1. spacer 2.1|1812678|19|CP031194|CRISPRCasFinder matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cccgctgcccgccgcgccg CRISPR spacer
cccgctgcccgccgcgccg Protospacer
*******************
2. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 1, identity: 0.969
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
cgcacgctgatcgccggggacgtcaagggcga Protospacer
********************.***********
3. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 1, identity: 0.969
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
cgcacgctgatcgccggggacgtcaagggcga Protospacer
********************.***********
4. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 1, identity: 0.969
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
cgcacgctgatcgccggggacgtcaagggcga Protospacer
********************.***********
5. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.903
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ccaacgtcgtcttccccacaccgcccttgat Protospacer
*** ** ********************** *
6. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gaccaacgtcgtcttccccacaccgcccttgat Protospacer
*.*** ** ********************** *
7. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
ggacatccggacgcacggcctcgcggcccggc Protospacer
* ..*** ***********************
8. spacer 9.6|2934331|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to GQ919031 (Streptomyces phage ZL12, complete genome) position: , mismatch: 5, identity: 0.844
aggcagcgcggccgggtgaggtagccgcgaac CRISPR spacer
aggcatcgcggccgggtgaggtagccggagag Protospacer
***** ********************* ..*
9. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP046568 (Dietzia sp. DQ12-45-1b plasmid pI, complete sequence) position: , mismatch: 5, identity: 0.839
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ctaccgaggtcttccccaccccgcccttgag Protospacer
*.***** *********** *********
10. spacer 13.3|5015258|31|CP031194|CRT matches to NC_023497 (Amycolatopsis keratiniphila plasmid pXL100, complete sequence) position: , mismatch: 5, identity: 0.839
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
cctcgttcgtcttgcccacaccgcccttgtt Protospacer
** * ****** *****************
11. spacer 13.3|5015258|31|CP031194|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 5, identity: 0.839
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ctaccgacgtcttgcccacgccgcccttctg Protospacer
*.*********** *****.******** *
12. spacer 13.3|5015258|31|CP031194|CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 5, identity: 0.839
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
caaccgacgtcttgcccacgccgcccttctg Protospacer
* *********** *****.******** *
13. spacer 13.3|5015258|31|CP031194|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 5, identity: 0.839
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ctaccgacgtcttgcccacgccgcccttctg Protospacer
*.*********** *****.******** *
14. spacer 6.1|2895929|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 6, identity: 0.818
tctcgacaaggcactgtcgatcgggagcgccat- CRISPR spacer
tctcgacaaggcgctgtcgacc-ggatcgtcagc Protospacer
************.*******.* *** **.**
15. spacer 6.1|2895929|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 6, identity: 0.818
tctcgacaaggcactgtcgatcgggagcgccat- CRISPR spacer
tctcgacaaggcgctgtcgacc-ggatcgtcagc Protospacer
************.*******.* *** **.**
16. spacer 6.1|2895929|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 6, identity: 0.818
tctcgacaaggcactgtcgatcgggagcgccat- CRISPR spacer
tctcgacaaggcgctgtcgacc-ggatcgtcagc Protospacer
************.*******.* *** **.**
17. spacer 6.1|2895929|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 6, identity: 0.818
tctcgacaaggcactgtcgatcgggagcgccat- CRISPR spacer
tctcgacaaggcgctgtcgacc-ggatcgtcagc Protospacer
************.*******.* *** **.**
18. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.818
gcccccgccgcccgccgctcccgccaagccggt-- CRISPR spacer
gctcccgccccccgccgctcccgcc--gccgagtc Protospacer
**.****** *************** ****.
19. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.818
gcccccgccgcccgccgctcccgccaagccggt-- CRISPR spacer
gcccccgccccccgccgatcccgcc--gccaggcg Protospacer
********* ******* ******* ***.*
20. spacer 6.6|2896234|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.818
gtcgtcggc--ggccgttgttccggtggcggccgt CRISPR spacer
--tgtgggcaaggccgttgttcaggtggccgccgt Protospacer
.** *** *********** ****** *****
21. spacer 8.5|2920361|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.812
atgaagtcgcctgagagcacaggagccgtggc-- CRISPR spacer
atgaagtcgcctgggagcac--gggctgcggctg Protospacer
*************.****** *.**.*.***
22. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to MN096374 (Microbacterium phage Roman, complete genome) position: , mismatch: 6, identity: 0.812
cgcacgct---gatcgccggggatgtcaagggcga CRISPR spacer
---actctcaagatcgccggggatgccaaggccga Protospacer
** ** **************.***** ***
23. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
gcgtccccggcgaacaggacgcggccgtgccg Protospacer
.*** *****************.***** *
24. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 6, identity: 0.812
atccgcctcgatcatcgcgcgccag--cgccgca CRISPR spacer
ggccgcctcgatcgtcgagcgccaggtcgccg-- Protospacer
. ***********.*** ******* *****
25. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 6, identity: 0.812
atccgcctcgatcatcgcgcgccag--cgccgca CRISPR spacer
ggccgcctcgatcgtcgagcgccaggtcgccg-- Protospacer
. ***********.*** ******* *****
26. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 6, identity: 0.812
atccgcctcgatcatcgcgcgccag--cgccgca CRISPR spacer
ggccgcctcgatcgtcgagcgccaggtcgccg-- Protospacer
. ***********.*** ******* *****
27. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.812
gggacgtc----tgcgccagctcgatgcggcggacg CRISPR spacer
----cgtcgatgtgcgtcagctcgatgcggccgacg Protospacer
**** ****.************** ****
28. spacer 13.1|5015136|32|CP031194|CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-tgattgatcgcgcgcttggccccgagaccggc CRISPR spacer
gtggtcg-ccgcgcggctggccccgagaccggc Protospacer
**.*.* .****** .****************
29. spacer 13.2|5015197|32|CP031194|CRT matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 6, identity: 0.812
tatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-acgcccacggctgttgcacggtcaggcatttc Protospacer
*.** *. *******.*** ************
30. spacer 13.2|5015197|32|CP031194|CRT matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 6, identity: 0.812
tatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-acgcccacggctgttgcacggtcaggcatttc Protospacer
*.** *. *******.*** ************
31. spacer 13.2|5015197|32|CP031194|CRT matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 6, identity: 0.812
tatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-acgcccacggctgttgcacggtcaggcatttc Protospacer
*.** *. *******.*** ************
32. spacer 13.2|5015197|32|CP031194|CRT matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 6, identity: 0.812
tatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-acgcccacggctgttgcacggtcaggcatttc Protospacer
*.** *. *******.*** ************
33. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ctagcgttgtcttaccgacaccgcccttgtt Protospacer
*.* ** .***** ** **************
34. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ccagggttgtcttgccgacaccgcccttgtt Protospacer
*** * .***** ** **************
35. spacer 13.5|5015379|32|CP031194|CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.812
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
aacgcgaaggcagcggcgtgatgggcacggtg Protospacer
**** ***** *************** * *
36. spacer 13.5|5015379|32|CP031194|CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.812
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
aacgcgaaggcagcggcgtgatgggcacggtg Protospacer
**** ***** *************** * *
37. spacer 13.6|5015440|32|CP031194|CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.812
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
aacgcgaaggcagcggcgtgatgggcacggtg Protospacer
**** ***** *************** * *
38. spacer 13.6|5015440|32|CP031194|CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.812
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
aacgcgaaggcagcggcgtgatgggcacggtg Protospacer
**** ***** *************** * *
39. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NC_023497 (Amycolatopsis keratiniphila plasmid pXL100, complete sequence) position: , mismatch: 6, identity: 0.818
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gacctcgttcgtcttgcccacaccgcccttgtt Protospacer
*.** * ****** *****************
40. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
ccagccggcgccggccgctcccgccaagccgac Protospacer
* *** **** ******************..
41. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cctgccgccgcgcgccgcccccgccaagcccgc Protospacer
*. ******* ******.*********** *.
42. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
ccagccggcgccggccgctcccgccaagccgac Protospacer
* *** **** ******************..
43. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cctgccgccgcgcgccgcccccgccaagcccgc Protospacer
*. ******* ******.*********** *.
44. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
ccagccggcgccggccgctcccgccaagccgag Protospacer
* *** **** ******************.
45. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cctgccgccgcgcgccgcccccgccaagcccgc Protospacer
*. ******* ******.*********** *.
46. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gcccccgccgcccgccgcgccctccgcgaaggc Protospacer
****************** *** **. * **.
47. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gcccccgtcgcccgccgctcctgccccgactgc Protospacer
*******.*************.*** * * *.
48. spacer 6.10|2896484|33|CP031194|PILER-CR matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ggacgtgaagccggcgccgtggagctgcgccgt CRISPR spacer
ggtctcgaagccggcggcgtggagctgagcgat Protospacer
** * .********** ********** ** .*
49. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 7, identity: 0.781
caggtcgcgatcacgagcgggacg----tggcgctt CRISPR spacer
caggtcgagatcacgagcgggccgatttcggc---- Protospacer
******* ************* ** .***
50. spacer 6.12|2896477|33|CP031194|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ggacgtgaagccggcgccgtggagctgcgccgt CRISPR spacer
ggtctcgaagccggcggcgtggagctgagcgat Protospacer
** * .********** ********** ** .*
51. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttccccggcgggcgctcgccagctccgggtag Protospacer
* ******* ***************** .
52. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttccccggcgggcgctcgccagctccgggtag Protospacer
* ******* ***************** .
53. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
54. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP034755 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
55. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_010158 (Yersinia pestis Angola plasmid pMT-pPCP, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
56. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_005815 (Yersinia pestis biovar Microtus str. 91001 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
57. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009490 (Yersinia pestis strain PBM19 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
58. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP033346 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
59. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009714 (Yersinia pestis Pestoides F plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
60. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009702 (Yersinia pestis strain Harbin35 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
61. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009784 (Yersinia pestis strain El Dorado plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
62. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009722 (Yersinia pestis strain Shasta plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
63. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045259 (Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
64. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_014022 (Yersinia pestis Z176003 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
65. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_017266 (Yersinia pestis biovar Medievalis str. Harbin 35 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
66. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
67. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
68. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP033694 (Yersinia pestis strain FDAARGOS_602 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
69. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_009378 (Yersinia pestis Pestoides F plasmid MT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
70. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP033700 (Yersinia pestis strain FDAARGOS_601 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
71. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP046272 (Enterobacter hormaechei strain E70 plasmid pE70-A, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
72. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_006323 (Yersinia pestis plasmid pG8786, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
73. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045146 (Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
74. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045164 (Yersinia pestis strain SCPM-O-B-6291 (C-25) plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
75. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045155 (Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
76. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045159 (Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
77. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006746 (Yersinia pestis 8787 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
78. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_003134 (Yersinia pestis CO92 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
79. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045150 (Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
80. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006790 (Yersinia pestis 2944 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
81. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006749 (Yersinia pestis 3770 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
82. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP032183 (Citrobacter freundii strain AR_0116 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
83. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006756 (Yersinia pestis 1522 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
84. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_032102 (Enterobacter cloacae strain G6809 plasmid pG6809-1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
85. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to MN178640 (Kluyvera cryocrescens strain SCW13 plasmid pSCW13-2, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
86. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_017155 (Yersinia pestis D106004 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
87. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_017158 (Yersinia pestis D182038 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
88. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_004835 (Yersinia pestis strain KIM5 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
89. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_004838 (Yersinia pestis KIM10+ plasmid pMT-1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
90. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
91. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP033692 (Yersinia pestis strain FDAARGOS_603 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
92. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP033693 (Yersinia pestis strain FDAARGOS_603 plasmid unnamed4) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
93. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006760 (Yersinia pestis 1413 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
94. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP048417 (Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
95. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP021897 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
96. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP011655 (Citrobacter freundii strain CAV1741 plasmid pCAV1741-110, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
97. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006779 (Yersinia pestis 1412 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
98. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP006752 (Yersinia pestis 3067 plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
99. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP027605 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
100. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_AP019819 (Enterobacter hormaechei subsp. hoffmannii strain OIPH-N069 plasmid pN069_2, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
101. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP019891 (Enterobacter hormaechei strain FRM plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
102. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_008118 (Yersinia pestis Nepal516 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
103. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP044336 (Enterobacter hormaechei strain AKB48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
104. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP040567 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 plasmid pCFSAN059543, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
105. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP016275 (Yersinia pestis strain Cadman plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
106. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP019709 (Yersinia pestis strain 195/P plasmid pMT1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
107. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_AP018351 (Enterobacter hormaechei strain TUM10695 plasmid pMTY10695_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
108. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009904 (Yersinia pestis Antiqua plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
109. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009841 (Yersinia pestis A1122 plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
110. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009989 (Yersinia pestis strain Nicholisk 41 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
111. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009934 (Yersinia pestis Angola plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
112. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP014995 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
113. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP010021 (Yersinia pestis str. Pestoides B plasmid pMT, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
114. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP031722 (Enterobacter hormaechei strain WCHEH020038 plasmid p1_020038, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
115. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP017724 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_01, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
116. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP053193 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
117. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_018843 (Salmonella phage SSU5, complete genome) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc---- CRISPR spacer
tgacccggcgcgtgctcgccagct----tctcgaag Protospacer
**.*********.*********** .***
118. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_015378 (Burkholderia gladioli BSR3 plasmid bgla_3p, complete sequence) position: , mismatch: 7, identity: 0.781
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
cggtcagttgcgcgctggcaagctccggcctc Protospacer
.**.* * .******* ** ************
119. spacer 8.3|2920239|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781
gatgcggtttcgatcccgtggcggggcatcgc CRISPR spacer
gttgcggtttcgatcgcgtggccggacgcctc Protospacer
* ************* ****** **.*..* *
120. spacer 8.3|2920239|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781
gatgcggtttcgatcccgtggcggggcatcgc CRISPR spacer
gttgcggtttcgatcgcgtggccggacgcctc Protospacer
* ************* ****** **.*..* *
121. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
122. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_014304 (Erwinia billingiae Eb661 plasmid pEB102, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
123. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP022726 (Erwinia persicina strain B64 plasmid pEP1, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
124. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP020945 (Pantoea ananatis strain PNA 97-1R plasmid unamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
125. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP034473 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_4, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
126. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP034478 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_4, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
127. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP049117 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
128. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_019310 (Erwinia amylovora plasmid pEM65, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
129. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP022431 (Pantoea ananatis strain YJ76 plasmid p_unamed2) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgctgccctgacgcacggcctcgcgcagcgtg Protospacer
*****.**.**************** **
130. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
cgggatcccgacgtacagcctcgcggccgagc Protospacer
** .********.**.*********** .**
131. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
ggctcaattatcgccctggatgtcaagggcga Protospacer
** *. * ****** ***************
132. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
atccgcccggcgaacaggacgaagccgtggat Protospacer
*. .***************** ****** * .
133. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
ccgcccgcagcgaacaggcagcagccgtcgcc Protospacer
**. * *.********* ************
134. spacer 9.7|2934392|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ggcacctggcaggccacgctgaccgacttccc CRISPR spacer
ctcgccggccaggccacgctgaccgacttgcg Protospacer
*.** * ******************** *
135. spacer 9.7|2934392|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 7, identity: 0.781
---ggcacctggcaggccacgctgaccgacttccc CRISPR spacer
tccgacac---gcaggccgcgctgaccgactgccg Protospacer
*.*** *******.************ **
136. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.781
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
agaaggcgcgataatcgcgcgcccgcgccgca Protospacer
* * * **** ********** ********
137. spacer 12.4|5014429|34|CP031194|CRT,CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.794
gggggacgtc----tgcgccagctcgatgcggcggacg CRISPR spacer
----gtcgtcgatgtgcgtcagctcgatgcggccgacg Protospacer
* **** ****.************** ****
138. spacer 12.6|5014370|32|CP031194|PILER-CR matches to MN304818 (Phage 71_18, complete genome) position: , mismatch: 7, identity: 0.781
ggagacgaacgcggcgccctgttcggcgtgca- CRISPR spacer
ggtgacgaacgccgcgccctgttc-ccgctcgt Protospacer
** ********* *********** **. *.
139. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 7, identity: 0.781
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gcgggctaccgcagcgccctgttcggcatgca Protospacer
* .*.* * ***.**************.****
140. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.781
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
141. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 7, identity: 0.781
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
142. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 7, identity: 0.781
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
143. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
----gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cctcggg----cagcgcgagcgcgatgcggcggacg Protospacer
*** * **** *** **************
144. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 7, identity: 0.781
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
gtgcaggctgtgccatctcgatgcggcggagg Protospacer
* * * ***.**** ************** *
145. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
agcctcgctgccctgaccgccgtactcc-acgt CRISPR spacer
gtgctcgccggcctgaccgccgtactcctgcg- Protospacer
. *****.* ***************** .**
146. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_LR594676 (Variovorax sp. PBS-H4 plasmid 2) position: , mismatch: 7, identity: 0.774
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
cgagactcgtcttccccacaccgcccttgcc Protospacer
* * **********************..
147. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP029178 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
cagtggtcgtcttccccaccccgcccttgta Protospacer
* .. * ************ **********
148. spacer 13.3|5015258|31|CP031194|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 7, identity: 0.774
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ccgtcgacgtcttaccgacaccgcccttccc Protospacer
**..********* ** *********** ..
149. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 7, identity: 0.774
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
aaccagtcgtcttacctacaccgcccttgtt Protospacer
* * ****** **.**************
150. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.774
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
cgagtgtcgtcttcccaaccccgcccttgtc Protospacer
* * .* ********* ** **********.
151. spacer 6.3|2896051|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 8, identity: 0.758
cagcccggccgcgatcctggcccgccttcagcg CRISPR spacer
gctcccggccgggatcctgccccgccttgcgcc Protospacer
******** ******* ******** **
152. spacer 6.3|2896051|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.758
cagcccggccgcgatcctggcccgccttcagcg CRISPR spacer
cagcccggccgcgacccgggcccgggtgccgaa Protospacer
**************.** ****** * * * .
153. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gcccgcgccgcccgccgcccccgccgcgcgcac Protospacer
**** *************.******. ** ..
154. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
ccccactccgcccgccgctcccgccatgaccag Protospacer
*** * ******************* * * .
155. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to MK937595 (Streptomyces phage Dubu, complete genome) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccccaggcgcccgccgctcccgccccgctccc Protospacer
***** * ***************** **. .
156. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccgccgccgcccgccgcacccgcgcagaagcc Protospacer
*** ************** ***** ** * .
157. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccgccgccgcccgccgcttccgcgtcatcgga Protospacer
*** ***************.**** ..***
158. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cgccccgccgccccccgatcccgccaccgcgct Protospacer
*********** *** ******** ** *
159. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccgccgccgcccgccgcacccgcgcagaagcc Protospacer
*** ************** ***** ** * .
160. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccgccgccgcccgccgcacccgcgcagaagcc Protospacer
*** ************** ***** ** * .
161. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cgccccgccgccccccgatcccgccaccgcgct Protospacer
*********** *** ******** ** *
162. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cgccccgccgccccccgatcccgccaccgcgct Protospacer
*********** *** ******** ** *
163. spacer 6.10|2896484|33|CP031194|PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.758
ggacgtga-agccggcgccgtggagctgcgccgt CRISPR spacer
-accatggccgccggcgcgatggagctgcgccgt Protospacer
. *.**. ******** .**************
164. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
caggtcgcgatcacgagcgggacgtggcgctt CRISPR spacer
aattcctcgatcacgagctggacgaggcgctg Protospacer
* .* *********** ***** ******
165. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
--caggtcgcgatcacgagcgggacgtggcgctt CRISPR spacer
gccag--cgcgaacgcgagcgggacgtggcctgc Protospacer
*** ***** *.*************** . .
166. spacer 6.12|2896477|33|CP031194|CRISPRCasFinder,CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.758
ggacgtga-agccggcgccgtggagctgcgccgt CRISPR spacer
-accatggccgccggcgcgatggagctgcgccgt Protospacer
. *.**. ******** .**************
167. spacer 7.4|2899296|35|CP031194|PILER-CR,CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 8, identity: 0.771
gtagtccttcgaccactcctcgttgtaggacgggt CRISPR spacer
gggggcgtcggacccctcctcgttgtaggccgggt Protospacer
* .* * *. **** ************** *****
168. spacer 7.4|2899296|35|CP031194|PILER-CR,CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 8, identity: 0.771
gtagtccttcgaccactcctcgttgtaggacgggt CRISPR spacer
gggggcgtcggacccctcctcgttgtaggccgggt Protospacer
* .* * *. **** ************** *****
169. spacer 7.4|2899296|35|CP031194|PILER-CR,CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 8, identity: 0.771
gtagtccttcgaccactcctcgttgtaggacgggt CRISPR spacer
gggggcgtcggacccctcctcgttgtaggccgggt Protospacer
* .* * *. **** ************** *****
170. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to AB916497 (Ralstonia phage RS138 DNA, complete genome) position: , mismatch: 8, identity: 0.771
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgct Protospacer
**************.********.** *. *. *
171. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgct Protospacer
**************.********.** *. *. *
172. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgct Protospacer
**************.********.** *. *. *
173. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgct Protospacer
**************.********.** *. *. *
174. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgct Protospacer
**************.********.** *. *. *
175. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttctccggcgggcgctcgccagctccgggtag Protospacer
* .****** ***************** .
176. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
177. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP042167 (Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
178. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP028810 (Burkholderia contaminans strain SK875 plasmid p875, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
179. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP046610 (Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
180. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
181. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttcccctgcgggcgctcgccagctccgggtag Protospacer
* *** *** ***************** .
182. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
caagccagcgcgcgatcgccagctccggtttc Protospacer
... **.******* *************..**
183. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttgcagttggcgcgctcgccagcgccggtctc Protospacer
* ** ************** ****.***
184. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP051678 (Spirosoma sp. CJU-R4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
tggcccagcgcgcgctcggcagcccactgctg Protospacer
******.*********** ****.* **
185. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ccgccgccggcgcgatcgccggctccggcctc Protospacer
. *** ***** *****.***********
186. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ccgccgccggcgcgatcgccggctccggcctc Protospacer
. *** ***** *****.***********
187. spacer 8.3|2920239|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
gatgcggtttcgatcccgtggcggggcatcgc CRISPR spacer
gttgcggtttcgatcgcgtggccggacgcttc Protospacer
* ************* ****** **.*... *
188. spacer 8.6|2920422|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MK660714 (Arthrobacter phage MrGloopy, complete genome) position: , mismatch: 8, identity: 0.75
accgccgaccacttccgcatgaaagtcgccgt CRISPR spacer
gccgccgaccacttcctcatggaagaggtaga Protospacer
.*************** ****.*** *. *
189. spacer 8.6|2920422|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MG198781 (Arthrobacter phage Fluke, complete genome) position: , mismatch: 8, identity: 0.75
accgccgaccacttccgcatgaaagtcgccgt CRISPR spacer
gccgccgaccacttcctcatggaagaggtaga Protospacer
.*************** ****.*** *. *
190. spacer 8.6|2920422|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MK112528 (Arthrobacter phage Beethoven, complete genome) position: , mismatch: 8, identity: 0.75
accgccgaccacttccgcatgaaagtcgccgt CRISPR spacer
gccgccgaccacttcctcatggaagaggtaga Protospacer
.*************** ****.*** *. *
191. spacer 8.6|2920422|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 8, identity: 0.75
accgccgaccacttccgcatgaaagtcgccgt CRISPR spacer
ctcaacgaccacttccgcatgaacgccggggt Protospacer
.*. ****************** *.** **
192. spacer 8.7|2920483|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015523 (Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gaaaccccgctgccctgggcgcccgccacggt CRISPR spacer
gatggtgccctgccctgggcggccgacacggt Protospacer
** . . * ************ *** ******
193. spacer 8.7|2920483|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gaaaccccgctgccctgggcgcccgc---cacggt CRISPR spacer
ttcaccccgccgacctgggcgcccgcacgcac--- Protospacer
*******.* ************* ***
194. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
aaattaggtacccgtcatcgtgctgcactagg Protospacer
*.. .**********.*********** **
195. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
gacacgctgatcggcggggatggcaacgacac Protospacer
.*********** ******** *** *.*.
196. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
gacacgctgatcggcggggatggcaacgacac Protospacer
.*********** ******** *** *.*.
197. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
gacacgctgatcggcggggatggcaacgacac Protospacer
.*********** ******** *** *.*.
198. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
ctgctgatcatcgccgaggatgtcgagggcga Protospacer
* .* * *******.*******.*******
199. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
ctgctgattatcgccgaggatgtcgagggcga Protospacer
* .* * *******.*******.*******
200. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
ctgctgattatcgccgaggatgtcgagggcga Protospacer
* .* * *******.*******.*******
201. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 8, identity: 0.75
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
tggatcccggcgaacagcacgcggccgtcggg Protospacer
* ************ ****.*******
202. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
atctcggaggcgaacaggacgctgccgtagcc Protospacer
*. * ************** ***** ***
203. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014516 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
tcatcgccggcgaacaggaccccgccgtctct Protospacer
*.* ************** * ****** *.
204. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
acgtgcccggcgaacaggacgcagccgtcgcc-- CRISPR spacer
ccctggccggcgagcaggacgcagcc--catcag Protospacer
* ** *******.************ *..*
205. spacer 9.5|2934270|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to KY092484 (Streptomyces phage Raleigh, complete genome) position: , mismatch: 8, identity: 0.75
tcggtccac-ccgtcgagccagcggcgggcgag CRISPR spacer
-caaccggcgccgtcgaggcggcggcgggcgag Protospacer
*...* .* ******** *.************
206. spacer 9.7|2934392|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcacctggcaggccacgctgaccgacttccc CRISPR spacer
ggcacctggctggccacgctggccggcacgtg Protospacer
********** **********.***.* . .
207. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
agatcacccgatcatagcgcgccagcgccgcc Protospacer
* . *.******* ***************
208. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009155 (Burkholderia pseudomallei strain TSV202 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
gtccgcctcgatcttcgcgagccaggggcctt Protospacer
.************ ***** ***** * * .
209. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
gtccgcctcgatcttcgcgagccaggggcttt Protospacer
.************ ***** ***** * * .
210. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MN175603 (Microbacterium phage Tyrumbra, complete genome) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
ctgcgtctcgatgatcgcgcgccagcggttcg Protospacer
* **.****** ************** . *.
211. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MH271312 (Microbacterium phage RobsFeet, complete genome) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
ctgcgtctcgatgatcgcgcgccagcggttcg Protospacer
* **.****** ************** . *.
212. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MK524510 (Microbacterium phage Fireman, complete genome) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
ctgcgtctcgatgatcgcgcgccagcggttcg Protospacer
* **.****** ************** . *.
213. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
ctgcgtctcgatgatcgcgcgccagcggttcg Protospacer
* **.****** ************** . *.
214. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010714 (Phaeobacter inhibens strain P66 plasmid pP66_i, complete sequence) position: , mismatch: 8, identity: 0.75
atccgcctcgatcatcgcgcgccagcgccgca- CRISPR spacer
atcagcctcgatcatcccgcgcccg-atcacgg Protospacer
*** ************ ****** * ..*.*.
215. spacer 12.2|5014307|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 8, identity: 0.765
agctcg---cgttccaccgtcacgccatcgcgctggc CRISPR spacer
---tcgatctgcaccaccggcacgccgtcgcgctggc Protospacer
*** .*. ****** ******.**********
216. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 8, identity: 0.75
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
caggacgaccgccgcgccctgttcggcaaaca Protospacer
..***** *** **************. .**
217. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
caggacgaccgccgcgccctgttcggcaaaca Protospacer
..***** *** **************. .**
218. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
caggacgaccgccgcgccctgttcggcaaaca Protospacer
..***** *** **************. .**
219. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
ggagacgaacgcggcgccctgttcggcgtgca- CRISPR spacer
ccactcgagcgcggcgcgctgttcggcg-gcgt Protospacer
* ***.******** ********** **.
220. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.75
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gtgttcggccgcggcgtcctgttcggcgcgca Protospacer
* . **. *******.***********.***
221. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP046254 (Sphingobium sp. CAP-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtc-----tgcgccagctcgatgcggcggacg CRISPR spacer
-----gtcagcggtgcgccagatcgaggcggcggacc Protospacer
*** ******** **** *********
222. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtc-----tgcgccagctcgatgcggcggacg CRISPR spacer
-----gtcagcggtgcgccagatcgaggcggcggacc Protospacer
*** ******** **** *********
223. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP010683 (Phaeobacter piscinae strain P14 plasmid pP14_b, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
gcaaaccctgcgcccgctcgatgaggcggaag Protospacer
* .* .******* ******** ****** *
224. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP010718 (Phaeobacter piscinae strain P18 plasmid pP18_c, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
gcaaaccctgcgcccgctcgatgaggcggaag Protospacer
* .* .******* ******** ****** *
225. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
ggcgcgcctgcgccagctcaatgcggcccccc Protospacer
** .**.************.******* *
226. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 8, identity: 0.75
gggacgtc-----tgcgccagctcgatgcggcggacg CRISPR spacer
-----gtcagcggtgcgccagatcgaggcggcggacc Protospacer
*** ******** **** *********
227. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
cgcctcgccgccctgaccgccgtcctggcggc Protospacer
*******.************** ** *.
228. spacer 12.8|5014492|32|CP031194|PILER-CR matches to KT803877 (Burkholderia phage PE067, complete genome) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
ttcctcgctgccctggccgccgaactcgatcc Protospacer
*************.****** **** *. .
229. spacer 12.8|5014492|32|CP031194|PILER-CR matches to MH809532 (Burkholderia phage phiE131, complete genome) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
ttcctcgctgccctggccgccgaactcgatcc Protospacer
*************.****** **** *. .
230. spacer 12.8|5014492|32|CP031194|PILER-CR matches to MH809533 (Burkholderia phage phiE058, complete genome) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
ttcctcgctgccctggccgccgaactcgatcc Protospacer
*************.****** **** *. .
231. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
ttcctcgctgccctgatcgccgcaccgctcgc Protospacer
**************.*****.**. * **.
232. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NC_004444 (Pseudomonas resinovorans plasmid pCAR1, complete sequence) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
agcctcgccgccctggccgccgtcgcccccca Protospacer
********.******.******* .** *
233. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NC_021506 (Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
agcctcgccgccctggccgccgtcgcccccca Protospacer
********.******.******* .** *
234. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NC_011838 (Pseudomonas putida plasmid pCAR1.2, complete sequence) position: , mismatch: 8, identity: 0.75
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
agcctcgccgccctggccgccgtcgcccccca Protospacer
********.******.******* .** *
235. spacer 13.1|5015136|32|CP031194|CRT matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 8, identity: 0.75
tgattgatcgcgcgcttggccccgagaccggc CRISPR spacer
cgaagggcggcgcgcttgtcgccgagaccggc Protospacer
.** *.. ********* * ***********
236. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
aggtcgacgtcttgcccacgccgcccttgaa Protospacer
..********* *****.*********
237. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP045330 (Labrenzia sp. THAF191b plasmid pTHAF191b_b, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgagcgacgtctttcccaccccgccctttcc Protospacer
. * *********.***** ******** ..
238. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
239. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP045346 (Labrenzia sp. THAF187b plasmid pTHAF187b_b, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgagcgacgtctttcccaccccgccctttcc Protospacer
. * *********.***** ******** ..
240. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP045334 (Labrenzia sp. THAF191a plasmid pTHAF191a_a, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgagcgacgtctttcccaccccgccctttcc Protospacer
. * *********.***** ******** ..
241. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgagcgacgtctttcccaccccgccctttcc Protospacer
. * *********.***** ******** ..
242. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgaaggccgtcttgcccacaccgcccttgcg Protospacer
. * * ****** ***************.
243. spacer 13.3|5015258|31|CP031194|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
244. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
245. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP011045 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI2, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
246. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
247. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP021036 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI2, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
248. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tgatggaggtcttccccacgccgcccttgcg Protospacer
. *. ** ***********.*********.
249. spacer 13.3|5015258|31|CP031194|CRT matches to NC_009479 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgtcgacgtcttcccgacgccgcccttcaa Protospacer
.*..************ **.********
250. spacer 13.3|5015258|31|CP031194|CRT matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tggcgaacgtcttgcccacgccgcccttgat Protospacer
. .* .******* *****.********* *
251. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
aggcggcggtctttccgacaccgcccttgtt Protospacer
.* * *****.** **************
252. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP034188 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
cgctggtcgtcttcccgaccccgcccttgtc Protospacer
* . * ********* ** **********.
253. spacer 13.5|5015379|32|CP031194|CRT,PILER-CR matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
tgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
254. spacer 13.5|5015379|32|CP031194|CRT,PILER-CR matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
tgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
255. spacer 13.6|5015440|32|CP031194|CRT,PILER-CR matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
tgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
256. spacer 13.6|5015440|32|CP031194|CRT,PILER-CR matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
tgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
257. spacer 13.7|5015501|32|CP031194|CRT,PILER-CR matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 8, identity: 0.75
ctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
cggacggtgatgaatccgttccacgtcgtgca Protospacer
* ******************. **** *..
258. spacer 13.7|5015501|32|CP031194|CRT,PILER-CR matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
ctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
cggacggtgatgaatccgttccacgtcgtgca Protospacer
* ******************. **** *..
259. spacer 13.9|5015195|34|CP031194|CRISPRCasFinder matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 8, identity: 0.765
agtatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-ccacgcccacggctgttgcacggtcaggcatttc Protospacer
.*.** *. *******.*** ************
260. spacer 13.9|5015195|34|CP031194|CRISPRCasFinder matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 8, identity: 0.765
agtatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-ccacgcccacggctgttgcacggtcaggcatttc Protospacer
.*.** *. *******.*** ************
261. spacer 13.9|5015195|34|CP031194|CRISPRCasFinder matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 8, identity: 0.765
agtatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-ccacgcccacggctgttgcacggtcaggcatttc Protospacer
.*.** *. *******.*** ************
262. spacer 13.9|5015195|34|CP031194|CRISPRCasFinder matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 8, identity: 0.765
agtatgcgcg-ggctgttacaccgtcaggcatttc CRISPR spacer
-ccacgcccacggctgttgcacggtcaggcatttc Protospacer
.*.** *. *******.*** ************
263. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
264. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
265. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
266. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP011045 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI2, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
267. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
268. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
agaaccagtcgtcttacctacaccgcccttgtt Protospacer
.* * * ****** **.**************
269. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP021036 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI2, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
270. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtgatggaggtcttccccacgccgcccttgcg Protospacer
**. *. ** ***********.*********.
271. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NC_009479 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.758
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
ggtcgtcgacgtcttcccgacgccgcccttcaa Protospacer
**.*..************ **.********
272. spacer 13.12|5015377|34|CP031194|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.765
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
gaaacgcgaaggcagcggcgtgatgggcacggtg Protospacer
.. **** ***** *************** * *
273. spacer 13.12|5015377|34|CP031194|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.765
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
gaaacgcgaaggcagcggcgtgatgggcacggtg Protospacer
.. **** ***** *************** * *
274. spacer 13.13|5015438|34|CP031194|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.765
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
gaaacgcgaaggcagcggcgtgatgggcacggtg Protospacer
.. **** ***** *************** * *
275. spacer 13.13|5015438|34|CP031194|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.765
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
gaaacgcgaaggcagcggcgtgatgggcacggtg Protospacer
.. **** ***** *************** * *
276. spacer 6.3|2896051|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
cagcccggccgcgatcctggcccgccttcagcg CRISPR spacer
cagcccggccacgatcccggcccgcgcctggtc Protospacer
**********.******.******* ....*.
277. spacer 6.3|2896051|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 9, identity: 0.727
cagcccggccgcgatcctggcccgccttcagcg CRISPR spacer
tctcccggccgggatcctgccccgcctcgcgcc Protospacer
. ******** ******* *******. **
278. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
ccccccaccgcccgccgcacccgcctgcgccgc Protospacer
*****.*********** ****** . * *.
279. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
tcccccgccgccctccgctccggcccactctcc Protospacer
************ ******* *** * .* .
280. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
tcccccgccgccctccgctccggccccgtccag Protospacer
************ ******* *** *.* .
281. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gccgccgccgccggccgctcccgcggtcgccgc Protospacer
*** ******** *********** . * *.
282. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
tcccccgccgccctccgctccggccccgtccac Protospacer
************ ******* *** *.* ..
283. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
tcccccgccgccctccgctccggccccgtccac Protospacer
************ ******* *** *.* ..
284. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gcccccgccgcccgccgatccggcgcgcaaggg Protospacer
***************** *** ** . **
285. spacer 6.6|2896234|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to MK291441 (Paracoccus phage vB_PbeS_Pben1, complete genome) position: , mismatch: 9, identity: 0.727
gtcgtcggcggccgttgttccggtggcggccgt CRISPR spacer
gatgtcggcagccgttgtgccggtggccagaat Protospacer
* .******.******** ******** . .*
286. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
caggtcgcgatcacgagcgggacgtggcgctt CRISPR spacer
gattgcgcgatcacgcgcgggacctggcggcg Protospacer
* ********** ******* ***** .
287. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
caggtcgcgatcacgagcgggacgtggcgctt CRISPR spacer
caggtcgcgttcacgagcggcacccacaggtc Protospacer
********* ********** ** .. * *.
288. spacer 6.11|2896417|32|CP031194|CRISPRCasFinder,CRT matches to MN304821 (Phage 66_12, partial genome) position: , mismatch: 9, identity: 0.719
caggtcgcgatcacgagcgggacgtggcgctt CRISPR spacer
caggccgcgaccacgagcgggaccagcccgag Protospacer
****.*****.************ * *
289. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.743
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
cgcctcgtccggcgcggtctgcccgagtgctgcgg Protospacer
*** *** ****************** . *. *
290. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgctgg Protospacer
**************.********.** *. *. **
291. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgctgg Protospacer
**************.********.** *. *. **
292. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgctgg Protospacer
**************.********.** *. *. **
293. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgctgg Protospacer
**************.********.** *. *. **
294. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to AB916497 (Ralstonia phage RS138 DNA, complete genome) position: , mismatch: 9, identity: 0.757
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcgtcggccggcgtggtctgcctgaaccagcgctgg Protospacer
**************.********.** *. *. **
295. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ccctccggcgggcgctcgccagctccgggtag Protospacer
. .****** ***************** .
296. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttctcccgcgggcgctcgccagctccgggtag Protospacer
* .** *** ***************** .
297. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
ttctcccgcgggcgctcgccagctccgggtag Protospacer
* .** *** ***************** .
298. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
299. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP009433 (Burkholderia glumae LMG 2196 = ATCC 33617 plasmid pBIN_1, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
300. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
301. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NC_012720 (Burkholderia glumae BGR1 plasmid bglu_3p, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
302. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP035902 (Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
303. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045091 (Burkholderia glumae strain GX plasmid pWSGX3, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
304. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP052865 (Burkholderia glumae strain HN1 plasmid pBGHN1-1, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
305. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP047317 (Burkholderia glumae AU6208 plasmid pwszb, complete sequence) position: , mismatch: 9, identity: 0.719
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
gtcgcaggcgggcgctcgccagcaccggcgcc Protospacer
* **** ************ ***** .*
306. spacer 8.3|2920239|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719
gatgcggtttcgatcccgtggcggggcatcgc CRISPR spacer
ggcaactcttcgatccggcggcggggcatcgc Protospacer
*... .******** *.*************
307. spacer 8.6|2920422|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719
accgccgaccacttccgcatgaaagtcgccgt CRISPR spacer
ctggccgaccagttccgcatgaacgtggtagc Protospacer
. ******** *********** ** *. *.
308. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
309. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
310. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
311. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
312. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
313. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
314. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
315. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
316. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
317. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
318. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
319. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
320. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
321. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
322. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
323. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
324. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
325. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
326. spacer 8.8|2920544|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgtcttcctgaccgcatgggacaagtccag CRISPR spacer
atcgtcttcatgaccgcatggaacaactatct Protospacer
. ******* ***********.**** * .
327. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
acacggtgtgcccgtcgtcgtgctgcacggcg Protospacer
.*** **.******************..
328. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MT889378 (Gordonia phage Burnsey, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
329. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_015720 (Gordonia phage GTE2, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
330. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MK279900 (Gordonia phage Nina, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
331. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to HQ403646 (Gordonia phage GTE2, complete sequence) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
332. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MN444871 (Gordonia phage Axym, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
333. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to KF879862 (UNVERIFIED: Nocardia phage NOC2, partial genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
334. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MK875795 (Gordonia phage Agatha, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
335. spacer 8.9|2920605|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to MN444878 (Gordonia phage Quasar, complete genome) position: , mismatch: 9, identity: 0.719
cagcggggtacccgtcgtcgtgctgcacaagt CRISPR spacer
ctgcggggtacccgtcttcttgctgttgccgg Protospacer
* ************** ** *****. *
336. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
ccacgaaccggcgcaccgcctcgcggcccgcg Protospacer
* .* ***.***** *************
337. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 9, identity: 0.719
cgctgtcccgac-------gcacggcctcgcggcccggc CRISPR spacer
-------ccgacggccgcagcacggcctcgcggcccgag Protospacer
***** ******************.
338. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 9, identity: 0.719
cgctgtcccgac-------gcacggcctcgcggcccggc CRISPR spacer
-------ccgacggccgcagcacggcctcgcggcccgag Protospacer
***** ******************.
339. spacer 9.2|2934087|32|CP031194|CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 9, identity: 0.719
cgcacgctgatcgccggggatgtcaagggcga CRISPR spacer
tccacgctgatcgccgatgatgtcatcgacac Protospacer
. **************. ******* *.*.
340. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 9, identity: 0.719
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
ccccgcccggcgaactggacgccgccgtgctg Protospacer
* .*********** ****** ***** .
341. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
agctgcccggcgaacagggcgccgccctgatt Protospacer
* ***************.*** *** * ...
342. spacer 9.4|2934209|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
acccaccagccgacctgccggcccacaaagta CRISPR spacer
gcaccaaagccgccctgcaggcccacaaaggc Protospacer
.* * ***** ***** ***********
343. spacer 9.4|2934209|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
acccaccagccgacctgccggcccacaaagta CRISPR spacer
gcaccaaagccgccctgcaggcccacaaaggc Protospacer
.* * ***** ***** ***********
344. spacer 9.5|2934270|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtccacccgtcgagccagcggcgggcgag CRISPR spacer
ccggtccggccgtcgagccagcggtcgggatc Protospacer
.******. ***************. ** .
345. spacer 9.5|2934270|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtccacccgtcgagccagcggcgggcgag CRISPR spacer
gttgccgcccagtcgagccagcggcggccgac Protospacer
. *.* ** **************** ***
346. spacer 9.7|2934392|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032625 (Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcacctggcaggccacgctgaccgacttccc CRISPR spacer
agcacctggcaggccacgccggcccgcgctcg Protospacer
.******************.*.** .* ..*
347. spacer 9.7|2934392|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035709 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt12, complete sequence) position: , mismatch: 9, identity: 0.719
ggcacctggcaggccacgctgaccgacttccc CRISPR spacer
gagcgcacgcaggccacgctgaccgcctaccg Protospacer
*. * ***************** ** **
348. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
caaggcctcgatcatcgctcgcgagcgttgct Protospacer
************** *** ****..**
349. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
cggtggcgagatcgccgcgcgccagcgccgca Protospacer
.* * ****..*****************
350. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
caaggcctcgatcatcgctcgcgagcgttgct Protospacer
************** *** ****..**
351. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
cgtgggcgggatcatggcgcgcgagcgccgca Protospacer
. * * ****** ****** *********
352. spacer 12.1|5014246|34|CP031194|CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 9, identity: 0.735
aggcgagcagccgctctcagaccgg-----ccatttacg CRISPR spacer
tgccgcgcagccgctctccgaccggccggaccat----- Protospacer
* ** ************ ****** ****
353. spacer 12.3|5014368|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
ggggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gccaggacgaccgccgcgccctgttcggcaaaca Protospacer
* ..***** *** **************. .**
354. spacer 12.3|5014368|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.735
ggggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gccaggacgaccgccgcgccctgttcggcaaaca Protospacer
* ..***** *** **************. .**
355. spacer 12.3|5014368|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gccaggacgaccgccgcgccctgttcggcaaaca Protospacer
* ..***** *** **************. .**
356. spacer 12.3|5014368|34|CP031194|CRT,CRISPRCasFinder matches to MN304818 (Phage 71_18, complete genome) position: , mismatch: 9, identity: 0.735
ggggagacgaacgcggcgccctgttcggcgtgca- CRISPR spacer
ccggtgacgaacgccgcgccctgttc-ccgctcgt Protospacer
** ********* *********** **. *.
357. spacer 12.4|5014429|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 9, identity: 0.735
gggggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cccggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
358. spacer 12.4|5014429|34|CP031194|CRT,CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 9, identity: 0.735
gggggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cccggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
359. spacer 12.4|5014429|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 9, identity: 0.735
gggggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cccggacatctgcgccaactcgatgcgagccacg Protospacer
****.*********.*********. ***
360. spacer 12.5|5014490|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735
ggagcctcgctgccctgaccgccgtactcc-acgt CRISPR spacer
tcgtgctcgccggcctgaccgccgtactcctgcg- Protospacer
. *****.* ***************** .**
361. spacer 12.5|5014490|34|CP031194|CRT,CRISPRCasFinder matches to KT803877 (Burkholderia phage PE067, complete genome) position: , mismatch: 9, identity: 0.735
ggagcctcgctgccctgaccgccgtactccacgt CRISPR spacer
gattcctcgctgccctggccgccgaactcgatcc Protospacer
*. *************.****** **** *. .
362. spacer 12.5|5014490|34|CP031194|CRT,CRISPRCasFinder matches to MH809532 (Burkholderia phage phiE131, complete genome) position: , mismatch: 9, identity: 0.735
ggagcctcgctgccctgaccgccgtactccacgt CRISPR spacer
gattcctcgctgccctggccgccgaactcgatcc Protospacer
*. *************.****** **** *. .
363. spacer 12.5|5014490|34|CP031194|CRT,CRISPRCasFinder matches to MH809533 (Burkholderia phage phiE058, complete genome) position: , mismatch: 9, identity: 0.735
ggagcctcgctgccctgaccgccgtactccacgt CRISPR spacer
gattcctcgctgccctggccgccgaactcgatcc Protospacer
*. *************.****** **** *. .
364. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
atcgacgatcgcgccgccctgttcggagagac Protospacer
. ***** **** ************ * *
365. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
gcaggggctgggccagttcgatgcggcggagc Protospacer
* .. * *** *****.*************
366. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
367. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
368. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
acagcgtcagcgccagctcggtgcggccgctg Protospacer
. ..**** ***********.****** * .*
369. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
370. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
acagcgtcagcgccagctcggtgcggccgctg Protospacer
. ..**** ***********.****** * .*
371. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtct------gcgccagctcgatgcggcggacg CRISPR spacer
------cctcgatgagcgcctgctcgatccggcggacg Protospacer
.** ***** ******* *********
372. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
373. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
374. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
375. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
376. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
377. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
378. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
379. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
380. spacer 12.7|5014431|32|CP031194|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
381. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
382. spacer 12.7|5014431|32|CP031194|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
agcctatgcgcgcaagctcgatgcggcgggcg Protospacer
.* ..* .**** ***************.**
383. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.719
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
acagcgtcagcgccagctcggtgcggccggag Protospacer
. ..**** ***********.****** *. *
384. spacer 13.3|5015258|31|CP031194|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 9, identity: 0.71
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tggtggtggtcttcccgaccccgcccttgtt Protospacer
. .. * ******** ** ***********
385. spacer 13.3|5015258|31|CP031194|CRT matches to NZ_CP033726 (Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence) position: , mismatch: 9, identity: 0.71
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tcgttgacgtcttcccgacgccgcccttcaa Protospacer
.*...*********** **.********
386. spacer 13.3|5015258|31|CP031194|CRT matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 9, identity: 0.71
ccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
tggtggtggtcttcccgaccccgcccttgtt Protospacer
. .. * ******** ** ***********
387. spacer 13.7|5015501|32|CP031194|CRT,PILER-CR matches to NZ_CP037433 (Lactobacillus plantarum strain EM plasmid pEM4, complete sequence) position: , mismatch: 9, identity: 0.719
ctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
tttacggtgatggatccgttattcgtgatttt Protospacer
.*.*********.******* ***** *
388. spacer 13.7|5015501|32|CP031194|CRT,PILER-CR matches to NZ_CP037433 (Lactobacillus plantarum strain EM plasmid pEM4, complete sequence) position: , mismatch: 9, identity: 0.719
ctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
tttacggtgatggatccgttattcgtgatttt Protospacer
.*.*********.******* ***** *
389. spacer 13.8|5015562|32|CP031194|CRT,PILER-CR matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacctgccggagggccttgatggccgttcc CRISPR spacer
ttgattcgccggcggaccttgatggccgtttg Protospacer
* .*...***** **.**************.
390. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP045330 (Labrenzia sp. THAF191b plasmid pTHAF191b_b, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gctgagcgacgtctttcccaccccgccctttcc Protospacer
* . * *********.***** ******** ..
391. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP045346 (Labrenzia sp. THAF187b plasmid pTHAF187b_b, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gctgagcgacgtctttcccaccccgccctttcc Protospacer
* . * *********.***** ******** ..
392. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP045334 (Labrenzia sp. THAF191a plasmid pTHAF191a_a, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gctgagcgacgtctttcccaccccgccctttcc Protospacer
* . * *********.***** ******** ..
393. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
gctgagcgacgtctttcccaccccgccctttcc Protospacer
* . * *********.***** ******** ..
394. spacer 6.2|2895990|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.697
cttcgtccggccgccgggcggcaacatcaaggg CRISPR spacer
tcatgtcccaccgccgggcggcaacatcattcc Protospacer
.. .**** .*******************
395. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 10, identity: 0.697
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
cccgccgccgcccgtcgctcccgccgcgggaag Protospacer
** **********.**********. * ..
396. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to CP021182 (Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence) position: , mismatch: 10, identity: 0.697
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gtgatcgccgccggccgcgcccgccaagcaaaa Protospacer
*. .******* ***** ********** ..
397. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053224 (Sphingobium sp. RSMS plasmid pRSMS1, complete sequence) position: , mismatch: 10, identity: 0.697
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gtgatcgccgccggccgcgcccgccaagcaaaa Protospacer
*. .******* ***** ********** ..
398. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 10, identity: 0.697
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gtgatcgccgccggccgcgcccgccaagcaaaa Protospacer
*. .******* ***** ********** ..
399. spacer 6.5|2896173|33|CP031194|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 10, identity: 0.697
gcccccgccgcccgccgctcccgccaagccggt CRISPR spacer
gtgatcgccgccggccgcgcccgccaagcaaaa Protospacer
*. .******* ***** ********** ..
400. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
401. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
402. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
403. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
404. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
405. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
406. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
407. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
408. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
409. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
410. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
411. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
412. spacer 7.2|2899174|35|CP031194|PILER-CR,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ccgccgcccgcagcgcctgcacgagcgcacctcgt CRISPR spacer
gggtcgccagcagcgcctgcacgaccgcatcgtcc Protospacer
*.**** *************** ****.* . .
413. spacer 7.7|2899479|35|CP031194|PILER-CR,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.714
cgcgtcggccggcgcggtctgcccgacctcccagt CRISPR spacer
ctgcacggccggctcgatctgcccgacctccagcc Protospacer
* ******** **.************** . .
414. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.73
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
cgcctcgtccggcgcggtctgcccgagtgctgcggcc Protospacer
*** *** ****************** . *. * *
415. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP045191 (Escherichia coli strain NT1F31 plasmid pNT1F31-113kb, complete sequence) position: , mismatch: 10, identity: 0.688
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
cggcccggcgcgtgctcgccagcttttagaag Protospacer
.***********.***********.. .
416. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 10, identity: 0.688
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
acatgctgcgcgcgctcggcagcttcggccag Protospacer
.. * *********** *****.*****
417. spacer 8.1|2920117|32|CP031194|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
tggcccggcgcgcgctcgccagctccggcctc CRISPR spacer
cggccctgcgcgcgctcgccaccttgcgtgga Protospacer
.***** ************** **. *.
418. spacer 8.3|2920239|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039693 (Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence) position: , mismatch: 10, identity: 0.688
gatgcggtttcgatcccgtggcggggcatcgc CRISPR spacer
ccaccggtttcgatcctgtggcgtggcaagcg Protospacer
************.****** ****
419. spacer 8.7|2920483|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
gaaaccccgctgccctgggcgcccgccacggt CRISPR spacer
acgctgccggtgccctgggcgcgcgccacgac Protospacer
. . . *** ************ *******..
420. spacer 8.7|2920483|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaaccccgctgccctgggcgcccgccacggt CRISPR spacer
ctgcgccccttgccctgggcgcccgccagcgc Protospacer
. *** .****************** *.
421. spacer 8.7|2920483|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gaaaccccgctgccctgggcgcccgccacggt CRISPR spacer
accaccacgctgccctgcgcgcccgcgcccag Protospacer
. *** ********** ******** * .
422. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 10, identity: 0.688
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
gcctggcccgacgcccggcctcgcgggtactg Protospacer
*** ******** *********** .
423. spacer 9.1|2934026|32|CP031194|CRISPRCasFinder,CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688
cgctgtcccgacgcacggcctcgcggcccggc CRISPR spacer
gcctggcccgacgcccggcctcgcgggtactg Protospacer
*** ******** *********** .
424. spacer 9.3|2934148|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 10, identity: 0.688
acgtgcccggcgaacaggacgcagccgtcgcc CRISPR spacer
gtcgacaatgcgaacaggacccatccgtcgcc Protospacer
.. .* *********** ** ********
425. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.688
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
catcgccacgaacatcgcgcgccagccatggt Protospacer
.**** *** ************** .*
426. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.688
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
catcgccacgaacatcgcgcgccagccatggt Protospacer
.**** *** ************** .*
427. spacer 9.8|2934453|32|CP031194|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 10, identity: 0.688
atccgcctcgatcatcgcgcgccagcgccgca CRISPR spacer
tcgtacgtcgatcctctcgcgccagcgccgac Protospacer
. ..* ****** ** *************
428. spacer 12.5|5014490|34|CP031194|CRT,CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggagcctcgctgccctgaccgccgtactccacgt CRISPR spacer
cccgcctcgccgccctgaccgccgtcctggcggc Protospacer
*******.************** ** *.
429. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 10, identity: 0.688
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
cagtccgaccgcggcgacctgttcggcgcggc Protospacer
.. *** ******* ***********.*
430. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 10, identity: 0.688
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
atcgtcgaatgcggcgtcctgttcggcggcgg Protospacer
. * ****.******.*********** .
431. spacer 12.6|5014370|32|CP031194|PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 10, identity: 0.688
ggagacgaacgcggcgccctgttcggcgtgca CRISPR spacer
gcgctcgatcgcggcgccctgttcgccgccgc Protospacer
* . *** **************** **.
432. spacer 12.7|5014431|32|CP031194|PILER-CR matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 10, identity: 0.688
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
cccacatctgggccagctcgatgcgggactgg Protospacer
**.**** *************** . *
433. spacer 12.7|5014431|32|CP031194|PILER-CR matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 10, identity: 0.688
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
tcatcacgcgcgccagctcggcgcggcggacg Protospacer
. *.. .***********..**********
434. spacer 12.7|5014431|32|CP031194|PILER-CR matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 10, identity: 0.688
gggacgtctgcgccagctcgatgcggcggacg CRISPR spacer
tcatcacgcgcgccagctcggcgcggcggacg Protospacer
. *.. .***********..**********
435. spacer 12.8|5014492|32|CP031194|PILER-CR matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
agcctcgctgccctgaccgccgtactccacgt CRISPR spacer
aatgcgaatgccctgactggcgtactccacgc Protospacer
*.. . . *********.* ***********.
436. spacer 13.10|5015256|33|CP031194|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 10, identity: 0.697
ggccaccgacgtcttccccacaccgcccttgtt CRISPR spacer
acaggtcgacgtcttgcccacgccgcccttgaa Protospacer
. ..********* *****.*********
437. spacer 13.12|5015377|34|CP031194|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 10, identity: 0.706
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
cctgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
438. spacer 13.12|5015377|34|CP031194|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 10, identity: 0.706
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
cctgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
439. spacer 13.13|5015438|34|CP031194|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 10, identity: 0.706
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
cctgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
440. spacer 13.13|5015438|34|CP031194|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 10, identity: 0.706
agcacgccaaggctgcggcgtgatgggcaagcag CRISPR spacer
cctgaggaaaggccgcgccgtgatgggcaagcac Protospacer
.. * *****.*** ***************
441. spacer 13.14|5015499|34|CP031194|CRISPRCasFinder matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 10, identity: 0.706
agctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
cccggacggtgatgaatccgttccacgtcgtgca Protospacer
* ******************. **** *..
442. spacer 13.14|5015499|34|CP031194|CRISPRCasFinder matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.706
agctcacggtgatgaatccgttcttcgtctggtg CRISPR spacer
cccggacggtgatgaatccgttccacgtcgtgca Protospacer
* ******************. **** *..
443. spacer 7.15|2899479|37|CP031194|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 11, identity: 0.703
cgcgtcggccggcgcggtctgcccgacctcccagtgc CRISPR spacer
ctgcacggccggctcgatctgcccgacctccagccgt Protospacer
* ******** **.************** . .*.
