Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025019 Oceanobacillus sp. 143 chromosome, complete genome 2 crisprs NA 0 1 0 0

Results visualization

1. CP025019
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025019_1 913924-914013 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025019_2 1080859-1080982 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 NZ_CP045036 Lactobacillus mali strain LM596 plasmid unnamed1, complete sequence 18705-18734 6 0.8
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 NZ_LR723672 Rhizobium flavum strain YW14 plasmid 3 112128-112157 7 0.767
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 MH370386 Salmonella phage S147, complete genome 94084-94113 7 0.767
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 NZ_CP018918 Serratia marcescens strain UMH5 plasmid unnamed2, complete sequence 54091-54120 7 0.767
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 NZ_CP003425 Serratia sp. SCBI plasmid SCBI_Pl, complete sequence 59107-59136 7 0.767
CP025019_1 1.1|913954|30|CP025019|CRISPRCasFinder 913954-913983 30 NC_047951 Yersinia phage phiR8-01 complete genome 31793-31822 8 0.733

1. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to NZ_CP045036 (Lactobacillus mali strain LM596 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
tgacttagcggttgcttctccgcctttttc	Protospacer
   ***.**************.*******.

2. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 7, identity: 0.767 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
ctgcttgccggttgcttctccagctttcag	Protospacer
 * **** ************** ****.

3. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to MH370386 (Salmonella phage S147, complete genome) position: , mismatch: 7, identity: 0.767 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
aatgctggcggatgctcctccacctttttg	Protospacer
. * .****** ****.************

4. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to NZ_CP018918 (Serratia marcescens strain UMH5 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
atctgtcgcggttgcttctccgccgttttt	Protospacer
.*.. * **************.** *****

5. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to NZ_CP003425 (Serratia sp. SCBI plasmid SCBI_Pl, complete sequence) position: , mismatch: 7, identity: 0.767 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
atctgtcgcggttgcttctccgccgttttt	Protospacer
.*.. * **************.** *****

6. spacer 1.1|913954|30|CP025019|CRISPRCasFinder matches to NC_047951 (Yersinia phage phiR8-01 complete genome) position: , mismatch: 8, identity: 0.733 

gttcttggcggttgcttctccacctttttt	CRISPR spacer
aatcttggcggttgcttctgcacggtagtc	Protospacer
. ***************** ***  *  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage