Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030277 Rhodobiaceae bacterium strain SMS8 chromosome, complete genome 1 crisprs csa3,cas3,PD-DExK,DEDDh,WYL,DinG 0 1 6 0

Results visualization

1. CP030277
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030277_1 2663145-2663227 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030277_2 2.2|2831617|34|CP030277|CRISPRCasFinder 2831617-2831650 34 NZ_CP028972 Aminobacter sp. MSH1 plasmid pUSP4, complete sequence 19810-19843 9 0.735

1. spacer 2.2|2831617|34|CP030277|CRISPRCasFinder matches to NZ_CP028972 (Aminobacter sp. MSH1 plasmid pUSP4, complete sequence) position: , mismatch: 9, identity: 0.735

acgatcacggtcacgcccatcaacatcggtaaaa	CRISPR spacer
ggcatcacgggcacgcccatcaacatcggcgggc	Protospacer
.  ******* ******************.... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19347 : 38653 25 Burkholderia_phage(28.57%) terminase,tail,plate,head,portal,holin,capsid NA
DBSCAN-SWA_2 482863 : 497720 17 Paracoccus_phage(27.27%) terminase,tail,protease,head,portal,capsid NA
DBSCAN-SWA_3 930302 : 937862 8 Only_Syngen_Nebraska_virus(16.67%) NA NA
DBSCAN-SWA_4 1068985 : 1082639 11 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_5 1095078 : 1104933 12 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_6 1219766 : 1227818 9 Staphylococcus_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage