Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030325 Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 1 0
CP030326 Staphylococcus aureus strain AR_474 chromosome, complete genome 8 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 9 3 10 0

Results visualization

1. CP030325
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11027 : 18100 7 Staphylococcus_phage(42.86%) integrase,transposase attL 14743:14799|attR 18101:18157
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030326
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_1 462910-463011 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_2 818452-818534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_3 859399-859477 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_4 864854-865123 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_5 908081-908162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_6 1742606-1742690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_7 2175847-2175928 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030326_8 2305103-2305183 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 181692-181713 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 304768-304789 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 691387-691408 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 817493-817514 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 908154-908175 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1472550-1472571 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1561104-1561125 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1742682-1742703 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1757216-1757237 0 1.0
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 2074965-2074986 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 181692-181713 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 304768-304789 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 691387-691408 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 817493-817514 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 908154-908175 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1472550-1472571 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1561104-1561125 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1742682-1742703 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1757216-1757237 0 1.0
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 2074965-2074986 0 1.0
CP030326_7 7.1|2175871|34|CP030326|CRISPRCasFinder 2175871-2175904 34 CP030326.1 859398-859431 0 1.0
CP030326_7 7.1|2175871|34|CP030326|CRISPRCasFinder 2175871-2175904 34 CP030326.1 1260903-1260936 0 1.0
CP030326_3 3.1|859423|31|CP030326|CRISPRCasFinder 859423-859453 31 CP030326.1 1777089-1777119 1 0.968
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1022475-1022496 1 0.955
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1776944-1776965 1 0.955
CP030326_4 4.1|864890|22|CP030326|CRT 864890-864911 22 CP030326.1 1777177-1777198 1 0.955
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 818443-818465 1 0.957
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 818721-818743 1 0.957
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 1472666-1472688 1 0.957
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 2075023-2075045 1 0.957
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 2414635-2414657 1 0.957
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1022475-1022496 1 0.955
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1776944-1776965 1 0.955
CP030326_4 4.3|865007|22|CP030326|CRT 865007-865028 22 CP030326.1 1777177-1777198 1 0.955
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 818443-818465 1 0.957
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 818721-818743 1 0.957
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 1472666-1472688 1 0.957
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 2075023-2075045 1 0.957
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 2414635-2414657 1 0.957
CP030326_5 5.1|908105|34|CP030326|CRISPRCasFinder 908105-908138 34 CP030326.1 1472646-1472679 1 0.971
CP030326_6 6.1|1742632|33|CP030326|CRISPRCasFinder 1742632-1742664 33 CP030326.1 1472647-1472679 1 0.97
CP030326_7 7.1|2175871|34|CP030326|CRISPRCasFinder 2175871-2175904 34 CP030326.1 1869317-1869350 1 0.971
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 872142-872172 1 0.968
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 872198-872228 1 0.968
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 1560987-1561009 2 0.913
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 CP030326.1 2175928-2175950 2 0.913
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 1560987-1561009 2 0.913
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 CP030326.1 2175928-2175950 2 0.913
CP030326_7 7.1|2175871|34|CP030326|CRISPRCasFinder 2175871-2175904 34 CP030326.1 1477020-1477053 2 0.941
CP030326_7 7.1|2175871|34|CP030326|CRISPRCasFinder 2175871-2175904 34 CP030326.1 2865285-2865318 2 0.941
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 83049-83079 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 424172-424202 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 691442-691472 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 908417-908447 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1163976-1164006 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1266504-1266534 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1472605-1472635 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1561040-1561070 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1561156-1561186 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 1757270-1757300 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 2414688-2414718 2 0.935
CP030326_10 10.1|2425489|31|CP030326|CRISPRCasFinder 2425489-2425519 31 CP030326.1 2591686-2591716 2 0.935

1. spacer 4.1|864890|22|CP030326|CRT matches to position: 181692-181713, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

2. spacer 4.1|864890|22|CP030326|CRT matches to position: 304768-304789, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 4.1|864890|22|CP030326|CRT matches to position: 691387-691408, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 4.1|864890|22|CP030326|CRT matches to position: 817493-817514, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 4.1|864890|22|CP030326|CRT matches to position: 908154-908175, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 4.1|864890|22|CP030326|CRT matches to position: 1472550-1472571, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 4.1|864890|22|CP030326|CRT matches to position: 1561104-1561125, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 4.1|864890|22|CP030326|CRT matches to position: 1742682-1742703, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 4.1|864890|22|CP030326|CRT matches to position: 1757216-1757237, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 4.1|864890|22|CP030326|CRT matches to position: 2074965-2074986, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 4.3|865007|22|CP030326|CRT matches to position: 181692-181713, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 4.3|865007|22|CP030326|CRT matches to position: 304768-304789, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 4.3|865007|22|CP030326|CRT matches to position: 691387-691408, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 4.3|865007|22|CP030326|CRT matches to position: 817493-817514, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 4.3|865007|22|CP030326|CRT matches to position: 908154-908175, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 4.3|865007|22|CP030326|CRT matches to position: 1472550-1472571, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 4.3|865007|22|CP030326|CRT matches to position: 1561104-1561125, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 4.3|865007|22|CP030326|CRT matches to position: 1742682-1742703, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 4.3|865007|22|CP030326|CRT matches to position: 1757216-1757237, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 4.3|865007|22|CP030326|CRT matches to position: 2074965-2074986, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 7.1|2175871|34|CP030326|CRISPRCasFinder matches to position: 859398-859431, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

22. spacer 7.1|2175871|34|CP030326|CRISPRCasFinder matches to position: 1260903-1260936, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

23. spacer 3.1|859423|31|CP030326|CRISPRCasFinder matches to position: 1777089-1777119, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** *******

24. spacer 4.1|864890|22|CP030326|CRT matches to position: 1022475-1022496, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

25. spacer 4.1|864890|22|CP030326|CRT matches to position: 1776944-1776965, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

26. spacer 4.1|864890|22|CP030326|CRT matches to position: 1777177-1777198, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

27. spacer 4.2|864948|23|CP030326|CRT matches to position: 818443-818465, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

28. spacer 4.2|864948|23|CP030326|CRT matches to position: 818721-818743, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

29. spacer 4.2|864948|23|CP030326|CRT matches to position: 1472666-1472688, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

30. spacer 4.2|864948|23|CP030326|CRT matches to position: 2075023-2075045, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 4.2|864948|23|CP030326|CRT matches to position: 2414635-2414657, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 4.3|865007|22|CP030326|CRT matches to position: 1022475-1022496, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

33. spacer 4.3|865007|22|CP030326|CRT matches to position: 1776944-1776965, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

34. spacer 4.3|865007|22|CP030326|CRT matches to position: 1777177-1777198, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

35. spacer 4.4|865065|23|CP030326|CRT matches to position: 818443-818465, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

36. spacer 4.4|865065|23|CP030326|CRT matches to position: 818721-818743, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

37. spacer 4.4|865065|23|CP030326|CRT matches to position: 1472666-1472688, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 4.4|865065|23|CP030326|CRT matches to position: 2075023-2075045, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 4.4|865065|23|CP030326|CRT matches to position: 2414635-2414657, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 5.1|908105|34|CP030326|CRISPRCasFinder matches to position: 1472646-1472679, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

41. spacer 6.1|1742632|33|CP030326|CRISPRCasFinder matches to position: 1472647-1472679, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

42. spacer 7.1|2175871|34|CP030326|CRISPRCasFinder matches to position: 1869317-1869350, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgtgttgg	Protospacer
*************************.********

43. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 872142-872172, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

44. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 872198-872228, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

45. spacer 4.2|864948|23|CP030326|CRT matches to position: 1560987-1561009, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

46. spacer 4.2|864948|23|CP030326|CRT matches to position: 2175928-2175950, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

47. spacer 4.4|865065|23|CP030326|CRT matches to position: 1560987-1561009, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

48. spacer 4.4|865065|23|CP030326|CRT matches to position: 2175928-2175950, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

49. spacer 7.1|2175871|34|CP030326|CRISPRCasFinder matches to position: 1477020-1477053, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

50. spacer 7.1|2175871|34|CP030326|CRISPRCasFinder matches to position: 2865285-2865318, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

51. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 83049-83079, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

52. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 424172-424202, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

53. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 691442-691472, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

54. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 908417-908447, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

55. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1163976-1164006, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1266504-1266534, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

57. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1472605-1472635, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

58. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1561040-1561070, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

59. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1561156-1561186, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

60. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 1757270-1757300, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

61. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 2414688-2414718, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

62. spacer 10.1|2425489|31|CP030326|CRISPRCasFinder matches to position: 2591686-2591716, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP030326_4 4.2|864948|23|CP030326|CRT 864948-864970 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP030326_4 4.4|865065|23|CP030326|CRT 865065-865087 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP030326_9 9.1|2317450|34|CP030326|CRISPRCasFinder 2317450-2317483 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP030326_9 9.1|2317450|34|CP030326|CRISPRCasFinder 2317450-2317483 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 4.2|864948|23|CP030326|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 4.2|864948|23|CP030326|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 4.4|865065|23|CP030326|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 4.4|865065|23|CP030326|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 9.1|2317450|34|CP030326|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 9.1|2317450|34|CP030326|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 360594 : 402858 64 Staphylococcus_phage(90.62%) head,tail,holin,portal,integrase,terminase attL 360484:360501|attR 403590:403607
DBSCAN-SWA_2 796571 : 804392 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 816363 : 831004 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 916492 : 973414 78 Staphylococcus_phage(76.12%) head,tail,holin,portal,capsid,integrase,terminase,transposase attL 914580:914596|attR 949234:949250
DBSCAN-SWA_5 1072595 : 1134145 74 Staphylococcus_phage(89.23%) head,tail,holin,portal,protease,capsid,integrase,terminase,bacteriocin attL 1075441:1075467|attR 1120944:1120970
DBSCAN-SWA_6 1165549 : 1173959 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 1792276 : 1801319 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1922034 : 1992656 67 Staphylococcus_phage(91.67%) tRNA,protease,integrase,transposase attL 1939597:1939613|attR 1988058:1988074
DBSCAN-SWA_9 1998857 : 2003104 6 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_10 2128027 : 2173967 69 Staphylococcus_phage(95.65%) head,tail,holin,integrase,portal,capsid,protease attL 2147455:2147472|attR 2171951:2171968
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage