Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026121 Streptomyces sp. Go-475 chromosome, complete genome 7 crisprs csa3,WYL,casR,DEDDh,cas4,Cas9_archaeal,cas3,DinG 6 3 0 0

Results visualization

1. CP026121
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_1 35791-35989 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_2 1011552-1011686 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_3 1153997-1154147 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_6 3037159-3037273 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_7 3299231-3299321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_8 4388896-4388972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026121_13 6533766-6533894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 35740-35759 0 1.0
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 36200-36219 0 1.0
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 36245-36264 0 1.0
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 36290-36309 0 1.0
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 36440-36459 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 35742-35759 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 36158-36175 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 36202-36219 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 36247-36264 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 36292-36309 0 1.0
CP026121_1 1.2|35859|18|CP026121|CRT 35859-35876 18 CP026121.1 36442-36459 0 1.0
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 35740-35759 0 1.0
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 36200-36219 0 1.0
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 36245-36264 0 1.0
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 36290-36309 0 1.0
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 36440-36459 0 1.0
CP026121_11 11.1|5683033|55|CP026121|PILER-CR 5683033-5683087 55 CP026121.1 5683435-5683489 0 1.0
CP026121_11 11.2|5683111|37|CP026121|PILER-CR 5683111-5683147 37 CP026121.1 5683513-5683549 0 1.0
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 35695-35714 2 0.9
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 35755-35774 2 0.9
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 35770-35789 2 0.9
CP026121_1 1.1|35815|20|CP026121|CRT 35815-35834 20 CP026121.1 6065657-6065676 2 0.9
CP026121_1 1.3|35901|21|CP026121|CRT 35901-35921 21 CP026121.1 3150956-3150976 2 0.905
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 35695-35714 2 0.9
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 35755-35774 2 0.9
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 35770-35789 2 0.9
CP026121_1 1.4|35946|20|CP026121|CRT 35946-35965 20 CP026121.1 6065657-6065676 2 0.9

1. spacer 1.1|35815|20|CP026121|CRT matches to position: 35740-35759, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

2. spacer 1.1|35815|20|CP026121|CRT matches to position: 36200-36219, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

3. spacer 1.1|35815|20|CP026121|CRT matches to position: 36245-36264, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

4. spacer 1.1|35815|20|CP026121|CRT matches to position: 36290-36309, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

5. spacer 1.1|35815|20|CP026121|CRT matches to position: 36440-36459, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

6. spacer 1.2|35859|18|CP026121|CRT matches to position: 35742-35759, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

7. spacer 1.2|35859|18|CP026121|CRT matches to position: 36158-36175, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

8. spacer 1.2|35859|18|CP026121|CRT matches to position: 36202-36219, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

9. spacer 1.2|35859|18|CP026121|CRT matches to position: 36247-36264, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

10. spacer 1.2|35859|18|CP026121|CRT matches to position: 36292-36309, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

11. spacer 1.2|35859|18|CP026121|CRT matches to position: 36442-36459, mismatch: 0, identity: 1.0

cgcggcacggcggtgggc	CRISPR spacer
cgcggcacggcggtgggc	Protospacer
******************

12. spacer 1.4|35946|20|CP026121|CRT matches to position: 35740-35759, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

13. spacer 1.4|35946|20|CP026121|CRT matches to position: 36200-36219, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

14. spacer 1.4|35946|20|CP026121|CRT matches to position: 36245-36264, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

15. spacer 1.4|35946|20|CP026121|CRT matches to position: 36290-36309, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

16. spacer 1.4|35946|20|CP026121|CRT matches to position: 36440-36459, mismatch: 0, identity: 1.0

tgcgcggcacggcggtgggc	CRISPR spacer
tgcgcggcacggcggtgggc	Protospacer
********************

17. spacer 11.1|5683033|55|CP026121|PILER-CR matches to position: 5683435-5683489, mismatch: 0, identity: 1.0

gcttggcctccgctccctcggccgcgtcgacggcggcctcggcggtggctgcggt	CRISPR spacer
gcttggcctccgctccctcggccgcgtcgacggcggcctcggcggtggctgcggt	Protospacer
*******************************************************

18. spacer 11.2|5683111|37|CP026121|PILER-CR matches to position: 5683513-5683549, mismatch: 0, identity: 1.0

tctccgtggcttcggaggcctcggccgctgcggcggc	CRISPR spacer
tctccgtggcttcggaggcctcggccgctgcggcggc	Protospacer
*************************************

19. spacer 1.1|35815|20|CP026121|CRT matches to position: 35695-35714, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

20. spacer 1.1|35815|20|CP026121|CRT matches to position: 35755-35774, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

21. spacer 1.1|35815|20|CP026121|CRT matches to position: 35770-35789, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

22. spacer 1.1|35815|20|CP026121|CRT matches to position: 6065657-6065676, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggctcggcggtgggc	Protospacer
** ***** ***********

23. spacer 1.3|35901|21|CP026121|CRT matches to position: 3150956-3150976, mismatch: 2, identity: 0.905

cgcgcggcacaagctggcccg	CRISPR spacer
cgcccggcacaagatggcccg	Protospacer
*** ********* *******

24. spacer 1.4|35946|20|CP026121|CRT matches to position: 35695-35714, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

25. spacer 1.4|35946|20|CP026121|CRT matches to position: 35755-35774, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

26. spacer 1.4|35946|20|CP026121|CRT matches to position: 35770-35789, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggcgcggcggtgggc	Protospacer
** *****.***********

27. spacer 1.4|35946|20|CP026121|CRT matches to position: 6065657-6065676, mismatch: 2, identity: 0.9

tgcgcggcacggcggtgggc	CRISPR spacer
tgggcggctcggcggtgggc	Protospacer
** ***** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026121_14 14.1|8448280|25|CP026121|CRISPRCasFinder 8448280-8448304 25 NZ_CP049041 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence 21080-21104 3 0.88
CP026121_14 14.1|8448280|25|CP026121|CRISPRCasFinder 8448280-8448304 25 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 224762-224786 4 0.84
CP026121_14 14.1|8448280|25|CP026121|CRISPRCasFinder 8448280-8448304 25 MN855976 Siphoviridae sp. isolate 68, complete genome 10053-10077 6 0.76
CP026121_4 4.2|1157515|32|CP026121|CRISPRCasFinder 1157515-1157546 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144537-144568 8 0.75
CP026121_4 4.2|1157515|32|CP026121|CRISPRCasFinder 1157515-1157546 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156004-156035 8 0.75
CP026121_5 5.2|2063720|32|CP026121|PILER-CR 2063720-2063751 32 MT773557 Myoviridae sp. isolate BML_S_1 genomic sequence 22876-22907 9 0.719

1. spacer 14.1|8448280|25|CP026121|CRISPRCasFinder matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 3, identity: 0.88

ttccggccaggcggacttggcggca	CRISPR spacer
atcctgacaggcggacttggcggca	Protospacer
 *** * ******************

2. spacer 14.1|8448280|25|CP026121|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

ttccggccaggcggacttggcggca	CRISPR spacer
ctccggcgaggaggacttggcggcg	Protospacer
.****** *** ************.

3. spacer 14.1|8448280|25|CP026121|CRISPRCasFinder matches to MN855976 (Siphoviridae sp. isolate 68, complete genome) position: , mismatch: 6, identity: 0.76

ttccggccaggcggacttggcggca	CRISPR spacer
cgaatgccaggcggacttggcggcc	Protospacer
.    ******************* 

4. spacer 4.2|1157515|32|CP026121|CRISPRCasFinder matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 8, identity: 0.75

---gaatccgtatcagcagccgggataccagcaga	CRISPR spacer
cctggat---tatcagcagcctgcataccagcacg	Protospacer
   *.**   *********** * ********* .

5. spacer 4.2|1157515|32|CP026121|CRISPRCasFinder matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

---gaatccgtatcagcagccgggataccagcaga	CRISPR spacer
cctggat---tatcagcagcctgcataccagcacg	Protospacer
   *.**   *********** * ********* .

6. spacer 5.2|2063720|32|CP026121|PILER-CR matches to MT773557 (Myoviridae sp. isolate BML_S_1 genomic sequence) position: , mismatch: 9, identity: 0.719

accccaagcaccaaccacaggccacgaccgcc	CRISPR spacer
aacccaagcaccaacctctggccactcattct	Protospacer
* ************** * ******   . *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage