Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031145 Intrasporangium calvum strain C5 chromosome, complete genome 3 crisprs csa3,DEDDh,cas4,WYL,cas3 0 1 3 0

Results visualization

1. CP031145
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031145_1 271571-271680 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031145_2 1272122-1272196 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031145_3 2756022-2756139 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031145_2 2.1|1272146|27|CP031145|CRISPRCasFinder 1272146-1272172 27 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 77956-77982 5 0.815

1. spacer 2.1|1272146|27|CP031145|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

caagtggtgcggtttccctgcaggccg	CRISPR spacer
taagcggtgcggtttcccagcaggggg	Protospacer
.***.************* *****  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 76984 : 140060 57 Mycobacterium_phage(18.18%) transposase,integrase attL 133387:133404|attR 145129:145146
DBSCAN-SWA_2 300473 : 350964 51 Mycobacterium_phage(42.86%) protease,holin,transposase,integrase attL 310686:310730|attR 323723:323767
DBSCAN-SWA_3 3601990 : 3647519 49 Gordonia_phage(16.67%) protease,holin,transposase,integrase attL 3601078:3601096|attR 3607677:3607695
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage