1. spacer 2.7|167485|30|CP031253|CRISPRCasFinder,CRT matches to NC_010906 (Neisseria lactamica isolate 410838 plasmid pNL18.1, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaagtgatgcaaaaaccgtgatttcag CRISPR spacer
ctcgaagtgatgcaaaaaccgtgatttcag Protospacer
******************************
2. spacer 2.7|167485|30|CP031253|CRISPRCasFinder,CRT matches to NC_010888 (Neisseria lactamica isolate 811778 plasmid pNL15, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaagtgatgcaaaaaccgtgatttcag CRISPR spacer
ctcgaagtgatgcaaaaaccgtgatttcag Protospacer
******************************
3. spacer 2.7|167485|30|CP031253|CRISPRCasFinder,CRT matches to NC_010855 (Neisseria lactamica isolate 102739 plasmid pNL11, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaagtgatgcaaaaaccgtgatttcag CRISPR spacer
ctcgaagtgatgcaaaaaccgtgatttcag Protospacer
******************************
4. spacer 2.7|167485|30|CP031253|CRISPRCasFinder,CRT matches to NC_010871 (Neisseria lactamica isolate 9225393 plasmid pNL7.1, complete sequence) position: , mismatch: 0, identity: 1.0
ctcgaagtgatgcaaaaaccgtgatttcag CRISPR spacer
ctcgaagtgatgcaaaaaccgtgatttcag Protospacer
******************************
5. spacer 2.10|167683|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_010928 (Neisseria lactamica plasmid pNL18.2, complete sequence) position: , mismatch: 0, identity: 1.0
tgtactatgcaattcaaaatctcttggcaa CRISPR spacer
tgtactatgcaattcaaaatctcttggcaa Protospacer
******************************
6. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_010868 (Neisseria lactamica plasmid pNL750149, complete sequence) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
7. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_010869 (Neisseria lactamica plasmid pNL932024, complete sequence) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
8. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_025192 (Neisseria meningitidis serogroup A plasmid pJS-A) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
9. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_010868 (Neisseria lactamica plasmid pNL750149, complete sequence) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
10. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_010869 (Neisseria lactamica plasmid pNL932024, complete sequence) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
11. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NC_025192 (Neisseria meningitidis serogroup A plasmid pJS-A) position: , mismatch: 0, identity: 1.0
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tttagtgcgtgatgtttgggcagagcagca Protospacer
******************************
12. spacer 3.11|395495|35|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_010923 (Neisseria lactamica plasmid pNL9, complete sequence) position: , mismatch: 0, identity: 1.0
ctctctctcttcgtcgcttatggcgtattcgagag CRISPR spacer
ctctctctcttcgtcgcttatggcgtattcgagag Protospacer
***********************************
13. spacer 3.2|394902|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_010923 (Neisseria lactamica plasmid pNL9, complete sequence) position: , mismatch: 1, identity: 0.97
ctgattttattcgtactcgtatgggcatttaaa CRISPR spacer
ctgattttattcgtgctcgtatgggcatttaaa Protospacer
**************.******************
14. spacer 3.3|394967|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_004758 (Neisseria meningitidis plasmid pJS-B, complete sequence) position: , mismatch: 1, identity: 0.97
aggtctgtcaaagaactctgttatgacgtttac CRISPR spacer
aagtctgtcaaagaactctgttatgacgtttac Protospacer
*.*******************************
15. spacer 3.3|394967|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to ADWM02000138 (Neisseria meningitidis K1207 plasmid, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97
aggtctgtcaaagaactctgttatgacgtttac CRISPR spacer
aagtctgtcaaagaactctgttatgacgtttac Protospacer
*.*******************************
16. spacer 3.2|394902|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_004758 (Neisseria meningitidis plasmid pJS-B, complete sequence) position: , mismatch: 2, identity: 0.939
ctgattttattcgtactcgtatgggcatttaaa CRISPR spacer
ctgattttattcgtgatcgtatgggcatttaaa Protospacer
**************. *****************
17. spacer 3.2|394902|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to ADWM02000138 (Neisseria meningitidis K1207 plasmid, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.939
ctgattttattcgtactcgtatgggcatttaaa CRISPR spacer
ctgattttattcgtgatcgtatgggcatttaaa Protospacer
**************. *****************
18. spacer 3.21|396156|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_004758 (Neisseria meningitidis plasmid pJS-B, complete sequence) position: , mismatch: 2, identity: 0.941
atcgccatggcttatctctattccgcaatcttgg CRISPR spacer
atagccatggcttacctctattccgcaatcttgg Protospacer
** ***********.*******************
19. spacer 3.21|396156|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to ADWM02000138 (Neisseria meningitidis K1207 plasmid, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.941
atcgccatggcttatctctattccgcaatcttgg CRISPR spacer
atagccatggcttacctctattccgcaatcttgg Protospacer
** ***********.*******************
20. spacer 3.3|394967|33|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NC_010923 (Neisseria lactamica plasmid pNL9, complete sequence) position: , mismatch: 3, identity: 0.909
aggtctgtcaaagaactctgttatgacgtttac CRISPR spacer
aagtcggttaaagaactctgttatgacgtttac Protospacer
*.*** **.************************
21. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 4, identity: 0.862
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccgtcggtgtcggtgtcgccgcggatc Protospacer
****************** ***** * *.
22. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 5, identity: 0.828
tgccgtcggtgtcggtgtggccgctgctt- CRISPR spacer
ggccgtcggtgtcgatgaggccgc-gctga Protospacer
*************.** ****** ***
23. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_021086 (Cutibacterium acnes HL096PA1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
tgccg-tcggtgtcggtgtggccgctgctt CRISPR spacer
-gcggctcggtgtcggtgtggatgctgctc Protospacer
** * *************** .******.
24. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP012356 (Cutibacterium acnes strain PA_15_1_R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
tgccg-tcggtgtcggtgtggccgctgctt CRISPR spacer
-gcggctcggtgtcggtgtggatgctgctc Protospacer
** * *************** .******.
25. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 5, identity: 0.833
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gtgccgtcggtgtcggtgtcgccgcggatc Protospacer
****************** ***** * *.
26. spacer 6.2|1337582|27|CP031253|PILER-CR matches to KY398841 (Escherichia phage vB_Ecos_CEB_EC3a, complete genome) position: , mismatch: 5, identity: 0.815
cggcaatattcaaaggttataaaagac CRISPR spacer
aggcagtatttaaaggttataaaaaag Protospacer
****.****.*************.*
27. spacer 6.2|1337582|27|CP031253|PILER-CR matches to MN164484 (Escherichia virus ECH1, complete genome) position: , mismatch: 5, identity: 0.815
cggcaatattcaaaggttataaaagac CRISPR spacer
aggcagtatttaaaggttataaaaagc Protospacer
****.****.*************..*
28. spacer 6.2|1337582|27|CP031253|PILER-CR matches to MT511058 (Escherichia phage vB_EcoD_SU57, complete genome) position: , mismatch: 5, identity: 0.815
cggcaatattcaaaggttataaaagac CRISPR spacer
aggcagtatttaaaggttataaaaaag Protospacer
****.****.*************.*
29. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 6, identity: 0.793
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgccg Protospacer
.* **************.***** ***.
30. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
ggccgtcggtgccggtgtggccggggccg Protospacer
**********.*********** **.
31. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 6, identity: 0.793
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccggcggtgtcggtatggccgacgatg Protospacer
***** **********.****** .* *
32. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 6, identity: 0.793
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccgtcgggggcggtgtggccggtccac Protospacer
********* * *********** * * .
33. spacer 2.3|167420|29|CP031253|PILER-CR matches to MN033554 (Leviviridae sp. isolate H4_Bulk_46_scaffold_14885 sequence) position: , mismatch: 6, identity: 0.793
agatttccaatgtagaacttgagttttgg CRISPR spacer
tcatttccgatgtggaacttgagttttat Protospacer
******.****.*************.
34. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 6, identity: 0.8
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
ctgccggcggtgtcggtatggccgacgatg Protospacer
****** **********.****** .* *
35. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_021086 (Cutibacterium acnes HL096PA1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ctgccg--tcggtgtcggtgtggccgctgctt CRISPR spacer
--ggcggctcggtgtcggtgtggatgctgctc Protospacer
* ** *************** .******.
36. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 6, identity: 0.8
ctgccgtcggtgtcggtgtggccgctgctt- CRISPR spacer
gggccgtcggtgtcgatgaggccgc-gctga Protospacer
*************.** ****** ***
37. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP012356 (Cutibacterium acnes strain PA_15_1_R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ctgccg--tcggtgtcggtgtggccgctgctt CRISPR spacer
--ggcggctcggtgtcggtgtggatgctgctc Protospacer
* ** *************** .******.
38. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgagcgtgatgtttgggccgggcagcc Protospacer
*.* * *************** *.*****
39. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgcgcgtgatgtttgggccgggcagcc Protospacer
*.* *.*************** *.*****
40. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgcgcgtgatgtttgggccgaacagcg Protospacer
*.* *.*************** **.****.
41. spacer 2.11|167749|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgagcgtgatgtttgggccgggcagcc Protospacer
*.* * *************** *.*****
42. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgagcgtgatgtttgggccgggcagcc Protospacer
*.* * *************** *.*****
43. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgcgcgtgatgtttgggccgggcagcc Protospacer
*.* *.*************** *.*****
44. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgcgcgtgatgtttgggccgaacagcg Protospacer
*.* *.*************** **.****.
45. spacer 2.12|167815|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
tttagtgcgtgatgtttgggcagagcagca CRISPR spacer
tcttgagcgtgatgtttgggccgggcagcc Protospacer
*.* * *************** *.*****
46. spacer 6.2|1337582|27|CP031253|PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 6, identity: 0.778
cggcaatattcaaaggttataaaagac CRISPR spacer
gttcaatgtacaaaggttataaaagaa Protospacer
****.* ****************
47. spacer 6.2|1337582|27|CP031253|PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 6, identity: 0.778
cggcaatattcaaaggttataaaagac CRISPR spacer
gttcaatgtacaaaggttataaaagaa Protospacer
****.* ****************
48. spacer 6.2|1337582|27|CP031253|PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 6, identity: 0.778
cggcaatattcaaaggttataaaagac CRISPR spacer
gttcaatgtacaaaggttataaaagaa Protospacer
****.* ****************
49. spacer 6.2|1337582|27|CP031253|PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 6, identity: 0.778
cggcaatattcaaaggttataaaagac CRISPR spacer
gttcaatgtacaaaggttataaaagaa Protospacer
****.* ****************
50. spacer 6.2|1337582|27|CP031253|PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 6, identity: 0.778
cggcaatattcaaaggttataaaagac CRISPR spacer
gttcaatgtacaaaggttataaaagaa Protospacer
****.* ****************
51. spacer 2.1|167288|29|CP031253|PILER-CR matches to MK919469 (Gordonia phage Madeline, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gatcctcggtgtcggtctggccgctgcga Protospacer
..* *********** **********
52. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tctggtcggcgtcggtgtggctgctgcgc Protospacer
* . *****.***********.***** .
53. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccgtcggcgtcggagtggccgagggcc Protospacer
*********.***** ******* * ..
54. spacer 2.1|167288|29|CP031253|PILER-CR matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccgtcggtgtcggtgtcggcgacggcg Protospacer
****************** * ** .* .
55. spacer 2.1|167288|29|CP031253|PILER-CR matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
56. spacer 2.1|167288|29|CP031253|PILER-CR matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
57. spacer 2.1|167288|29|CP031253|PILER-CR matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
58. spacer 2.1|167288|29|CP031253|PILER-CR matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
59. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
60. spacer 2.1|167288|29|CP031253|PILER-CR matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
61. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tcacgccggtgtcggtgtagccgctggcc Protospacer
* **.************.******* ..
62. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 7, identity: 0.759
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
ctccgccggtgtcggtgtggccgtcgcga Protospacer
. ***.*****************..**
63. spacer 2.3|167420|29|CP031253|PILER-CR matches to NC_015250 (Acinetobacter phage 133, complete genome) position: , mismatch: 7, identity: 0.759
agatttccaatgtagaacttgagttttgg CRISPR spacer
attgggcaaatgtagaacttgagtattgg Protospacer
* * **************** ****
64. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
aggccgtcggtgccggtgtggccggggccg Protospacer
**********.*********** **.
65. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MK919469 (Gordonia phage Madeline, complete genome) position: , mismatch: 7, identity: 0.767
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cgatcctcggtgtcggtctggccgctgcga Protospacer
* ..* *********** **********
66. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 7, identity: 0.767
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgccg Protospacer
.* **************.***** ***.
67. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.767
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gtgccgtcgggggcggtgtggccggtccac Protospacer
********* * *********** * * .
68. spacer 2.6|167419|30|CP031253|CRISPRCasFinder,CRT matches to MN033554 (Leviviridae sp. isolate H4_Bulk_46_scaffold_14885 sequence) position: , mismatch: 7, identity: 0.767
tagatttccaatgtagaacttgagttttgg CRISPR spacer
ctcatttccgatgtggaacttgagttttat Protospacer
. ******.****.*************.
69. spacer 2.13|167881|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to MT066160 (Vibrio phage Saratov-12, complete genome) position: , mismatch: 7, identity: 0.767
ctgcctgctggaatcaagcacggttatagt CRISPR spacer
aacccttctggaaccaagcacggttagatt Protospacer
*** ******.************ * *
70. spacer 2.13|167881|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to MT767883 (Vibrio phage Saratov-15, complete genome) position: , mismatch: 7, identity: 0.767
ctgcctgctggaatcaagcacggttatagt CRISPR spacer
aacccttctggaaccaagcacggttagatt Protospacer
*** ******.************ * *
71. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.724
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
ctgcgtcggtgtcgatgtggccgcgaatg Protospacer
. ***********.********* . *
72. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccctcggtgttggtgtggccggcatca Protospacer
**** *******.********** ....
73. spacer 2.1|167288|29|CP031253|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tgccgtcggtgtcggtgaagccgagcggg Protospacer
***************** .****
74. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 8, identity: 0.724
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cttggtcggagtcggtgtggacgctgccg Protospacer
. . ***** ********** ******.
75. spacer 2.1|167288|29|CP031253|PILER-CR matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 8, identity: 0.724
tgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cttggtcggagtcggtgtggacgctgccg Protospacer
. . ***** ********** ******.
76. spacer 2.3|167420|29|CP031253|PILER-CR matches to MN855897 (Inoviridae sp. isolate 387, complete genome) position: , mismatch: 8, identity: 0.724
agatttccaatgtagaacttgagttttgg CRISPR spacer
tgatttccaatgatgaacttgagtaacat Protospacer
*********** ********** ..
77. spacer 2.3|167420|29|CP031253|PILER-CR matches to MN694751 (Marine virus AFVG_250M1010, complete genome) position: , mismatch: 8, identity: 0.724
agatttccaatgtagaacttgagttttgg CRISPR spacer
caatttctagtgtagaacttgagttagat Protospacer
.*****.*.*************** .
78. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
cctgcgtcggtgtcgatgtggccgcgaatg Protospacer
*. ***********.********* . *
79. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
atctggtcggcgtcggtgtggctgctgcgc Protospacer
* . *****.***********.***** .
80. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gtcacgccggtgtcggtgtagccgctggcc Protospacer
* **.************.******* ..
81. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
atgccgtcggcgtcggagtggccgagggcc Protospacer
*********.***** ******* * ..
82. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
tctccgccggtgtcggtgtggccgtcgcga Protospacer
.. ***.*****************..**
83. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
ctgccgtcgttgccggtgtggcccgaccac Protospacer
********* **.********** * .
84. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gtgccgtcggtgtcggtgtcggcgacggcg Protospacer
****************** * ** .* .
85. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
86. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
87. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
88. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
89. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
90. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 8, identity: 0.733
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcgacgtcggtgtcggtgcggccggtgtcg Protospacer
.* **************.***** **..
91. spacer 2.6|167419|30|CP031253|CRISPRCasFinder,CRT matches to NC_015250 (Acinetobacter phage 133, complete genome) position: , mismatch: 8, identity: 0.733
tagatttccaatgtagaacttgagttttgg CRISPR spacer
cattgggcaaatgtagaacttgagtattgg Protospacer
.* * **************** ****
92. spacer 3.10|395429|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 8, identity: 0.765
ccgttaagcgcatcaatctgccgcgcaatctccc CRISPR spacer
ctaatccccgcatcaaactgccgcacaatctccc Protospacer
*.. * ******** *******.*********
93. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 9, identity: 0.7
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcttggtcggagtcggtgtggacgctgccg Protospacer
. . ***** ********** ******.
94. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
atgccctcggtgttggtgtggccggcatca Protospacer
**** *******.********** ....
95. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 9, identity: 0.7
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gcttggtcggagtcggtgtggacgctgccg Protospacer
. . ***** ********** ******.
96. spacer 2.4|167287|30|CP031253|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ctgccgtcggtgtcggtgtggccgctgctt CRISPR spacer
gtgccgtcggtgtcggtgaagccgagcggg Protospacer
***************** .****
97. spacer 2.6|167419|30|CP031253|CRISPRCasFinder,CRT matches to MN694751 (Marine virus AFVG_250M1010, complete genome) position: , mismatch: 9, identity: 0.7
tagatttccaatgtagaacttgagttttgg CRISPR spacer
ccaatttctagtgtagaacttgagttagat Protospacer
. .*****.*.*************** .
98. spacer 2.6|167419|30|CP031253|CRISPRCasFinder,CRT matches to MN855897 (Inoviridae sp. isolate 387, complete genome) position: , mismatch: 9, identity: 0.7
tagatttccaatgtagaacttgagttttgg CRISPR spacer
gtgatttccaatgatgaacttgagtaacat Protospacer
*********** ********** ..
99. spacer 2.9|167617|30|CP031253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.7
cggttgcgcgcgggacgattttgccgtatg CRISPR spacer
tcttctcgcgcgggacgatcttgccgtcga Protospacer
. *. *************.******* .
100. spacer 3.10|395429|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to MK804891 (Aeromonas phage 2_D05, complete genome) position: , mismatch: 9, identity: 0.735
ccgttaagcgcatcaatctgccgcgcaatctccc CRISPR spacer
ctcatcccagcatcaaactgccgcacaatctccc Protospacer
*. * ******* *******.*********
101. spacer 3.10|395429|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.735
ccgttaagcgcatcaatctgccgcgcaatctccc CRISPR spacer
tcgccgcccgcgtcaatctgcagcgcaatctcgc Protospacer
.**... ***.********* ********** *
102. spacer 3.10|395429|34|CP031253|PILER-CR,CRISPRCasFinder,CRT matches to MK804892 (Aeromonas phage 4_D05, complete genome) position: , mismatch: 9, identity: 0.735
ccgttaagcgcatcaatctgccgcgcaatctccc CRISPR spacer
ctcatccccgcatcaaactgccgcacaatctctc Protospacer
*. * ******** *******.*******.*
