	100.0
AXB15330.1\|1551309_1551765_-	hypothetical protein	A0A0P0HSF5	Acinetobacter_phage	1.0e-82	98.0

DBSCAN-SWA_5

1555071 : 1680527

146

Acinetobacter_phage(80.43%)

integrase,terminase,head,capsid,tRNA,tail

attL 1563495:1563550|attR 1660410:1660465

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB15336.1\|1555071_1555548_-	hypothetical protein	A0A2H4J548	uncultured_Caudovirales_phage	1.2e-25	40.3
AXB15337.1\|1555544_1555937_-	DUF559 domain-containing protein	A0A1B1P9J0	Acinetobacter_phage	2.1e-52	80.8
AXB15338.1\|1555933_1556245_-	hypothetical protein	A0A0D4DCM1	Acinetobacter_phage	1.1e-59	95.1
AXB15339.1\|1556235_1556685_-	hypothetical protein	A0A0D4DBZ8	Acinetobacter_phage	3.4e-14	64.1
AXB15340.1\|1556688_1557021_-	hypothetical protein	E2GLW0	Acinetobacter_phage	2.0e-11	44.7
AXB15341.1\|1557013_1557199_-	hypothetical protein	A0A0D4DCN1	Acinetobacter_phage	2.5e-24	96.4
AXB15342.1\|1557264_1557444_-	hypothetical protein	A0A0D4DCD9	Acinetobacter_phage	1.0e-22	83.1
AXB15343.1\|1557436_1557748_-	hypothetical protein	A0A0P0I8J0	Acinetobacter_phage	1.8e-35	73.1
AXB15344.1\|1557917_1558169_-	hypothetical protein	A0A0P0IE39	Acinetobacter_phage	5.6e-35	88.0
AXB15345.1\|1558165_1559491_-	DNA helicase	A0A0P0IVX0	Acinetobacter_phage	1.3e-247	98.2
AXB15346.1\|1559490_1560234_-	replication protein	A0A0P0HSN8	Acinetobacter_phage	1.1e-46	91.6
AXB15347.1\|1560366_1560549_-	hypothetical protein	A0A1B1P9H5	Acinetobacter_phage	2.0e-10	77.3
AXB15348.1\|1560600_1560867_-	hypothetical protein	A0A1B1P9I3	Acinetobacter_phage	1.2e-32	79.5
AXB15349.1\|1560877_1561108_-	hypothetical protein	A0A1B1P9I7	Acinetobacter_phage	1.6e-36	100.0
AXB15350.1\|1561232_1561979_+	helix-turn-helix domain-containing protein	A0A1B1P9J5	Acinetobacter_phage	1.3e-140	100.0
AXB15351.1\|1561988_1562198_+	hypothetical protein	A0A1B1P9G7	Acinetobacter_phage	2.5e-28	98.5
AXB15352.1\|1562692_1563007_-	hypothetical protein	NA	NA	NA	NA
AXB15353.1\|1563067_1563298_+	hypothetical protein	NA	NA	NA	NA
AXB17445.1\|1563281_1563497_-	hypothetical protein	NA	NA	NA	NA
1563495:1563550	attL	NA	NA	NA	NA
AXB17446.1\|1563699_1564077_+	hypothetical protein	A0A068CDD9	Acinetobacter_phage	7.7e-12	38.3
AXB17447.1\|1564096_1564363_+	hypothetical protein	NA	NA	NA	NA
AXB15354.1\|1564362_1564653_+	hypothetical protein	NA	NA	NA	NA
AXB15355.1\|1564662_1565514_+	nuclease	G8CLD3	Synechococcus_phage	9.5e-34	31.6
AXB15356.1\|1565516_1566413_+	hypothetical protein	NA	NA	NA	NA
AXB15357.1\|1566417_1566675_+	hypothetical protein	K4HYN5	Acinetobacter_phage	3.6e-29	77.5
AXB15358.1\|1566671_1566935_+	hypothetical protein	NA	NA	NA	NA
AXB15359.1\|1567283_1567493_+	hypothetical protein	A0A0P0IRG7	Acinetobacter_phage	3.7e-32	94.2
AXB15360.1\|1567489_1567705_+	hypothetical protein	NA	NA	NA	NA
AXB15361.1\|1567716_1567986_+	hypothetical protein	A0A1B1P9G0	Acinetobacter_phage	4.7e-48	100.0
AXB15362.1\|1567982_1568969_-\|integrase	site-specific integrase	A0A1B1P9F9	Acinetobacter_phage	2.9e-183	97.9
AXB15363.1\|1569266_1570202_+	ABC transporter ATP-binding protein	W6JKT0	Anomala_cuprea_entomopoxvirus	8.3e-23	30.0
AXB15364.1\|1570198_1570972_+	ABC transporter permease	NA	NA	NA	NA
AXB15365.1\|1570968_1571781_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	A0A126HHM5	Vibrio_phage	5.0e-40	37.2
AXB15366.1\|1571804_1572455_+	hypothetical protein	NA	NA	NA	NA
AXB15367.1\|1572583_1573726_+	rod shape-determining protein RodA	NA	NA	NA	NA
AXB15368.1\|1573745_1574747_+	lytic murein transglycosylase B	NA	NA	NA	NA
AXB15369.1\|1575037_1575655_+	septal ring lytic transglycosylase RlpA family protein	F5B3X9	Synechococcus_phage	2.1e-22	45.5
AXB15370.1\|1576210_1576663_+	DUF962 domain-containing protein	NA	NA	NA	NA
AXB15371.1\|1576703_1577021_-	AzlD domain-containing protein	NA	NA	NA	NA
AXB15372.1\|1577022_1577739_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA
AXB15373.1\|1577833_1578658_-	AraC family transcriptional regulator	NA	NA	NA	NA
AXB15374.1\|1578755_1579241_-	DUF3465 domain-containing protein	NA	NA	NA	NA
AXB15375.1\|1579306_1580182_-	elongation factor Ts	NA	NA	NA	NA
AXB15376.1\|1580319_1581072_-	30S ribosomal protein S2	NA	NA	NA	NA
AXB15377.1\|1581281_1582109_+	type I methionyl aminopeptidase	NA	NA	NA	NA
AXB15378.1\|1582313_1583432_+	OmpW family protein	NA	NA	NA	NA
AXB15379.1\|1583841_1585188_+	MFS transporter	NA	NA	NA	NA
AXB15380.1\|1585362_1586577_+	MFS transporter	NA	NA	NA	NA
AXB15381.1\|1586820_1588233_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA
AXB15382.1\|1588429_1589443_+	lipoyl synthase	NA	NA	NA	NA
AXB15383.1\|1589726_1592192_+	acyl-CoA dehydrogenase	NA	NA	NA	NA
AXB15384.1\|1592295_1592679_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA
AXB15385.1\|1592717_1593254_-	peptidase C39	NA	NA	NA	NA
AXB15386.1\|1593475_1594858_+	adenosylhomocysteinase	S4W1G4	Pandoravirus	2.0e-41	30.6
AXB17448.1\|1594929_1595766_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA
AXB15387.1\|1595784_1596507_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA
AXB15388.1\|1596641_1599491_+	EAL domain-containing protein	NA	NA	NA	NA
AXB15389.1\|1599727_1601998_+	NADP-dependent malic enzyme	NA	NA	NA	NA
AXB15390.1\|1602089_1603328_+\|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	A0A0F6YPT7	Sinorhizobium_phage	1.6e-90	47.3
AXB17449.1\|1603377_1604553_-	PDZ domain-containing protein	W5SAB9	Pithovirus	8.0e-07	29.6
AXB15391.1\|1604746_1605505_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA
AXB15392.1\|1605650_1606277_+	superoxide dismutase	NA	NA	NA	NA
AXB15393.1\|1606897_1607341_+	DUF2726 domain-containing protein	NA	NA	NA	NA
AXB15394.1\|1607350_1607551_-	hypothetical protein	NA	NA	NA	NA
AXB15395.1\|1607661_1609119_-	alpha/beta hydrolase	NA	NA	NA	NA
AXB15396.1\|1609229_1610108_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA
AXB15397.1\|1610104_1610614_-	chorismate--pyruvate lyase	NA	NA	NA	NA
AXB17450.1\|1610739_1612149_-	type I glutamate--ammonia ligase	NA	NA	NA	NA
AXB15398.1\|1612889_1614431_+	MFS transporter	A0A0P0IY73	Acinetobacter_phage	5.7e-287	99.4
AXB15399.1\|1614427_1616230_+	aminopeptidase P family protein	A0A0P0I8D7	Acinetobacter_phage	0.0e+00	97.5
AXB15400.1\|1616717_1617914_+	DUF4102 domain-containing protein	A0A0D4DBR3	Acinetobacter_phage	9.7e-226	99.7
AXB15401.1\|1617910_1618105_-	hypothetical protein	A0A0D4DBH0	Acinetobacter_phage	3.8e-31	100.0
AXB15402.1\|1618496_1618814_-	anaerobic dehydrogenase	E5KY21	Escherichia_phage	6.7e-25	58.5
AXB15403.1\|1618814_1619360_-	hypothetical protein	A0A0D4DCJ5	Acinetobacter_phage	1.5e-93	92.7
AXB15404.1\|1619398_1619788_-	hypothetical protein	J7I481	Acinetobacter_phage	4.3e-58	84.5
AXB15405.1\|1619874_1628430_-\|tail	phage tail protein	A0A0R6PIC9	Moraxella_phage	2.3e-10	39.8
AXB15406.1\|1628496_1629168_-\|tail	tail assembly protein	A0A0R6PIW1	Moraxella_phage	4.1e-40	47.3
AXB15407.1\|1629151_1629907_-\|tail	phage tail protein	A0A0R6PIM4	Moraxella_phage	4.5e-88	57.4
AXB15408.1\|1629913_1630612_-\|tail	phage minor tail protein L	A0A0R6PIG8	Moraxella_phage	4.8e-92	68.1
AXB15409.1\|1630621_1630972_-	hypothetical protein	NA	NA	NA	NA
AXB15410.1\|1631026_1631368_-\|tail	phage tail protein	NA	NA	NA	NA
AXB15411.1\|1631485_1635451_-	replication protein	A0A0D4DC37	Acinetobacter_phage	2.9e-165	44.7
AXB15412.1\|1635511_1635913_-	hypothetical protein	NA	NA	NA	NA
AXB15413.1\|1635993_1636398_-	type II toxin-antitoxin system HicB family antitoxin	A0A0D4DCG1	Acinetobacter_phage	2.7e-63	89.6
AXB15414.1\|1636462_1636645_-	type II toxin-antitoxin system HicA family toxin	A0A0D4DC32	Acinetobacter_phage	7.4e-29	100.0
AXB15415.1\|1636976_1637510_-	hypothetical protein	A0A0N7IRG3	Acinetobacter_phage	6.3e-44	59.9
AXB15416.1\|1637553_1638483_-	hypothetical protein	A0A059VG08	Pseudomonas_phage	4.0e-54	40.6
AXB15417.1\|1638590_1638803_-	hypothetical protein	A0A0D4DC29	Acinetobacter_phage	1.3e-21	75.4
AXB15418.1\|1638804_1639203_-	hypothetical protein	A0A0D4DBX3	Acinetobacter_phage	4.0e-51	71.2
AXB15419.1\|1639204_1639573_-	HK97 gp10 family phage protein	A0A0P0IDX0	Acinetobacter_phage	4.6e-54	95.4
AXB17451.1\|1639544_1639949_-	hypothetical protein	A0A0P0IKR8	Acinetobacter_phage	9.0e-67	93.3
AXB15420.1\|1639957_1640371_-	glutamate 5-kinase	J7I467	Acinetobacter_phage	5.6e-56	76.6
AXB15421.1\|1640327_1640717_-	hypothetical protein	A0A0D4DC24	Acinetobacter_phage	9.5e-66	98.4
AXB15422.1\|1640721_1641387_-	stress-responsive nuclear envelope protein	J7I4P7	Acinetobacter_phage	5.2e-72	67.4
AXB15423.1\|1641451_1642408_-\|capsid	phage capsid protein	A0A0D4DBM4	Acinetobacter_phage	5.6e-168	93.7
AXB15424.1\|1642435_1643203_-	hypothetical protein	J7I0W4	Acinetobacter_phage	7.3e-118	97.3
AXB15425.1\|1643316_1643631_-	hypothetical protein	A0A0S3UFT8	Pseudomonas_phage	3.4e-13	48.5
AXB15426.1\|1643699_1644212_-	hypothetical protein	NA	NA	NA	NA
AXB15427.1\|1644403_1645507_-\|head	phage head morphogenesis protein	A0A0D4DBL9	Acinetobacter_phage	9.6e-196	93.5
AXB15428.1\|1645513_1646959_-	hypothetical protein	A0A0D4DCP1	Acinetobacter_phage	1.1e-281	98.8
AXB15429.1\|1646955_1648383_-\|terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	1.2e-254	89.3
AXB15430.1\|1648372_1648843_-	DUF2280 domain-containing protein	A0A0D4DC15	Acinetobacter_phage	2.6e-73	89.7
AXB15431.1\|1648900_1649542_-	hypothetical protein	J7I4N9	Acinetobacter_phage	4.4e-124	97.2
AXB15432.1\|1649510_1649978_-	hypothetical protein	A0A0P0IRI6	Acinetobacter_phage	6.3e-64	76.1
AXB15433.1\|1650150_1650354_-	hypothetical protein	NA	NA	NA	NA
AXB15434.1\|1651411_1651642_-	hypothetical protein	NA	NA	NA	NA
AXB15435.1\|1651822_1652386_-	hypothetical protein	A0A1B1P9I8	Acinetobacter_phage	3.2e-46	52.5
AXB15436.1\|1652407_1652692_-	hypothetical protein	NA	NA	NA	NA
AXB15437.1\|1652701_1653109_-	DUF1064 domain-containing protein	A0A0R6PIZ9	Moraxella_phage	4.0e-22	51.8
AXB15438.1\|1653105_1653507_-	hypothetical protein	NA	NA	NA	NA
AXB15439.1\|1653493_1653676_-	hypothetical protein	NA	NA	NA	NA
AXB15440.1\|1653672_1654071_-	HNH endonuclease	K7P7B7	Enterobacteria_phage	8.9e-27	48.5
AXB15441.1\|1654067_1654475_-	hypothetical protein	NA	NA	NA	NA
AXB15442.1\|1654471_1655221_-	hypothetical protein	A0A0N7IRF0	Acinetobacter_phage	1.6e-133	96.0
AXB15443.1\|1655213_1656143_-	DUF1376 domain-containing protein	A0A0P0I481	Acinetobacter_phage	3.7e-172	99.7
AXB15444.1\|1656135_1656498_-	hypothetical protein	A0A0D4DBI9	Acinetobacter_phage	2.4e-55	99.1
AXB15445.1\|1656494_1656791_-	hypothetical protein	J7HXM0	Acinetobacter_phage	8.9e-48	98.0
AXB17452.1\|1656787_1657063_-	hypothetical protein	A0A0P0IVP2	Acinetobacter_phage	1.3e-40	97.8
AXB15446.1\|1657118_1657475_-	transcriptional regulator	J7I452	Acinetobacter_phage	8.8e-58	98.3
AXB15447.1\|1657484_1657736_-	hypothetical protein	A0A0N7IRE1	Acinetobacter_phage	2.4e-38	95.2
AXB15448.1\|1657844_1658609_+	helix-turn-helix domain-containing protein	A0A0P0J076	Acinetobacter_phage	1.5e-139	95.3
AXB15449.1\|1658623_1658839_+	hypothetical protein	A0A0P0I8I5	Acinetobacter_phage	3.9e-29	95.7
AXB15450.1\|1658940_1659804_+	KilA-N domain-containing protein	Q4ZC41	Staphylococcus_virus	7.1e-69	51.1
AXB15451.1\|1659862_1660075_+	transcriptional regulator	NA	NA	NA	NA
AXB15452.1\|1660061_1660337_-	hypothetical protein	NA	NA	NA	NA
AXB15453.1\|1660607_1661048_+	hypothetical protein	A0A0D4DBH9	Acinetobacter_phage	1.3e-74	98.6
1660410:1660465	attR	NA	NA	NA	NA
AXB15454.1\|1661047_1661338_+	hypothetical protein	A0A0P0IDU2	Acinetobacter_phage	1.6e-49	99.0
AXB15455.1\|1661330_1661654_+	hypothetical protein	A0A0D4DCB5	Acinetobacter_phage	1.7e-55	97.2
AXB15456.1\|1661665_1662787_+	AAA family ATPase	A0A0N7IRE0	Acinetobacter_phage	2.0e-212	99.7
AXB15457.1\|1662783_1662990_+	hypothetical protein	NA	NA	NA	NA
AXB15458.1\|1662994_1663954_+	hypothetical protein	A0A0D4DBR8	Acinetobacter_phage	5.7e-144	82.1
AXB15459.1\|1663992_1664202_+	hypothetical protein	A0A0P0IVN4	Acinetobacter_phage	3.3e-33	100.0
AXB15460.1\|1664205_1664613_+	hypothetical protein	A0A0P0I8H3	Acinetobacter_phage	1.3e-12	97.0
AXB15461.1\|1664609_1665005_+	hypothetical protein	NA	NA	NA	NA
AXB15462.1\|1665001_1665337_+	hypothetical protein	A0A0P0HSE1	Acinetobacter_phage	3.7e-34	62.4
AXB15463.1\|1665337_1665607_+	hypothetical protein	A0A0P0J067	Acinetobacter_phage	8.7e-42	100.0
AXB15464.1\|1665721_1666306_+	aminodeoxychorismate/anthranilate synthase component II	A0A0P0IKJ1	Acinetobacter_phage	1.7e-111	99.5
AXB15465.1\|1666401_1669101_-	M1 family peptidase	A0A0P0IY26	Acinetobacter_phage	0.0e+00	97.8
AXB15466.1\|1669179_1671912_-	TonB-dependent receptor	A0A0P0I887	Acinetobacter_phage	0.0e+00	97.7
AXB17453.1\|1672268_1673318_+	anthranilate phosphoribosyltransferase	A0A0N7IRD9	Acinetobacter_phage	9.8e-190	100.0
AXB15467.1\|1673327_1674134_+	indole-3-glycerol-phosphate synthase	A0A0P0IR83	Acinetobacter_phage	1.8e-146	99.6
AXB15468.1\|1674143_1674839_+	DNA mismatch repair protein MutS	A0A0P0IDT4	Acinetobacter_phage	5.8e-122	100.0
AXB15469.1\|1674849_1675833_-	xanthine dehydrogenase accessory protein XdhC	A0A0P0IKN7	Acinetobacter_phage	1.0e-188	99.4
AXB15470.1\|1675839_1678215_-	xanthine dehydrogenase molybdopterin binding subunit	A0A0P0I429	Acinetobacter_phage	0.0e+00	98.9
AXB15471.1\|1678216_1679716_-	xanthine dehydrogenase small subunit	A0A0P0IVM8	Acinetobacter_phage	2.3e-277	96.6
AXB15472.1\|1679972_1680527_+	GTP cyclohydrolase I FolE	A0A0P0HSD2	Acinetobacter_phage	2.7e-98	100.0

DBSCAN-SWA_6

2269892 : 2333499

uncultured_Caudovirales_phage(28.57%)

integrase,plate,terminase,portal,holin,capsid,tRNA,tail

attL 2275423:2275438|attR 2322040:2322055

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB15935.1\|2269892_2271671_+\|tRNA	aspartate--tRNA ligase	A0A2K9KZX5	Tupanvirus	6.2e-19	21.9
AXB15936.1\|2271810_2272026_+	hypothetical protein	NA	NA	NA	NA
AXB15937.1\|2272086_2272860_+	glycosyl transferase	NA	NA	NA	NA
AXB15938.1\|2272861_2273989_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	A0A1V0SAG5	Catovirus	3.2e-29	29.0
AXB15939.1\|2274168_2274984_+	glycosyltransferase	NA	NA	NA	NA
AXB15940.1\|2275002_2275896_+	hypothetical protein	NA	NA	NA	NA
2275423:2275438	attL	NA	NA	NA	NA
AXB15941.1\|2275892_2276927_-	glycosyltransferase	NA	NA	NA	NA
AXB15942.1\|2276938_2277703_-	glycosyltransferase family 2 protein	NA	NA	NA	NA
AXB17480.1\|2277699_2278431_-	polysaccharide deacetylase family protein	NA	NA	NA	NA
AXB15943.1\|2278451_2279480_-	glycosyltransferase	NA	NA	NA	NA
AXB15944.1\|2279502_2280393_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA
AXB15945.1\|2280460_2281387_-	branched-chain amino acid transaminase	NA	NA	NA	NA
AXB15946.1\|2281411_2284162_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA
AXB15947.1\|2284230_2285499_-	sensor histidine kinase	B5LWN0	Feldmannia_species_virus	1.3e-07	24.8
AXB15948.1\|2286831_2287830_-\|portal	phage portal protein	A0A2H4J922	uncultured_Caudovirales_phage	6.4e-98	53.2
AXB17481.1\|2287829_2289617_-\|terminase	terminase	Q9ZXM5	Pseudomonas_virus	2.5e-201	58.5
AXB15949.1\|2289775_2290603_+\|capsid	capsid protein	A0A2H4J928	uncultured_Caudovirales_phage	6.3e-59	45.8
AXB15950.1\|2290655_2291645_+\|capsid	phage major capsid protein, P2 family	E5G6M6	Salmonella_phage	1.5e-94	54.5
AXB15951.1\|2291655_2292402_+\|terminase	terminase	Q9ZXM2	Pseudomonas_virus	1.2e-37	42.9
AXB15952.1\|2292505_2292958_+\|capsid	capsid protein	Q9ZXM1	Pseudomonas_virus	1.2e-24	46.5
AXB15953.1\|2292958_2293168_+\|tail	phage tail protein	E5G6M9	Salmonella_phage	5.2e-18	59.7
AXB15954.1\|2293176_2293527_+	hypothetical protein	NA	NA	NA	NA
AXB15955.1\|2293523_2293793_+\|holin	phage holin family protein	Q9ZXL7	Pseudomonas_virus	7.7e-06	38.5
AXB15956.1\|2293789_2294620_+	DUF3380 domain-containing protein	A4JWU0	Burkholderia_virus	2.8e-46	42.6
AXB15957.1\|2294616_2295144_+\|tail	phage tail protein	A0A2H4J906	uncultured_Caudovirales_phage	2.8e-36	50.0
AXB15958.1\|2295140_2295590_+	phage virion morphogenesis protein	A0A2H4J927	uncultured_Caudovirales_phage	4.8e-29	48.2
AXB15959.1\|2295662_2296295_+\|plate	phage baseplate assembly protein V	A0A2H4JFJ8	uncultured_Caudovirales_phage	7.3e-23	35.1
AXB15960.1\|2296291_2296639_+\|plate	baseplate assembly protein	A0A2H4JE52	uncultured_Caudovirales_phage	8.1e-24	51.8
AXB15961.1\|2296635_2297538_+\|plate	baseplate assembly protein	A0A0F7LCJ3	Escherichia_phage	6.0e-71	48.5
AXB15962.1\|2297537_2298143_+\|tail	phage tail protein I	A0A0F7LA36	Escherichia_phage	1.1e-28	38.2
AXB15963.1\|2298154_2300107_+	alkaline phosphatase	F1BUP1	Erwinia_phage	2.9e-30	42.9
AXB15964.1\|2300256_2301432_+\|tail	phage tail protein	Q9ZXK4	Pseudomonas_virus	1.4e-149	68.3
AXB15965.1\|2301444_2301963_+\|tail	phage major tail tube protein	Q9ZXK3	Pseudomonas_virus	6.1e-52	58.5
AXB15966.1\|2302029_2302371_+\|tail	phage tail assembly protein	E5E3U8	Burkholderia_phage	5.0e-18	52.2
AXB17482.1\|2302373_2302511_+\|tail	GpE family phage tail protein	R9QCM4	Mannheimia_phage	1.7e-06	57.9
AXB15967.1\|2302524_2304975_+\|tail	phage tail tape measure protein	A0A193GYN8	Enterobacter_phage	3.0e-104	44.4
AXB15968.1\|2304980_2305421_+	oxidoreductase	A0A2H4JG54	uncultured_Caudovirales_phage	1.7e-39	54.8
AXB15969.1\|2305421_2306735_+	DNA primase	A0A2H4JAV0	uncultured_Caudovirales_phage	9.3e-97	42.9
AXB15970.1\|2306864_2307104_+	transcriptional regulator	NA	NA	NA	NA
AXB15971.1\|2307100_2307301_+	conjugal transfer protein TraR	NA	NA	NA	NA
AXB15972.1\|2307301_2307580_+	hypothetical protein	NA	NA	NA	NA
AXB15973.1\|2307616_2307898_-	hypothetical protein	NA	NA	NA	NA
AXB15974.1\|2307897_2308776_-	NAD-dependent DNA ligase	NA	NA	NA	NA
AXB15975.1\|2308824_2309085_-	hypothetical protein	NA	NA	NA	NA
AXB15976.1\|2309085_2309280_+	hypothetical protein	NA	NA	NA	NA
AXB15977.1\|2309387_2310203_+	Rha family transcriptional regulator	A0A0K2CXT4	Paenibacillus_phage	5.9e-25	52.1
AXB15978.1\|2310327_2310543_+	hypothetical protein	NA	NA	NA	NA
AXB15979.1\|2310587_2310929_-	XRE family transcriptional regulator	NA	NA	NA	NA
AXB15980.1\|2311021_2311213_+	hypothetical protein	NA	NA	NA	NA
AXB15981.1\|2311306_2314045_+	toprim	A0A2H4JDT6	uncultured_Caudovirales_phage	0.0e+00	62.2
AXB15982.1\|2314041_2314374_+	hypothetical protein	NA	NA	NA	NA
AXB15983.1\|2314439_2314991_+	hypothetical protein	NA	NA	NA	NA
AXB15984.1\|2315143_2315461_+	hypothetical protein	NA	NA	NA	NA
AXB15985.1\|2315448_2315802_+	single-stranded DNA-binding protein	M4SRQ0	Psychrobacter_phage	3.7e-32	60.9
AXB15986.1\|2315811_2316549_+	3'-5' exonuclease	A0A0S0NDC6	Pseudomonas_phage	2.7e-21	30.4
AXB15987.1\|2316558_2316780_+	hypothetical protein	A0A2H4J8L3	uncultured_Caudovirales_phage	2.0e-07	38.2
AXB15988.1\|2316776_2317073_+	hypothetical protein	NA	NA	NA	NA
AXB15989.1\|2317100_2318168_-\|integrase	site-specific integrase	A0A0A0YR56	Pseudomonas_phage	1.5e-44	37.9
AXB15990.1\|2318613_2319651_+\|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	NA	NA	NA	NA
AXB15991.1\|2319804_2320833_+	hypothetical protein	NA	NA	NA	NA
AXB15992.1\|2320919_2321489_+	LemA family protein	NA	NA	NA	NA
AXB15993.1\|2321664_2322798_+\|tRNA	tRNA guanosine(34) transglycosylase Tgt	A0A1B1IVQ4	uncultured_Mediterranean_phage	1.3e-94	48.5
2322040:2322055	attR	NA	NA	NA	NA
AXB15994.1\|2322896_2323226_+	preprotein translocase subunit YajC	NA	NA	NA	NA
AXB15995.1\|2323277_2325179_+	protein translocase subunit SecD	NA	NA	NA	NA
AXB15996.1\|2325187_2326153_+	protein translocase subunit SecF	A0A1B1IVP7	uncultured_Mediterranean_phage	1.7e-31	33.1
AXB15997.1\|2326218_2327472_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	Q9HH70	Methanothermobacter_phage	3.8e-39	34.0
AXB15998.1\|2327572_2328292_+	JAB domain-containing protein	NA	NA	NA	NA
AXB15999.1\|2328353_2329265_+	bestrophin	NA	NA	NA	NA
AXB16000.1\|2329272_2330124_-	PHP domain-containing protein	NA	NA	NA	NA
AXB16001.1\|2330168_2330783_+	septation protein A	NA	NA	NA	NA
AXB16002.1\|2330817_2331120_+	hypothetical protein	NA	NA	NA	NA
AXB16003.1\|2331124_2331604_+	hypothetical protein	NA	NA	NA	NA
AXB16004.1\|2331627_2333499_+\|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA

DBSCAN-SWA_7

3100146 : 3153103

Escherichia_phage(13.33%)

integrase,transposase,tRNA

attL 3103053:3103112|attR 3155356:3156175

Protein_ID	Protein_Def	Hit_ID	Hit_Def	E-value	Identity
AXB16667.1\|3100146_3100857_+\|transposase	heteromeric transposase endonuclease subunit TnsA	I6WI48	Vibriophage	9.1e-06	29.3
AXB16668.1\|3100858_3102769_+\|transposase	transposase	NA	NA	NA	NA
3103053:3103112	attL	NA	NA	NA	NA
AXB16669.1\|3103115_3103820_+\|transposase	IS6 family transposase IS15DI	A0A077SL39	Escherichia_phage	1.2e-138	99.6
AXB16670.1\|3104370_3105183_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA
AXB16671.1\|3105393_3105930_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA
AXB16672.1\|3105932_3106865_+\|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	NA	NA	NA	NA
AXB16673.1\|3106915_3108112_-	putative lipid II flippase FtsW	NA	NA	NA	NA
AXB16674.1\|3108136_3109483_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA
AXB16675.1\|3109643_3109895_-	hypothetical protein	NA	NA	NA	NA
AXB16676.1\|3109915_3111769_-	ferrous iron transporter B	NA	NA	NA	NA
AXB17517.1\|3111765_3112029_-	ferrous iron transport protein A	NA	NA	NA	NA
AXB16677.1\|3112172_3113093_+	site-specific tyrosine recombinase XerD	A0A0K2CP59	Brevibacillus_phage	2.3e-33	31.1
AXB16678.1\|3113239_3114055_+	DsbC family protein	NA	NA	NA	NA
AXB16679.1\|3114299_3115601_+	homoserine dehydrogenase	NA	NA	NA	NA
AXB16680.1\|3115656_3116796_+	threonine synthase	NA	NA	NA	NA
AXB16681.1\|3116904_3117912_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA
AXB16682.1\|3118163_3118799_+	DNA-binding response regulator	NA	NA	NA	NA
AXB17518.1\|3118854_3120378_+	PAS domain-containing sensor histidine kinase	A0A1V0SGX0	Hokovirus	4.7e-07	26.5
AXB16683.1\|3120402_3121824_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA
AXB16684.1\|3121827_3123012_-	S41 family peptidase	A0A0R6PIZ1	Moraxella_phage	8.3e-12	23.0
AXB16685.1\|3123027_3124575_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA
AXB16686.1\|3124700_3125771_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA
AXB16687.1\|3125770_3126871_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA
AXB16688.1\|3127014_3128463_+	cytosol aminopeptidase	Q6GYZ8	Mycoplasma_phage	5.5e-50	36.4
AXB16689.1\|3128455_3128863_+	DNA polymerase III subunit chi	NA	NA	NA	NA
AXB16690.1\|3128901_3129540_+	hypothetical protein	NA	NA	NA	NA
AXB16691.1\|3129670_3129889_+	hypothetical protein	NA	NA	NA	NA
AXB16692.1\|3129947_3130607_-	riboflavin synthase	A0A2H4PQS5	Staphylococcus_phage	1.5e-34	38.6
AXB16693.1\|3130649_3131942_-	DNA modification methylase	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	2.5e-38	32.6
AXB16694.1\|3131938_3133024_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	A0A2H4PQS8	Staphylococcus_phage	3.3e-47	36.3
AXB16695.1\|3133039_3133498_-	transcriptional repressor NrdR	NA	NA	NA	NA
AXB16696.1\|3133656_3135054_-	ammonium transporter	H8ZJB2	Ostreococcus_tauri_virus	7.0e-34	31.2
AXB16697.1\|3135111_3135450_-	P-II family nitrogen regulator	NA	NA	NA	NA
AXB16698.1\|3135729_3135957_+	membrane fusogenic activity	NA	NA	NA	NA
AXB16699.1\|3136022_3136880_+	ATP-binding protein	NA	NA	NA	NA
AXB16700.1\|3136962_3138759_+	hypothetical protein	NA	NA	NA	NA
AXB16701.1\|3139053_3140541_+	SulP family inorganic anion transporter	A0A2H4J153	uncultured_Caudovirales_phage	1.2e-217	78.6
AXB16702.1\|3140941_3142231_-\|transposase	ISL3-like element ISPpu12 family transposase	A0A2D1GQC1	Lysinibacillus_phage	9.5e-86	40.4
AXB16703.1\|3142252_3142765_-	signal peptidase II	NA	NA	NA	NA
AXB16704.1\|3142768_3143665_-	sodium:proton antiporter	NA	NA	NA	NA
AXB16705.1\|3143760_3144168_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA
AXB16706.1\|3144289_3144553_+	conjugal transfer protein TrbI	NA	NA	NA	NA
AXB16707.1\|3144609_3144993_-	hypothetical protein	NA	NA	NA	NA
AXB16708.1\|3145698_3146043_-	hypothetical protein	A0A2I7S8K9	Vibrio_phage	2.0e-11	41.4
AXB16709.1\|3146350_3146851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA
AXB16710.1\|3146869_3147049_+	hypothetical protein	NA	NA	NA	NA
AXB16711.1\|3146978_3147818_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA
AXB16712.1\|3147811_3148159_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA
AXB16713.1\|3148322_3149114_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA
AXB16714.1\|3149205_3149511_-	hypothetical protein	NA	NA	NA	NA
AXB16715.1\|3149526_3150039_-	GNAT family N-acetyltransferase	NA	NA	NA	NA
AXB16716.1\|3150157_3150622_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA
AXB16717.1\|3150792_3151827_+\|integrase	class 1 integron integrase IntI1	A0A1P8DJJ6	Virus_Rctr41k	5.0e-69	44.5
AXB16718.1\|3151900_3152251_+	DUF3330 domain-containing protein	NA	NA	NA	NA
AXB16719.1\|3152398_3153103_-\|transposase	IS6 family transposase IS15DIV	A0A077SL39	Escherichia_phage	1.8e-139	100.0
3155356:3156175	attR	NA	NA	NA	NA

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

Overview of predicted results

Overview of the results

Cas Category Instructions

Results visualization

1. CP030107

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection

2. CP030106

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection