1. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.833
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
acgtgcaggacggcaaggcgtggacatcgg Protospacer
**************** ******** *
2. spacer 1.19|432051|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_014642 (Achromobacter xylosoxidans A8 plasmid pA82, complete sequence) position: , mismatch: 5, identity: 0.833
caatgcgggatgccatgcaccctttgttga-- CRISPR spacer
caacgcgggatgccctgcaccc--tgatgaag Protospacer
***.********** ******* ** ***
3. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
4. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
5. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
6. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
7. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
8. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
9. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
10. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
11. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
12. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
13. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
14. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
15. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
atgtgcaggacggcaaggcgtggacatcgg Protospacer
.*************** ******** *
16. spacer 1.6|431193|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
gcccaaatcatagatttctttgatcgcaag CRISPR spacer
acccaagtcatagatttctttcatcggcaa Protospacer
.*****.************** **** *.
17. spacer 1.7|431259|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN693996 (Marine virus AFVG_250M857, complete genome) position: , mismatch: 6, identity: 0.8
cggttcgctcgttgtgatagacgaagcaca CRISPR spacer
ccctacgctcgtcgtgatggacgaagcaga Protospacer
* * *******.*****.********* *
18. spacer 1.7|431259|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 6, identity: 0.8
cggttcgctcgttgtgatagacgaagcaca CRISPR spacer
ccctacgctcgtcgtgatggacgaagcaga Protospacer
* * *******.*****.********* *
19. spacer 1.10|431457|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
gcaagtcggaacatgcggaacggcttgcct CRISPR spacer
gcgaaatcgaacatgcggaacggcttgccc Protospacer
**.*. . *********************.
20. spacer 1.11|431523|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 6, identity: 0.8
gccgcgccgcgcatatagtccacatgcccc CRISPR spacer
gccgcgccgcgcatatagcccacgcgcttg Protospacer
******************.****..**..
21. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK279899 (Arthrobacter phage Maja, complete genome) position: , mismatch: 7, identity: 0.767
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
gagtgccggacggcaagccgtggaacccca Protospacer
**** ***************** **
22. spacer 1.2|430929|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN694749 (Marine virus AFVG_250M1150, complete genome) position: , mismatch: 7, identity: 0.767
attgcaaaagcatttaggctggaaacgcaa CRISPR spacer
aatgcaaaagcatttatgctgaaaaaaaca Protospacer
* ************** ****.*** . *
23. spacer 1.2|430929|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN694747 (Marine virus AFVG_250M618, complete genome) position: , mismatch: 7, identity: 0.767
attgcaaaagcatttaggctggaaacgcaa CRISPR spacer
aatgcaaaagcatttatgctgaaaaaaaca Protospacer
* ************** ****.*** . *
24. spacer 1.11|431523|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gccgcgccgcgcatatagtccacatgcccc CRISPR spacer
ggggcgccgcgcagatcgtccacatgggcg Protospacer
* ********** ** ********* *
25. spacer 1.11|431523|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.767
gccgcgccgcgcatatagtccacatgcccc CRISPR spacer
gccgcgccgcgcatgtagcccacgcgcttt Protospacer
**************.***.****..**...
26. spacer 1.12|431589|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026529 (Sinorhizobium meliloti strain AK21 plasmid pSmeAK21b, complete sequence) position: , mismatch: 7, identity: 0.767
tggctcgctggttgtgatagacgaagcaca- CRISPR spacer
ctgcccgctggttctgatagacgaa-cgcgg Protospacer
. **.******** *********** *.*.
27. spacer 1.12|431589|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to KP881232 (Sinorhizobium phage phiM9, complete genome) position: , mismatch: 7, identity: 0.767
tggctcgctggttgtgatagacgaagcaca CRISPR spacer
gatctcgctggttgagatagtcgaagatca Protospacer
. *********** ***** ***** **
28. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
29. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggggactatgaacacctttgccaaatct Protospacer
* .* ** ****** *************
30. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
31. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
32. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
33. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448953 (Streptococcus phage Javan474, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
34. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
35. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448945 (Streptococcus phage Javan454, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
36. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
37. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
38. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
39. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
40. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
41. spacer 1.14|431721|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 7, identity: 0.767
aagtagcctctgaacaactttgccaaatct CRISPR spacer
ctggtgactatgaacacctttgccaaatct Protospacer
* * ** ****** *************
42. spacer 1.19|432051|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
caatgcgggatgccatgcaccctttgttga-- CRISPR spacer
tcatgcgggaggccatgcaccc--tgccgacc Protospacer
. ******** *********** **..**
43. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
44. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
45. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
46. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
47. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
48. spacer 1.20|432117|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcacaggtgttgtaaaacaaacatcatct CRISPR spacer
gaaacaggtgttgtaaaagaaacagggttt Protospacer
* *************** ***** .*.*
49. spacer 2.52|1708185|35|CP031255|CRISPRCasFinder matches to MK448495 (Streptococcus satellite phage Javan434, complete genome) position: , mismatch: 7, identity: 0.8
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaatagttttttagaaaaatattatttttt Protospacer
********.******** ******** * * * *
50. spacer 2.52|1708185|35|CP031255|CRISPRCasFinder matches to KC330683 (Bacillus phage Finn, complete genome) position: , mismatch: 7, identity: 0.8
tatgtcaacagtttttttgaaaaataatttatgta-- CRISPR spacer
tatgtcaacagtttttataaaaaatg--ttaaggagt Protospacer
**************** *.******. *** * *
51. spacer 2.78|1708186|35|CP031255|PILER-CR matches to MK448495 (Streptococcus satellite phage Javan434, complete genome) position: , mismatch: 7, identity: 0.8
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaatagttttttagaaaaatattatttttt Protospacer
********.******** ******** * * * *
52. spacer 2.78|1708186|35|CP031255|PILER-CR matches to KC330683 (Bacillus phage Finn, complete genome) position: , mismatch: 7, identity: 0.8
tatgtcaacagtttttttgaaaaataatttatgta-- CRISPR spacer
tatgtcaacagtttttataaaaaatg--ttaaggagt Protospacer
**************** *.******. *** * *
53. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016850 (Pseudomonas sp. TMW 2.1634 plasmid pL21564-1, complete sequence) position: , mismatch: 8, identity: 0.733
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
tagacgaaaacggcaagcagtggacagccc Protospacer
. * *..********* ***********
54. spacer 1.3|430995|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to GU979517 (Acinetobacter phage phiAB2 hypothetical protein (pd9) gene, partial cds) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
acctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
55. spacer 1.3|430995|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_041966 (Acinetobacter phage WCHABP1, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcccgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
56. spacer 1.3|430995|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MH853788 (Acinetobacter phage vB_KpnM_IME512, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
57. spacer 1.3|430995|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN166083 (Acinetobacter phage Abp9, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcccgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
58. spacer 1.3|430995|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_048142 (Acinetobacter phage AbKT21phiIII, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
acctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
59. spacer 1.4|431061|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to GU979517 (Acinetobacter phage phiAB2 hypothetical protein (pd9) gene, partial cds) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
acctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
60. spacer 1.4|431061|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_041966 (Acinetobacter phage WCHABP1, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcccgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
61. spacer 1.4|431061|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MH853788 (Acinetobacter phage vB_KpnM_IME512, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
62. spacer 1.4|431061|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MN166083 (Acinetobacter phage Abp9, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
gcccgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
63. spacer 1.4|431061|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_048142 (Acinetobacter phage AbKT21phiIII, complete genome) position: , mismatch: 8, identity: 0.733
tgtaattggttttgggtgtaatgttttaac CRISPR spacer
acctgttggttttggttgtgatgttttaat Protospacer
. .********** ***.*********.
64. spacer 1.8|431325|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_001949 (Lactococcus lactis DPC3147 plasmid pMRC01, complete sequence) position: , mismatch: 8, identity: 0.733
gaagttatcaatggttatgagaaaaagcct CRISPR spacer
aacattatcaatgatgatgagaaaaagata Protospacer
.* .*********.* *********** .
65. spacer 1.10|431457|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.733
gcaagtcggaacatgcggaacggcttgcct CRISPR spacer
atgagctcgaacatgcggaagggcttgccc Protospacer
...**.. ************ ********.
66. spacer 1.11|431523|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.733
gccgcgccgcgcatatagtccacatgcccc CRISPR spacer
tccgcgccgcggatatagtccatgaactca Protospacer
********** **********.. .*.*
67. spacer 1.13|431655|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 8, identity: 0.733
ctatacttcaaaatcaaggaagaccgccgc CRISPR spacer
ggctggttcaagatcaaggaagaccgccca Protospacer
*. *****.****************
68. spacer 1.18|431985|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NC_012983 (Hirschia baltica ATCC 49814 plasmid pHbal01, complete sequence) position: , mismatch: 8, identity: 0.733
atcaaagtaatggccgttggaaataaagca CRISPR spacer
ctttttctattgtccgttggaaataaagca Protospacer
*. ** ** *****************
69. spacer 1.21|432183|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to AP013647 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C72-MedDCM-OCT-S41-C96, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
aaacggaaatgaacaaggtaataaattgga CRISPR spacer
tcatatatttgaacaaggtaataaattaga Protospacer
*.. * ******************.**
70. spacer 1.22|432249|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcgaattgacttcaattccgtgggagaat CRISPR spacer
gtcgaagtgacatcaattccgtgcagcgac Protospacer
****** **** *********** .. .*.
71. spacer 2.29|1706667|33|CP031255|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccgctggc-----cgacgtgctgatacacagcggcctt CRISPR spacer
-----ggcgcccgcgacgtgctgatccgcagcggcctg Protospacer
*** ************ *.*********
72. spacer 2.34|1706998|33|CP031255|CRISPRCasFinder matches to NZ_CP030786 (Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
cgaaaaattgcattaactaaaggatattgatat CRISPR spacer
tataaaattgcattaacaaaaggaaattggaaa Protospacer
.. ************** ****** ****. *
73. spacer 2.40|1707391|34|CP031255|CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 8, identity: 0.765
atgtaaccatcaacatctcccaactccgattgag CRISPR spacer
aatgaaccatcaacatcacccaactctgatagtt Protospacer
* ************* ********.*** *
74. spacer 2.52|1708185|35|CP031255|CRISPRCasFinder matches to KC330682 (Bacillus phage Taylor, complete genome) position: , mismatch: 8, identity: 0.771
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaacagtttttataaaaaatgtttaaggag Protospacer
**************** *.******. ** * * .
75. spacer 2.52|1708185|35|CP031255|CRISPRCasFinder matches to KC330680 (Bacillus phage Eoghan, complete genome) position: , mismatch: 8, identity: 0.771
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaacagtttttataaaaaatgtttaaggag Protospacer
**************** *.******. ** * * .
76. spacer 2.55|1706668|33|CP031255|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccgctggc-----cgacgtgctgatacacagcggcctt CRISPR spacer
-----ggcgcccgcgacgtgctgatccgcagcggcctg Protospacer
*** ************ *.*********
77. spacer 2.60|1706999|33|CP031255|PILER-CR matches to NZ_CP030786 (Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
cgaaaaattgcattaactaaaggatattgatat CRISPR spacer
tataaaattgcattaacaaaaggaaattggaaa Protospacer
.. ************** ****** ****. *
78. spacer 2.66|1707392|34|CP031255|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 8, identity: 0.765
atgtaaccatcaacatctcccaactccgattgag CRISPR spacer
aatgaaccatcaacatcacccaactctgatagtt Protospacer
* ************* ********.*** *
79. spacer 2.78|1708186|35|CP031255|PILER-CR matches to KC330682 (Bacillus phage Taylor, complete genome) position: , mismatch: 8, identity: 0.771
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaacagtttttataaaaaatgtttaaggag Protospacer
**************** *.******. ** * * .
80. spacer 2.78|1708186|35|CP031255|PILER-CR matches to KC330680 (Bacillus phage Eoghan, complete genome) position: , mismatch: 8, identity: 0.771
tatgtcaacagtttttttgaaaaataatttatgta CRISPR spacer
tatgtcaacagtttttataaaaaatgtttaaggag Protospacer
**************** *.******. ** * * .
81. spacer 1.1|430863|30|CP031255|PILER-CR,CRISPRCasFinder,CRT matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 9, identity: 0.7
ccgtgcaggacggcaagccgtggacagccc CRISPR spacer
ggccgcagtacggcaagccgtggacgttca Protospacer
.**** ****************. .*
82. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013669 (Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
83. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013789 (Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
84. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013764 (Piscirickettsia salmonis strain PM21567A plasmid p2PS2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
85. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013817 (Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
86. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013793 (Piscirickettsia salmonis strain AY6297B plasmid p2PS8, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
87. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013809 (Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
88. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013784 (Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
89. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039192 (Piscirickettsia salmonis strain Psal-160 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
90. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039089 (Piscirickettsia salmonis strain Psal-111 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
91. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013798 (Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
92. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013978 (Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
93. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP012509 (Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
94. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013822 (Piscirickettsia salmonis strain PM25344B plasmid p1PS14, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
95. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013758 (Piscirickettsia salmonis strain AY6492A plasmid p1PS1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
96. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039183 (Piscirickettsia salmonis strain Psal-158 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
97. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039052 (Piscirickettsia salmonis strain Psal-081 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
98. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP013945 (Piscirickettsia salmonis strain PSCGR01 plasmid pPSCRG01-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
99. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039057 (Piscirickettsia salmonis strain Psal-098 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
100. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
101. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP012416 (Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-3, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
102. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP039067 (Piscirickettsia salmonis strain Psal-107 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
103. spacer 2.51|1708119|34|CP031255|CRISPRCasFinder matches to NZ_CP038901 (Piscirickettsia salmonis strain Psal-006b plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
104. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013669 (Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
105. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013789 (Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
106. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013764 (Piscirickettsia salmonis strain PM21567A plasmid p2PS2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
107. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013817 (Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
108. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013793 (Piscirickettsia salmonis strain AY6297B plasmid p2PS8, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
109. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013809 (Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
110. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013784 (Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
111. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039192 (Piscirickettsia salmonis strain Psal-160 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
112. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039089 (Piscirickettsia salmonis strain Psal-111 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
113. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013798 (Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
114. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013978 (Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
115. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP012509 (Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
116. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013822 (Piscirickettsia salmonis strain PM25344B plasmid p1PS14, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
117. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013758 (Piscirickettsia salmonis strain AY6492A plasmid p1PS1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
118. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039183 (Piscirickettsia salmonis strain Psal-158 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
119. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039052 (Piscirickettsia salmonis strain Psal-081 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
120. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP013945 (Piscirickettsia salmonis strain PSCGR01 plasmid pPSCRG01-4, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
121. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039057 (Piscirickettsia salmonis strain Psal-098 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
122. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
123. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP012416 (Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-3, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
124. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP039067 (Piscirickettsia salmonis strain Psal-107 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
125. spacer 2.77|1708120|34|CP031255|PILER-CR matches to NZ_CP038901 (Piscirickettsia salmonis strain Psal-006b plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735
taagcagtataattttaaaaattgaggtgattta CRISPR spacer
atagcagtatatttttaataattgagattactag Protospacer
********* ****** *******.* *.* .
126. spacer 2.33|1706933|33|CP031255|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.697
ctgattgccggcaggctgcatcaggcggtggat CRISPR spacer
acgcagtccggctggctgcatccggcggtggcg Protospacer
.* ***** ********* ********
127. spacer 2.39|1707325|34|CP031255|CRISPRCasFinder matches to MN038175 (Panteoa phage Phynn, complete genome) position: , mismatch: 10, identity: 0.706
tgccgataaaaaacatcttagcgtattcaacatt CRISPR spacer
cgggtataacaaacctcttagcgtattcatgaag Protospacer
.* **** **** ************** *
128. spacer 2.59|1706934|33|CP031255|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.697
ctgattgccggcaggctgcatcaggcggtggat CRISPR spacer
acgcagtccggctggctgcatccggcggtggcg Protospacer
.* ***** ********* ********
129. spacer 2.65|1707326|34|CP031255|PILER-CR matches to MN038175 (Panteoa phage Phynn, complete genome) position: , mismatch: 10, identity: 0.706
tgccgataaaaaacatcttagcgtattcaacatt CRISPR spacer
cgggtataacaaacctcttagcgtattcatgaag Protospacer
.* **** **** ************** *
130. spacer 2.44|1707657|34|CP031255|CRISPRCasFinder matches to NZ_CP022669 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence) position: , mismatch: 11, identity: 0.676
gattccgtttccgccgctgtatcaggaatcggct CRISPR spacer
atcgaccttgccgccgctgtaccaggaatcgctg Protospacer
. . * ** ***********.********* .
131. spacer 2.70|1707658|34|CP031255|PILER-CR matches to NZ_CP022669 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence) position: , mismatch: 11, identity: 0.676
gattccgtttccgccgctgtatcaggaatcggct CRISPR spacer
atcgaccttgccgccgctgtaccaggaatcgctg Protospacer
. . * ** ***********.********* .
