Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030097 Bacillus amyloliquefaciens strain SH-B74 chromosome, complete genome 2 crisprs NA 3 0 0 0
CP030098 Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP030097
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030097_1 487072-488052 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030097_2 3923874-3923962 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP030097_1 1.2|487162|18|CP030097|CRT 487162-487179 18 CP030097.1 488080-488097 0 1.0
CP030097_1 1.12|487837|18|CP030097|CRT 487837-487854 18 CP030097.1 488053-488070 0 1.0
CP030097_1 1.3|487216|54|CP030097|CRT 487216-487269 54 CP030097.1 488026-488079 2 0.963

1. spacer 1.2|487162|18|CP030097|CRT matches to position: 488080-488097, mismatch: 0, identity: 1.0 

ctactggagcgacgggtt	CRISPR spacer
ctactggagcgacgggtt	Protospacer
******************

2. spacer 1.12|487837|18|CP030097|CRT matches to position: 488053-488070, mismatch: 0, identity: 1.0 

cgacgggaatcacgggtc	CRISPR spacer
cgacgggaatcacgggtc	Protospacer
******************

3. spacer 1.3|487216|54|CP030097|CRT matches to position: 488026-488079, mismatch: 2, identity: 0.963 

ttacgggagataccggaccaactggggcgacgggaatcacgggtccaaccggag	CRISPR spacer
ttacgggagataccggatcaactggggcgacgggaatcacgggtccaactggag	Protospacer
*****************.*******************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage