1. spacer 2.5|171126|33|CP030794|CRISPRCasFinder,CRT matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879
tcaggaacgcgcggcggaagagcttggtgtttg CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg Protospacer
************.***************. **
2. spacer 2.5|171126|33|CP030794|CRISPRCasFinder,CRT matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879
tcaggaacgcgcggcggaagagcttggtgtttg CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg Protospacer
************.***************. **
3. spacer 2.14|171126|35|CP030794|PILER-CR matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857
tcaggaacgcgcggcggaagagcttggtgtttgcg CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc Protospacer
************.***************. ***
4. spacer 2.14|171126|35|CP030794|PILER-CR matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857
tcaggaacgcgcggcggaagagcttggtgtttgcg CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc Protospacer
************.***************. ***
5. spacer 2.15|171188|34|CP030794|PILER-CR matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853
gctgcctttcccggagttccggcccct----aaattgg CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa---- Protospacer
* ************************* ***
6. spacer 2.15|171188|34|CP030794|PILER-CR matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853
gctgcctttcccggagttccggcccct----aaattgg CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa---- Protospacer
* ************************* ***
7. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
ggtgcctttcccggagttccggccccttctca Protospacer
* ************************* .
8. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
ggtgcctttcccggagttccggccccttctca Protospacer
* ************************* .
9. spacer 2.15|171188|34|CP030794|PILER-CR matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824
gctgcctttcccggagttccggcccct----aaattgg CRISPR spacer
ggtgccttttccggagttccggccccttctcaaa---- Protospacer
* *******.***************** ***
10. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
ggtgccttttccggagttccggccccttctca Protospacer
* *******.***************** .
11. spacer 2.3|171004|32|CP030794|CRISPRCasFinder,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75
cgattctacggcaacaggccaggctgcgaccg CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcg Protospacer
* .********** ***********.**
12. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75
gctgcctttcccggagttccggcccctaaatt--- CRISPR spacer
tatgcctttcccggctttccggccc---aactgac Protospacer
************ ********* **.*
13. spacer 2.8|171310|32|CP030794|CRISPRCasFinder,CRT matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75
tgattattgacgacaacagcacagaccggcag CRISPR spacer
ttataattgactacaacagcacagagcagatt Protospacer
* ** ****** ************* *.*
14. spacer 2.8|171310|32|CP030794|CRISPRCasFinder,CRT matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75
tgattattgacgacaacagcacagaccggcag CRISPR spacer
ttataattgactacaacagcacagagcagatt Protospacer
* ** ****** ************* *.*
15. spacer 2.12|171004|34|CP030794|PILER-CR matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765
cgattctacggcaacaggccaggctgcgaccgcg CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcgcg Protospacer
* .********** ***********.****
16. spacer 1.1|154214|32|CP030794|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719
tatttataagcgtgtcatctatgcaacccaac CRISPR spacer
aatttataatcatgtcatctatgccataattc Protospacer
******** *.************ *. *
17. spacer 1.3|154336|32|CP030794|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
18. spacer 1.3|154336|32|CP030794|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
19. spacer 1.3|154336|32|CP030794|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
20. spacer 1.3|154336|32|CP030794|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
21. spacer 1.7|154580|32|CP030794|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719
gagaatgctcatgcgcgtgagcgccatatatt CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt Protospacer
..**** ********** ******** *
22. spacer 1.9|154216|32|CP030794|PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719
tatttataagcgtgtcatctatgcaacccaac CRISPR spacer
aatttataatcatgtcatctatgccataattc Protospacer
******** *.************ *. *
23. spacer 1.11|154338|32|CP030794|PILER-CR matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
24. spacer 1.11|154338|32|CP030794|PILER-CR matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
25. spacer 1.11|154338|32|CP030794|PILER-CR matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
26. spacer 1.11|154338|32|CP030794|PILER-CR matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719
ggccgctggtcaaattcccaatctgagcaatc CRISPR spacer
tacatcttgacaaattcccaatctgagcgact Protospacer
.* ** * ******************.*..
27. spacer 1.15|154582|32|CP030794|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719
gagaatgctcatgcgcgtgagcgccatatatt CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt Protospacer
..**** ********** ******** *
28. spacer 2.5|171126|33|CP030794|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
tcaggaacgcgcggcggaagagcttggtgtttg CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttc Protospacer
.. * **.*********** **********
29. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
30. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
31. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
32. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
33. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
34. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
35. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
36. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
37. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
38. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
39. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
40. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
41. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
42. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
43. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
44. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
45. spacer 2.6|171188|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gctgcctttcccggagttccggcccctaaatt CRISPR spacer
gtgccctttaccggagttccggccccttctca Protospacer
*. ***** ***************** .
46. spacer 2.8|171310|32|CP030794|CRISPRCasFinder,CRT matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719
tgattattgacgacaacagcacagaccggcag CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa Protospacer
* ********** ***.******** *.
47. spacer 2.10|171432|32|CP030794|CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719
gaatctggaggccaacagcgcggcgaaatcct CRISPR spacer
gaatctggagggcgacagcgcggtcgaccctg Protospacer
*********** *.*********. .* .*.
48. spacer 2.4|171065|32|CP030794|CRISPRCasFinder,CRT matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
atcaaacatggaaacccctttaatgagagcaa CRISPR spacer
ctaaaacatggaaaccactgtaatgacgaatc Protospacer
* ************* ** ****** ..
49. spacer 2.10|171432|32|CP030794|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
gaatctggaggccaacagcgcggcgaaatcct CRISPR spacer
gtggtcataggccatcagcgcggcgatatccc Protospacer
* . ... ****** *********** ****.
50. spacer 2.14|171126|35|CP030794|PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686
tcaggaacgcgcggcggaagagcttggtgtttgcg CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttctc Protospacer
.. * **.*********** ********** .
