Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030939 Escherichia coli strain AMSHJX01 chromosome, complete genome 5 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DinG,c2c9_V-U4,DEDDh 0 26 13 0
CP030940 Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. CP030939
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030939_1 615675-615792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030939_2 1050010-1050648 TypeI-E I-E
10 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030939_3 1066150-1067520 TypeI-E I-E
22 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030939_4 3373261-3373405 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030939_5 3661782-3661878 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 112539-112571 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 180672-180704 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 213091-213123 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 160690-160722 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 256-288 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 15889-15921 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 237786-237818 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 227490-227522 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 229760-229792 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 16704-16736 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 45746-45778 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 96803-96835 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 156967-156999 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 89323-89355 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 171730-171762 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 121114-121146 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 237537-237569 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 31967-31999 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 308545-308577 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 235708-235740 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_002305 Salmonella typhi plasmid R27, complete sequence 141684-141716 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 206257-206289 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 161011-161043 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 160809-160841 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 58379-58411 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 102938-102970 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 162354-162386 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 154530-154562 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 217889-217921 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 160798-160830 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 161121-161153 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 161066-161098 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 27673-27705 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 160809-160841 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 302945-302977 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 159519-159551 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 39113-39145 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 160574-160606 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 160901-160933 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 160809-160841 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 162734-162766 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 160635-160667 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 161011-161043 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 160537-160569 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 158323-158355 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 152653-152685 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 152086-152118 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 160642-160674 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 160426-160458 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 98185-98217 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 112539-112570 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 180673-180704 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 213091-213122 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 160690-160721 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 256-287 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 15889-15920 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 237787-237818 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 227491-227522 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 229761-229792 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 16705-16736 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 45747-45778 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 96804-96835 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 156967-156998 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 89323-89354 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 171731-171762 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 121115-121146 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 237538-237569 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 31968-31999 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 308546-308577 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 235709-235740 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 141685-141716 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 206257-206288 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 58380-58411 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 102938-102969 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 162354-162385 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 154531-154562 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 217889-217920 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 160798-160829 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 161121-161152 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 161066-161097 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 27673-27704 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 302946-302977 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 159519-159550 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 39113-39144 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 160574-160605 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 160901-160932 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 162734-162765 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 160635-160666 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 160537-160568 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 158323-158354 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 152653-152684 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 152087-152118 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 160642-160673 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 160426-160457 0 1.0
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 98185-98216 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 105238-105270 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 66553-66585 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 74796-74828 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 118044-118076 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 240379-240411 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 46728-46760 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 37722-37754 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 25675-25707 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 32464-32496 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 100635-100667 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 138368-138400 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 96787-96819 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 84184-84216 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 137391-137423 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 173749-173781 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 238531-238563 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 149374-149406 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 84184-84216 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 176729-176761 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 82749-82781 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 199740-199772 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 75569-75601 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 7793-7825 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 26063-26095 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 9385-9417 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 153222-153254 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 21836-21868 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 86682-86714 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 84185-84217 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 146900-146932 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 227807-227839 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 194221-194253 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 100302-100334 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 213332-213364 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 67686-67718 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 116189-116221 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 124872-124904 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 93474-93506 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 93527-93559 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 185398-185430 1 0.97
CP030939_3 3.17|1067155|33|CP030939|PILER-CR 1067155-1067187 33 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 34232-34264 1 0.97
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 105238-105269 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 66553-66584 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 74796-74827 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 118045-118076 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 240380-240411 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 46729-46760 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 37723-37754 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 25676-25707 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 32465-32496 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 100635-100666 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 138368-138399 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 96788-96819 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 84184-84215 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 137391-137422 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 173749-173780 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 238532-238563 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 149374-149405 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 84184-84215 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 176730-176761 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 82749-82780 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 199740-199771 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 75569-75600 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 7793-7824 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 26064-26095 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 9386-9417 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 153222-153253 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 21836-21867 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 86682-86713 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 84185-84216 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 146901-146932 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 227807-227838 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 194221-194252 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 100302-100333 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 213332-213363 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 67687-67718 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 116189-116220 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 124872-124903 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 93474-93505 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 93527-93558 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 185399-185430 1 0.969
CP030939_3 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT 1067156-1067187 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 34232-34263 1 0.969
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
CP030939_3 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT 1067460-1067491 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
CP030939_3 3.15|1067033|33|CP030939|PILER-CR 1067033-1067065 33 MN693292 Marine virus AFVG_25M2, complete genome 18744-18776 5 0.848
CP030939_3 3.36|1067034|32|CP030939|CRISPRCasFinder,CRT 1067034-1067065 32 MN693292 Marine virus AFVG_25M2, complete genome 18744-18775 5 0.844
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 138722-138753 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 134876-134907 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 159432-159463 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 139796-139827 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 159432-159463 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 132848-132879 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 132849-132880 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 159441-159472 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 159459-159490 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 159431-159462 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 138736-138767 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 138734-138765 6 0.812
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 138733-138764 6 0.812
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 112048-112078 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 138722-138752 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 134876-134906 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 159432-159462 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 139796-139826 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 255946-255976 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 159432-159462 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 132848-132878 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 132849-132879 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 159441-159471 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 159459-159489 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 159431-159461 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 138736-138766 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 138734-138764 6 0.806
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 138733-138763 6 0.806
CP030939_2 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT 1050344-1050375 32 NC_022551 Blattabacterium sp. (Nauphoeta cinerea) plasmid unnamed, complete sequence 1514-1545 7 0.781
CP030939_3 3.7|1066545|33|CP030939|PILER-CR 1066545-1066577 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 632074-632106 7 0.788
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 41803-41835 7 0.788
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 112048-112079 7 0.781
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP009154 Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence 17331-17362 7 0.781
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 255946-255977 7 0.781
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 41804-41835 7 0.781
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP009154 Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence 17332-17362 7 0.774
CP030939_2 2.2|1050100|32|CP030939|CRISPRCasFinder,CRT 1050100-1050131 32 MF459646 Erwinia phage vB_EamM_RisingSun, complete genome 116689-116720 8 0.75
CP030939_2 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT 1050344-1050375 32 NZ_CP051549 Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1 68629-68660 8 0.75
CP030939_2 2.13|1050343|33|CP030939|PILER-CR 1050343-1050375 33 NC_022551 Blattabacterium sp. (Nauphoeta cinerea) plasmid unnamed, complete sequence 1514-1546 8 0.758
CP030939_2 2.13|1050343|33|CP030939|PILER-CR 1050343-1050375 33 NZ_CP051549 Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1 68628-68660 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 MT446405 UNVERIFIED: Escherichia virus TH32, complete genome 25380-25412 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 MT446408 UNVERIFIED: Escherichia virus TH35, complete genome 54297-54329 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 NC_048073 Escherichia phage FEC19, complete genome 557-589 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 1691-1723 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 70337-70369 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 JX128258 Escherichia phage ECML-117, complete genome 6721-6753 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 1692-1724 8 0.758
CP030939_3 3.9|1066667|33|CP030939|PILER-CR 1066667-1066699 33 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 70380-70412 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1519143-1519175 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 519320-519352 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 109062-109094 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 947293-947325 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 988524-988556 8 0.758
CP030939_3 3.10|1066728|33|CP030939|PILER-CR 1066728-1066760 33 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 1301623-1301655 8 0.758
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1470278-1470309 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 1691-1722 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 70337-70368 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 JX128258 Escherichia phage ECML-117, complete genome 6721-6752 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 MT446405 UNVERIFIED: Escherichia virus TH32, complete genome 25381-25412 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 MT446408 UNVERIFIED: Escherichia virus TH35, complete genome 54298-54329 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 1692-1723 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 70380-70411 8 0.75
CP030939_3 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT 1066668-1066699 32 NC_048073 Escherichia phage FEC19, complete genome 558-589 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1519143-1519174 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 947294-947325 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 988525-988556 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 519320-519351 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 109062-109093 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 1301624-1301655 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 110388-110419 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 439371-439402 8 0.75
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 83345-83376 8 0.75
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1470278-1470308 8 0.742
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7608-7638 8 0.742
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7168-7198 8 0.742
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94061-94091 8 0.742
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9778-9808 8 0.742
CP030939_2 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT 1050344-1050375 32 NZ_CP016897 Acinetobacter soli strain GFJ2 plasmid pGFJ1, complete sequence 56226-56257 9 0.719
CP030939_2 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT 1050344-1050375 32 AP014380 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C70, *** SEQUENCING IN PROGRESS *** 30816-30847 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 694599-694630 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 7607-7638 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 7167-7198 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 94060-94091 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 9778-9809 9 0.719
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 AP014383 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS *** 34869-34900 9 0.719
CP030939_3 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT 1066362-1066393 32 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 145556-145587 9 0.719
CP030939_3 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT 1066546-1066577 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 632074-632105 9 0.719
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 CP003957 Rhodococcus opacus PD630 plasmid 8, complete sequence 15166-15197 9 0.719
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1271406-1271437 9 0.719
CP030939_3 3.39|1067217|32|CP030939|CRISPRCasFinder,CRT 1067217-1067248 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 474256-474287 9 0.719
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 739494-739524 9 0.71
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 694600-694630 9 0.71
CP030939_3 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT 1067278-1067308 31 AP014383 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS *** 34869-34899 9 0.71
CP030939_2 2.8|1050466|32|CP030939|CRISPRCasFinder,CRT 1050466-1050497 32 KF302036 UNVERIFIED: Pseudoalteromonas phage HS2, complete genome 4459-4490 10 0.688
CP030939_2 2.9|1050527|32|CP030939|CRISPRCasFinder,CRT 1050527-1050558 32 MN693675 Marine virus AFVG_250M630, complete genome 22878-22909 10 0.688
CP030939_2 2.9|1050527|32|CP030939|CRISPRCasFinder,CRT 1050527-1050558 32 MN693578 Marine virus AFVG_25M520, complete genome 23117-23148 10 0.688
CP030939_2 2.13|1050343|33|CP030939|PILER-CR 1050343-1050375 33 NZ_CP016897 Acinetobacter soli strain GFJ2 plasmid pGFJ1, complete sequence 56225-56257 10 0.697
CP030939_3 3.4|1066361|33|CP030939|PILER-CR 1066361-1066393 33 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 145556-145588 10 0.697
CP030939_3 3.19|1067277|32|CP030939|PILER-CR 1067277-1067308 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 739494-739525 10 0.688
CP030939_3 3.23|1066240|32|CP030939|CRISPRCasFinder,CRT 1066240-1066271 32 NC_019543 Aeromonas phage Aes508, complete genome 38378-38409 10 0.688
CP030939_3 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT 1066301-1066332 32 NZ_CP013276 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence 353704-353735 10 0.688
CP030939_3 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT 1066301-1066332 32 NZ_CP039722 Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence 131493-131524 10 0.688
CP030939_3 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT 1066301-1066332 32 NZ_CP009349 Bacillus thuringiensis HD1002 plasmid 1, complete sequence 70144-70175 10 0.688
CP030939_3 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT 1066301-1066332 32 NZ_CP045023 Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence 353750-353781 10 0.688
CP030939_3 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT 1066362-1066393 32 NZ_CP021153 Photobacterium damselae subsp. damselae strain KC-Na-1 plasmid pPDD-Na-1-1, complete sequence 44177-44208 10 0.688
CP030939_3 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT 1066362-1066393 32 NZ_CP035460 Photobacterium damselae subsp. damselae strain KC-Na-NB1 plasmid pFPPDNB1-2, complete sequence 47821-47852 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1904207-1904238 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 637027-637058 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 637048-637079 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 637036-637067 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 659223-659254 10 0.688
CP030939_3 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT 1066423-1066454 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 632655-632686 10 0.688
CP030939_3 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT 1066546-1066577 32 AP013483 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C20A-MedDCM-OCT-S30-C71 22755-22786 10 0.688
CP030939_3 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT 1066546-1066577 32 AP013484 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C20A-MedDCM-OCT-S36-C79 9197-9228 10 0.688
CP030939_3 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT 1066729-1066760 32 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 56136-56167 10 0.688
CP030939_2 2.15|1050465|33|CP030939|PILER-CR 1050465-1050497 33 KF302036 UNVERIFIED: Pseudoalteromonas phage HS2, complete genome 4458-4490 11 0.667
CP030939_3 3.29|1066607|32|CP030939|CRISPRCasFinder,CRT 1066607-1066638 32 NZ_CP048308 Escherichia coli strain 9 plasmid p009_D, complete sequence 23036-23067 11 0.656

1. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

2. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

3. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

4. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

5. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

6. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

7. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

8. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

9. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

10. spacer 3.17|1067155|33|CP030939|PILER-CR matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

11. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

12. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

13. spacer 3.17|1067155|33|CP030939|PILER-CR matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

14. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

15. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

16. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

17. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

18. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

19. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

20. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

21. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

22. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

23. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

24. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

25. spacer 3.17|1067155|33|CP030939|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

26. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

27. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

28. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

29. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

30. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

31. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

32. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

33. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

34. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

35. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

36. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

37. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

38. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

39. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

40. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

41. spacer 3.17|1067155|33|CP030939|PILER-CR matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

42. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

43. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

44. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

45. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

46. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

47. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

48. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

49. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

50. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccagccgttcagtattgccggtgtcagcaaaa	Protospacer
*********************************

51. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

52. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

53. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

54. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

55. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

56. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

57. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

58. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

59. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

60. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

61. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

62. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

63. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

64. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

65. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

66. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

67. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

68. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

69. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

70. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

71. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

72. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

73. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

74. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

75. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

76. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

77. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

78. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

79. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

80. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

81. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

82. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

83. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

84. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

85. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

86. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

87. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

88. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

89. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

90. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

91. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

92. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

93. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

94. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

95. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

96. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

97. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

98. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

99. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

100. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

101. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

102. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

103. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

104. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

105. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

106. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

107. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

108. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

109. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

110. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

111. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

112. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

113. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

114. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

115. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

116. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

117. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

118. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

119. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

120. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

121. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

122. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

123. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

124. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

125. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

126. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

127. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

128. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

129. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

130. spacer 3.17|1067155|33|CP030939|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

131. spacer 3.17|1067155|33|CP030939|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

132. spacer 3.17|1067155|33|CP030939|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

133. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

134. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

135. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

136. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

137. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

138. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

139. spacer 3.17|1067155|33|CP030939|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

140. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

141. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

142. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

143. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

144. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

145. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

146. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

147. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

148. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

149. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

150. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

151. spacer 3.17|1067155|33|CP030939|PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

152. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

153. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

154. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

155. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

156. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

157. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

158. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

159. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

160. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

161. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

162. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

163. spacer 3.17|1067155|33|CP030939|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

164. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

165. spacer 3.17|1067155|33|CP030939|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.97

gccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
gccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
****.****************************

166. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

167. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

168. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

169. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

170. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

171. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

172. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

173. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

174. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

175. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

176. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

177. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

178. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

179. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

180. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

181. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

182. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

183. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

184. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

185. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

186. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

187. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

188. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

189. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

190. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

191. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

192. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

193. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

194. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

195. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

196. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

197. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

198. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

199. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

200. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

201. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

202. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

203. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

204. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

205. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

206. spacer 3.38|1067156|32|CP030939|CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

207. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

208. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

209. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

210. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

211. spacer 3.43|1067460|32|CP030939|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

212. spacer 3.15|1067033|33|CP030939|PILER-CR matches to MN693292 (Marine virus AFVG_25M2, complete genome) position: , mismatch: 5, identity: 0.848

ggtgtggta--attggtggtctggctggtggttta	CRISPR spacer
--tttggtagtatcggtggtttggctggtggttta	Protospacer
  * *****  **.******.**************

213. spacer 3.36|1067034|32|CP030939|CRISPRCasFinder,CRT matches to MN693292 (Marine virus AFVG_25M2, complete genome) position: , mismatch: 5, identity: 0.844

gtgtggta--attggtggtctggctggtggttta	CRISPR spacer
--ttggtagtatcggtggtttggctggtggttta	Protospacer
   *****  **.******.**************

214. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

215. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

216. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

217. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

218. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

219. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

220. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

221. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

222. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

223. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

224. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

225. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

226. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgagcacatccagcgagccgcccgcgttga	Protospacer
**** *** *************** .**.* *

227. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gcggtcaaatccggcgagccgccggcgctct	Protospacer
 **  *******.***********.***** 

228. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

229. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

230. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

231. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

232. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806

-ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ttcgcg-gcatccagcgtgccgccgtcgctca	Protospacer
 .**** . ******** ******* ******

233. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

234. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

235. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

236. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

237. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

238. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

239. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

240. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

241. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgagcacatccagcgagccgcccgcgttga	Protospacer
*** *** *************** .**.* *

242. spacer 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT matches to NC_022551 (Blattabacterium sp. (Nauphoeta cinerea) plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

aaaaaacagcaaaagatgaacaaaa---tataaac	CRISPR spacer
gtaaaacagcaaaagatgaaaacaattgtata---	Protospacer
. ****************** * **   ****   

243. spacer 3.7|1066545|33|CP030939|PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.788

tgtttcg-ccgcaaatactaccgcaacggcgcgc	CRISPR spacer
-gcgccgatcgcagatacgaccgcaacggcgcgc	Protospacer
 *. .** .****.**** ***************

244. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 7, identity: 0.788

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaatcaccgttcgacgccgatcgccatgccgct	Protospacer
** .*** *****************.** *  *

245. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
tgcggtcaaatccggcgagccgccggcgctct	Protospacer
  **  *******.***********.***** 

246. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcgcaaatccagcgagccgccgacgctca---	CRISPR spacer
ggcccgcacattcagcgagccgccgac---caagc	Protospacer
* * **** **.***************   **   

247. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781

----gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
attcgcggc----atccagcgtgccgccgtcgctca	Protospacer
    ** **    ******** ******* ******

248. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 7, identity: 0.781

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aatcaccgttcgacgccgatcgccatgccgct	Protospacer
* .*** *****************.** *  *

249. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ccgcgcaaatccagcgagccgccgacgctca---	CRISPR spacer
gcccgcacattcagcgagccgccgac---caagc	Protospacer
 * **** **.***************   **   

250. spacer 2.2|1050100|32|CP030939|CRISPRCasFinder,CRT matches to MF459646 (Erwinia phage vB_EamM_RisingSun, complete genome) position: , mismatch: 8, identity: 0.75

atctggc-tcttcaaaaaacagcagcctgaacc	CRISPR spacer
-ttagacatcttcatgaaacagcagcctgaagg	Protospacer
 *. *.* ****** .***************  

251. spacer 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP051549 (Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

aaaaaacagcaaaagatgaacaaaatataaac	CRISPR spacer
caaaatgagcaaaagatgaacaaaaataatag	Protospacer
 ****  ******************   * * 

252. spacer 2.13|1050343|33|CP030939|PILER-CR matches to NC_022551 (Blattabacterium sp. (Nauphoeta cinerea) plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gaaaaaacagcaaaagatgaacaaaa---tataaac	CRISPR spacer
agtaaaacagcaaaagatgaaaacaattgtata---	Protospacer
.. ****************** * **   ****   

253. spacer 2.13|1050343|33|CP030939|PILER-CR matches to NZ_CP051549 (Phytobacter diazotrophicus strain UAEU22 plasmid unnamed1) position: , mismatch: 8, identity: 0.758

gaaaaaacagcaaaagatgaacaaaatataaac	CRISPR spacer
gcaaaatgagcaaaagatgaacaaaaataatag	Protospacer
* ****  ******************   * * 

254. spacer 3.9|1066667|33|CP030939|PILER-CR matches to MT446405 (UNVERIFIED: Escherichia virus TH32, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

255. spacer 3.9|1066667|33|CP030939|PILER-CR matches to MT446408 (UNVERIFIED: Escherichia virus TH35, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

256. spacer 3.9|1066667|33|CP030939|PILER-CR matches to NC_048073 (Escherichia phage FEC19, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

257. spacer 3.9|1066667|33|CP030939|PILER-CR matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatt	Protospacer
**.  ******** * *************  * 

258. spacer 3.9|1066667|33|CP030939|PILER-CR matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatt	Protospacer
**.  ******** * *************  * 

259. spacer 3.9|1066667|33|CP030939|PILER-CR matches to JX128258 (Escherichia phage ECML-117, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

260. spacer 3.9|1066667|33|CP030939|PILER-CR matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

261. spacer 3.9|1066667|33|CP030939|PILER-CR matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.758

gcaaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
gcgctcgatgagccgtccaacgaatcgcccatc	Protospacer
**.  ******** * *************  * 

262. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
ggtgaacggttcgacgccgctcgccatggcagg	Protospacer
*.*  ************** *****.**** . 

263. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaagagcggttcgacgatgatcgccgtggcagt	Protospacer
**   .********** .************ .*

264. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaagagcggttcgacgatgatcgccgtggcagt	Protospacer
**   .********** .************ .*

265. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaagagcggttcgacgatgatcgccgtggcagt	Protospacer
**   .********** .************ .*

266. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaagagcggttcgacgatgatcgccgtggcagt	Protospacer
**   .********** .************ .*

267. spacer 3.10|1066728|33|CP030939|PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758

gatccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gaagagcggttcgacgatgatcgccgtggcagt	Protospacer
**   .********** .************ .*

268. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gccgcgcaaatcgagcgtgccgccggtgaggc	Protospacer
************ **** *******..*    

269. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatt	Protospacer
*.  ******** * *************  * 

270. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatt	Protospacer
*.  ******** * *************  * 

271. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to JX128258 (Escherichia phage ECML-117, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

272. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to MT446405 (UNVERIFIED: Escherichia virus TH32, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

273. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to MT446408 (UNVERIFIED: Escherichia virus TH35, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

274. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

275. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

276. spacer 3.30|1066668|32|CP030939|CRISPRCasFinder,CRT matches to NC_048073 (Escherichia phage FEC19, complete genome) position: , mismatch: 8, identity: 0.75

caaacgatgagcgggccaacgaatcgccgttg	CRISPR spacer
cgctcgatgagccgtccaacgaatcgcccatc	Protospacer
*.  ******** * *************  * 

277. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
gtgaacggttcgacgccgctcgccatggcagg	Protospacer
.*  ************** *****.**** . 

278. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aagagcggttcgacgatgatcgccgtggcagt	Protospacer
*   .********** .************ .*

279. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aagagcggttcgacgatgatcgccgtggcagt	Protospacer
*   .********** .************ .*

280. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aagagcggttcgacgatgatcgccgtggcagt	Protospacer
*   .********** .************ .*

281. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aagagcggttcgacgatgatcgccgtggcagt	Protospacer
*   .********** .************ .*

282. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
aagagcggttcgacgatgatcgccgtggcagt	Protospacer
*   .********** .************ .*

283. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
acgctcgcttcgacgccgaacgccgtgggctt	Protospacer
*. * ** *********** ******** . *

284. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
acgctcgcttcgacgccgaacgccgtgggctt	Protospacer
*. * ** *********** ******** . *

285. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.75

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
acgctcgcttcgacgccgaacgccgtgggctt	Protospacer
*. * ** *********** ******** . *

286. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ccgcgcaaatcgagcgtgccgccggtgaggc	Protospacer
*********** **** *******..*    

287. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

288. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

289. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

290. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ctcggcagatccagcgcgccgccgacgagcg	Protospacer
*.  ***.******** **********  *.

291. spacer 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP016897 (Acinetobacter soli strain GFJ2 plasmid pGFJ1, complete sequence) position: , mismatch: 9, identity: 0.719

aaaaaacagcaaaagatgaacaaaatataaac	CRISPR spacer
attgaacagcaaaagattaacaaattattttg	Protospacer
*  .************* ****** ***    

292. spacer 2.6|1050344|32|CP030939|CRISPRCasFinder,CRT matches to AP014380 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C70, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

aaaaaacagcaaaagatgaacaaaatataaac	CRISPR spacer
tgaaaacagcaaaagatgaaagaaaagcaata	Protospacer
 .****************** .*** ..**  

293. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
ggtcttcaagtcgagcgagccgccgacgccga	Protospacer
* . . ***.** ****************. *

294. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg	Protospacer
.*.  ***.******** **********  *.

295. spacer 3.19|1067277|32|CP030939|PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg	Protospacer
.*.  ***.******** **********  *.

296. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg	Protospacer
.*.  ***.******** **********  *.

297. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
actcggcagatccagcgcgccgccgacgagcg	Protospacer
.*.  ***.******** **********  *.

298. spacer 3.19|1067277|32|CP030939|PILER-CR matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gatgatgaaatccaacgagccgccgaggcttt	Protospacer
* .*   *******.*********** ***. 

299. spacer 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 9, identity: 0.719

cacaagaaaaagatatcgcagcgtcatttatg	CRISPR spacer
gacaagaaaaaaatgtcgcagcgtcgaatggt	Protospacer
 **********.**.**********.  *.  

300. spacer 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcgccgcaaatactaccgcaacggcgcgc	CRISPR spacer
cgccgatcgcagatacgaccgcaacggcgcgc	Protospacer
  .. ..****.**** ***************

301. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 9, identity: 0.719

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
ccgaccggttcgacgccgatcaccgtggtgtt	Protospacer
 .   ****************.******.  *

302. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719

-atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
cgttcg-gggtcgacgccgatctccgtggcggc	Protospacer
 .*.*. ** ************ ******* ..

303. spacer 3.39|1067217|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaagctacttttgtgttcaactgatgcatt	CRISPR spacer
caatccgaccttttgtgttcgactgatggatt	Protospacer
 **      ***********.******* ***

304. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
tcttcggcatccagcgagccgccgtcgccca	Protospacer
.* .  . **************** ***.**

305. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
gtcttcaagtcgagcgagccgccgacgccga	Protospacer
 . . ***.** ****************. *

306. spacer 3.40|1067278|31|CP030939|CRISPRCasFinder,CRT matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

ccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
atgatgaaatccaacgagccgccgaggcttt	Protospacer
 .*   *******.*********** ***. 

307. spacer 2.8|1050466|32|CP030939|CRISPRCasFinder,CRT matches to KF302036 (UNVERIFIED: Pseudoalteromonas phage HS2, complete genome) position: , mismatch: 10, identity: 0.688

ggttaaacatgccgttaacgccatttcagcgc	CRISPR spacer
ttttaaacatgacgttaaagccatttttattg	Protospacer
  ********* ****** *******. ..  

308. spacer 2.9|1050527|32|CP030939|CRISPRCasFinder,CRT matches to MN693675 (Marine virus AFVG_250M630, complete genome) position: , mismatch: 10, identity: 0.688

ggtatttattgtgcaattagctttgcattaaa	CRISPR spacer
atcatttattgtataattagctttgcctctgc	Protospacer
. .*********..************ *. . 

309. spacer 2.9|1050527|32|CP030939|CRISPRCasFinder,CRT matches to MN693578 (Marine virus AFVG_25M520, complete genome) position: , mismatch: 10, identity: 0.688

ggtatttattgtgcaattagctttgcattaaa	CRISPR spacer
atcatttattgtataattagctttgcctctgc	Protospacer
. .*********..************ *. . 

310. spacer 2.13|1050343|33|CP030939|PILER-CR matches to NZ_CP016897 (Acinetobacter soli strain GFJ2 plasmid pGFJ1, complete sequence) position: , mismatch: 10, identity: 0.697

gaaaaaacagcaaaagatgaacaaaatataaac	CRISPR spacer
cattgaacagcaaaagattaacaaattattttg	Protospacer
 *  .************* ****** ***    

311. spacer 3.4|1066361|33|CP030939|PILER-CR matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 10, identity: 0.697

gcacaagaaaaagatatcgcagcgtcatttatg	CRISPR spacer
cgacaagaaaaaaatgtcgcagcgtcgaatggt	Protospacer
  **********.**.**********.  *.  

312. spacer 3.19|1067277|32|CP030939|PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcgcaaatccagcgagccgccgacgctca	CRISPR spacer
atcttcggcatccagcgagccgccgtcgccca	Protospacer
..* .  . **************** ***.**

313. spacer 3.23|1066240|32|CP030939|CRISPRCasFinder,CRT matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 10, identity: 0.688

attttttccgttagttagtgagcgtgataaca	CRISPR spacer
tctttttccgttagttcgtcagcgtacatgcc	Protospacer
 .************** ** *****.   .* 

314. spacer 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 10, identity: 0.688

agggttacagaaaagaagcatcgcaacttgat	CRISPR spacer
acatttacggaaaagaagcagcgcaacgcatc	Protospacer
* . ****.*********** ****** .. .

315. spacer 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

agggttacagaaaagaagcatcgcaacttgat	CRISPR spacer
acatttacggaaaagaagcagcgcaacgcatc	Protospacer
* . ****.*********** ****** .. .

316. spacer 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

agggttacagaaaagaagcatcgcaacttgat	CRISPR spacer
acatttacggaaaagaagcagcgcaacgcatc	Protospacer
* . ****.*********** ****** .. .

317. spacer 3.24|1066301|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

agggttacagaaaagaagcatcgcaacttgat	CRISPR spacer
acatttacggaaaagaagcagcgcaacgcatc	Protospacer
* . ****.*********** ****** .. .

318. spacer 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021153 (Photobacterium damselae subsp. damselae strain KC-Na-1 plasmid pPDD-Na-1-1, complete sequence) position: , mismatch: 10, identity: 0.688

cacaagaaaaagatatcgcagcgtcatttatg	CRISPR spacer
tgcgcttaaatgatattgcagcgtcatttaaa	Protospacer
..*.   *** *****.************* .

319. spacer 3.25|1066362|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP035460 (Photobacterium damselae subsp. damselae strain KC-Na-NB1 plasmid pFPPDNB1-2, complete sequence) position: , mismatch: 10, identity: 0.688

cacaagaaaaagatatcgcagcgtcatttatg	CRISPR spacer
tgcgcttaaatgatattgcagcgtcatttaaa	Protospacer
..*.   *** *****.************* .

320. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

321. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

322. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

323. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

324. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

325. spacer 3.26|1066423|32|CP030939|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgctttt--------ggcggcgtgggctaatgctggtt	CRISPR spacer
--------tagcgcgaaggcggcgtgcgcaaatgctggtt	Protospacer
        *        ********* ** **********

326. spacer 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT matches to AP013483 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C20A-MedDCM-OCT-S30-C71) position: , mismatch: 10, identity: 0.688

gtttcgccgcaaatactaccgcaacggcgcgc	CRISPR spacer
tatgtgccgcaattactaccgcaactgcaact	Protospacer
  * .******* ************ **.  .

327. spacer 3.28|1066546|32|CP030939|CRISPRCasFinder,CRT matches to AP013484 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C20A-MedDCM-OCT-S36-C79) position: , mismatch: 10, identity: 0.688

gtttcgccgcaaatactaccgcaacggcgcgc	CRISPR spacer
tatgtgccgcaattactaccgcaactgcaact	Protospacer
  * .******* ************ **.  .

328. spacer 3.31|1066729|32|CP030939|CRISPRCasFinder,CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

atccacggttcgacgccgatcgccgtggctat	CRISPR spacer
ccgtacggttcgacgccgttcgccttgcacgt	Protospacer
 . .************** ***** **  ..*

329. spacer 2.15|1050465|33|CP030939|PILER-CR matches to KF302036 (UNVERIFIED: Pseudoalteromonas phage HS2, complete genome) position: , mismatch: 11, identity: 0.667

gggttaaacatgccgttaacgccatttcagcgc	CRISPR spacer
tttttaaacatgacgttaaagccatttttattg	Protospacer
   ********* ****** *******. ..  

330. spacer 3.29|1066607|32|CP030939|CRISPRCasFinder,CRT matches to NZ_CP048308 (Escherichia coli strain 9 plasmid p009_D, complete sequence) position: , mismatch: 11, identity: 0.656

cgaacagaaaaaccgttctcagccagcgtcag	CRISPR spacer
acggtgataaaaccgtgctccgccagcgtcat	Protospacer
  ..... ******** *** ********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1083827 : 1090967 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1163692 : 1171456 6 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_3 1291395 : 1334016 53 Escherichia_phage(52.0%) integrase,holin,tail,terminase attL 1294494:1294510|attR 1332164:1332180
DBSCAN-SWA_4 1709364 : 1718806 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1758786 : 1825867 81 Enterobacteria_phage(40.0%) holin,lysis,integrase,protease,terminase,tail,head,portal attL 1760415:1760430|attR 1822548:1822563
DBSCAN-SWA_6 1875013 : 1977038 112 Salmonella_phage(62.5%) plate,lysis,transposase,integrase,protease,tail,capsid,head,portal attL 1866939:1866954|attR 1944803:1944818
DBSCAN-SWA_7 2248639 : 2298047 67 Shigella_phage(46.0%) holin,plate,tRNA,integrase,protease,terminase,tail,head,capsid,portal attL 2263430:2263445|attR 2291425:2291440
DBSCAN-SWA_8 2712439 : 2765838 67 Enterobacteria_phage(48.84%) holin,lysis,integrase,protease,terminase,tail attL 2723837:2723852|attR 2767270:2767285
DBSCAN-SWA_9 3161620 : 3209194 64 Enterobacteria_phage(35.71%) holin,lysis,integrase,terminase,tail,head,capsid,portal attL 3177009:3177024|attR 3209732:3209747
DBSCAN-SWA_10 3324174 : 3371777 72 Enterobacteria_phage(50.77%) holin,lysis,integrase,terminase,tail,head,capsid,portal attL 3346019:3346034|attR 3373485:3373500
DBSCAN-SWA_11 3590540 : 3658633 74 Enterobacteria_phage(42.31%) holin,lysis,tRNA,transposase,integrase,protease,tail,capsid,head,terminase,portal attL 3602450:3602496|attR 3648426:3648472
DBSCAN-SWA_12 3955880 : 3975676 15 uncultured_Caudovirales_phage(50.0%) transposase,plate NA
DBSCAN-SWA_13 4223193 : 4303450 95 Shigella_phage(41.67%) plate,holin,tRNA,transposase,integrase,protease,tail,capsid,head,terminase,portal attL 4272709:4272724|attR 4304161:4304176
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030940
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 201802 : 220230 19 Escherichia_phage(37.5%) integrase,transposase attL 216647:216660|attR 221713:221726
DBSCAN-SWA_2 239647 : 247643 11 Escherichia_phage(33.33%) integrase,transposase attL 238859:238871|attR 244361:244373
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage