1. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to MT777452 (Bacillus phage Baseball_field, complete genome) position: , mismatch: 7, identity: 0.794
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
aaaaagaaaaagaaaaaaattagagaaaaaatgg Protospacer
* .**************** ***** ****.*
2. spacer 1.25|235483|34|CP031252|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.794
-----tcgtaaatgcggccaaaccacggcaggccgaagt CRISPR spacer
ggccgtcgt-----cggtcaaaccacggcaggccgaagc Protospacer
**** ***.********************.
3. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to NZ_CP040940 (Cetia pacifica strain TB6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
aacttgaaaaagaaaaaaaagagagatgaaataa Protospacer
* * ************** *******.***..
4. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to KY744230 (Sulfolobus islandicus rod-shaped virus 10, partial genome) position: , mismatch: 8, identity: 0.765
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
attaacaaaaagaaaaaaattatagataaaaaac Protospacer
*...* ************** * ******** .*
5. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to KY744228 (Sulfolobus islandicus rod-shaped virus 9, partial genome) position: , mismatch: 8, identity: 0.765
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
attaacaaaaagaaaaaaattatagataaaaaac Protospacer
*...* ************** * ******** .*
6. spacer 1.17|235286|34|CP031252|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 8, identity: 0.765
ggcttcggcattacacgcaagggcaatggctcgg CRISPR spacer
taccttgggattacatgcaagggcaatggctatg Protospacer
.*.*.** ******.*************** *
7. spacer 1.17|235286|34|CP031252|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.765
ggcttcggcattacacgcaagggcaatggctcgg CRISPR spacer
ggcttcggcattgcccgcaagggcgaggtggcgc Protospacer
************.* *********.* * **
8. spacer 1.25|235483|34|CP031252|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.765
tcgtaaatgcggccaaaccacggcaggccgaagt CRISPR spacer
ccgcacgtgcggccaagccacggcacgccgacgc Protospacer
.**.* .*********.******** ***** *.
9. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to NZ_AP019832 (Leptotrichia trevisanii strain JMUB3870 plasmid pJMUB3870-1, complete sequence) position: , mismatch: 9, identity: 0.735
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
aagaaaaaaaagaaaaaaaggagagagaaaaaaa Protospacer
* .*.************* ****** **** .
10. spacer 1.3|234371|34|CP031252|CRISPRCasFinder,CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 10, identity: 0.706
atataagtcaagcggatcacgcgggacatggccc CRISPR spacer
atcgttaccaagcgcatcacgctggacatggcgg Protospacer
** ..****** ******* *********
11. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 10, identity: 0.706
----accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
ttgcccc----taaagcaaaaaatgagagaaaaaactt Protospacer
** **** ************* ***** .
12. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to AP013441 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C22-MedDCM-OCT-S33-C34) position: , mismatch: 10, identity: 0.706
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
aaaaagaaagaaaaaaaaatgagagatactaaag Protospacer
* .*****.*.**************** * .
13. spacer 1.3|234371|34|CP031252|CRISPRCasFinder,CRT matches to NZ_CP019065 (Rahnella sp. ERMR1:05 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.676
atataagtcaagcggatcacgcgggacatggccc CRISPR spacer
tcgatcatcaatcggatcacgcgggagatggggc Protospacer
.. .**** ************** **** *
14. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to CP024686 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-2-313K, complete sequence) position: , mismatch: 11, identity: 0.676
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
ttatatgaaaagaaaaaaatgggagatacaatta Protospacer
. * .**************.****** **.
15. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to KX397369 (Erwinia phage vB_EamM_Kwan, complete genome) position: , mismatch: 11, identity: 0.676
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
ataccccaaaagaaaaaaatgagacgtaaaaaat Protospacer
*. ***************** .***** ..
16. spacer 1.8|234698|34|CP031252|CRISPRCasFinder,CRT matches to NC_049962 (Bacillus phage SerPounce, complete genome) position: , mismatch: 11, identity: 0.676
accgagaaaaagaaaaaaatgagagataaaacgc CRISPR spacer
atattttaaaagaaaaaaatgaaagagaaaaaca Protospacer
*. ***************.*** ****
