Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031153 Kordia sp. SMS9 chromosome, complete genome 3 crisprs DEDDh,csa3,cas3,cas9,cas1,cas2,PrimPol 2 25 3 0

Results visualization

1. CP031153
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031153_2 2517244-2520521 orTypeII NA
42 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031153_3 2615533-2615645 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031153_4 4852872-4852952 Orphan NA
1 spacers
PrimPol

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031153_5 5.1|4972978|61|CP031153|PILER-CR 4972978-4973038 61 CP031153.1 4973890-4973950 1 0.984
CP031153_5 5.2|4973092|61|CP031153|PILER-CR 4973092-4973152 61 CP031153.1 4974004-4974064 1 0.984

1. spacer 5.1|4972978|61|CP031153|PILER-CR matches to position: 4973890-4973950, mismatch: 1, identity: 0.984

gcttaaattttcatctcctaccgtgccatcgtcaacacatggatcttgtggatctggatc	CRISPR spacer
gcttaaattttcatctcctaccgtgccatcgtcaacacatggatcttgtggatctggatc	Protospacer
************************************************************

2. spacer 5.2|4973092|61|CP031153|PILER-CR matches to position: 4974004-4974064, mismatch: 1, identity: 0.984

cgttacgtcttcatctcctaccgtgccatcgtcaacacatggatcttgcggatctggatc	CRISPR spacer
cgttacgtcttcatctcctaccgtgccatcgtcaacacatggatcttgcggatctggatc	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MH572290 Microviridae sp. isolate SD_SC_45, complete genome 3310-3339 4 0.867
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MG945625 UNVERIFIED: Microviridae sp. isolate 6123-1602, complete genome 348-377 4 0.867
CP031153_2 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR 2517670-2517699 30 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 155562-155591 5 0.833
CP031153_2 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR 2517670-2517699 30 MT708547 Klebsiella phage Muenster, complete genome 278297-278326 5 0.833
CP031153_2 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR 2517670-2517699 30 AB897757 Klebsiella phage K64-1 DNA, complete genome 155518-155547 5 0.833
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 NC_031024 Bacillus phage Belinda, complete genome 4658-4687 5 0.833
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 42675-42704 5 0.833
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 LC425521 Uncultured phage DNA, contig: NODE562 1011-1040 6 0.8
CP031153_2 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR 2517822-2517851 30 NZ_MK275620 Clostridium perfringens strain JXJA17 plasmid p2, complete sequence 15471-15500 6 0.8
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 CP002509 Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence 12730-12759 6 0.8
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MK448796 Streptococcus phage Javan53, complete genome 35115-35144 6 0.8
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP017026 Campylobacter coli plasmid pCC14983A-1, complete sequence 86863-86892 6 0.8
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP044170 Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence 31710-31739 6 0.8
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP017230 Campylobacter jejuni strain FORC_046 isolate Not reported plasmid pFORC46.1, complete sequence 9046-9075 6 0.8
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_AP018564 Staphylococcus argenteus strain 58113 plasmid p2, complete sequence 47952-47981 6 0.8
CP031153_2 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR 2519190-2519219 30 CP013734 Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence 34657-34686 6 0.8
CP031153_2 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR 2519190-2519219 30 NZ_CP038864 Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence 26169-26198 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NC_019688 Clostridium perfringens plasmid pNetB-NE10, complete sequence 75628-75657 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP025502 Clostridium perfringens strain EHE-NE18 plasmid pJIR3535, complete sequence 27544-27573 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP042495 Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence 57726-57755 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 MG945874 UNVERIFIED: Microviridae sp. isolate 125-1801, partial genome 6336-6365 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 JQ660954 Clostridium phage PhiS63, complete genome 24854-24883 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 125106-125135 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 152843-152872 6 0.8
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 107222-107251 6 0.8
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP028168 Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence 24310-24339 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG569891 Shigella sonnei strain DE105 plasmid pDE105, complete sequence 39319-39348 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 16322-16351 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP022456 Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence 64858-64887 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 80435-80464 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KT779550 Escherichia coli strain 369 plasmid p369, complete sequence 18533-18562 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 59003-59032 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KJ866866 Escherichia coli strain SKLX3330 plasmid pSKLX3330, complete sequence 32849-32878 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_020991 Shigella sonnei 10188 plasmid pKHSB1 complete sequence 69056-69085 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 45051-45080 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP042631 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence 44246-44275 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 87883-87912 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 208429-208458 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024226 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3 61697-61726 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP049350 Escherichia coli strain 3R plasmid p3R-2, complete sequence 93721-93750 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 111886-111915 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024468 Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence 72489-72518 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP043738 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence 102712-102741 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP020511 Escherichia coli strain 165 plasmid unnamed2, complete sequence 34712-34741 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 64195-64224 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 10811-10840 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 242876-242905 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 14794-14823 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 120419-120448 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP039714 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence 81520-81549 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP012627 Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence 42870-42899 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT838199 Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence 14301-14330 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP013221 Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence 14303-14332 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP041621 Shigella flexneri strain C32 plasmid pC32_2, complete sequence 5378-5407 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP015996 Escherichia coli strain S51 plasmid pS51_1, complete sequence 17288-17317 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045189 Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence 82120-82149 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 122677-122706 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 56229-56258 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019248 Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence 19750-19779 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 310171-310200 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 133569-133598 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014096 Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence 7558-7587 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014966 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence 134531-134560 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP049984 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N40391 plasmid pN40391-1, complete sequence 25222-25251 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024230 Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed2 49725-49754 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP041413 Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence 25944-25973 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP015161 Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence 5665-5694 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP045527 Shigella sonnei strain 6607.69 plasmid p6607-69, complete sequence 3549-3578 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP019691 Shigella sonnei strain 75/02 plasmid p75-02_3, complete sequence 16194-16223 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP044137 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence 21523-21552 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP032264 Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence 48215-48244 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 165951-165980 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 264546-264575 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016387 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence 51419-51448 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018993 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_2, complete sequence 78264-78293 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LC019731 Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01 14821-14850 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP053754 Shigella sonnei strain 506 plasmid pMHMC-003, complete sequence 40033-40062 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 91606-91635 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP050747 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence 15169-15198 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 242195-242224 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 13360-13389 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP035469 Escherichia coli strain U12A plasmid pU12A_B, complete sequence 10119-10148 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 226193-226222 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932029 Escherichia coli plasmid pEC15I_1, complete sequence 39045-39074 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932030 Escherichia coli plasmid pEC15I_2, complete sequence 39001-39030 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025176 Escherichia coli plasmid pH2291-112, complete sequence 78519-78548 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023899 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM7, complete sequence 56654-56683 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023900 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM2, complete sequence 59162-59191 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP010831 Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence 14308-14337 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 210142-210171 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024152 Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence 14311-14340 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 206710-206739 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025143 Escherichia coli plasmid pC59-112, complete sequence 54719-54748 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025144 Escherichia coli plasmid pC49-108, complete sequence 32240-32269 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP009566 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence 54093-54122 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 226123-226152 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP049180 Shigella sonnei strain L4094 plasmid pL4094, complete sequence 84243-84272 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_014383 Escherichia coli plasmid pEC_Bactec, complete sequence 84616-84645 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP049178 Shigella sonnei strain 1205.3131 plasmid p1205-3131, complete sequence 39055-39084 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 210142-210171 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 210138-210167 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_021811 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence 9315-9344 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 210142-210171 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP048298 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence 25220-25249 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP049176 Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence 7364-7393 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 207755-207784 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018946 Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence 73354-73383 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018975 Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence 16403-16432 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023365 Escherichia coli strain 144 plasmid p92, complete sequence 85150-85179 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 280519-280548 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP039475 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence 46597-46626 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419430 Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence 34842-34871 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419431 Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence 40133-40162 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419432 Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence 1933-1962 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419433 Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence 63328-63357 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419436 Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence 36747-36776 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419437 Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence 30889-30918 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP035721 Escherichia coli strain U15A plasmid pU15A_A, complete sequence 10119-10148 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 147161-147190 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 214249-214278 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019207 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence 5417-5446 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP039604 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence 75866-75895 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 27112-27141 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN125610 Salmonella enterica subsp. enterica serovar Enteritidis strain 1.11-3A7 plasmid pIncI1-CTX-M-14, complete sequence 57986-58015 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP044960 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence 34832-34861 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_021813 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence 22635-22664 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019173 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence 45656-45685 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023534 Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence 29491-29520 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019111 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence 33361-33390 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027135 Escherichia coli strain AR_0369 plasmid unnamed3 22816-22845 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MT230324 Escherichia coli strain DH5alpha plasmid pESBL71, complete sequence 19029-19058 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029975 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence 10300-10329 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025339 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence 31708-31737 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP043228 Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence 98197-98226 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH430881 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence 14591-14620 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH884650 Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence 13437-13466 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 13437-13466 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH884653 Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence 171561-171590 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH884654 Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence 33801-33830 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 112029-112058 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 12824-12853 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 101359-101388 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019905 Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence 111533-111562 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MN241905 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence 33458-33487 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH430883 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence 14301-14330 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MK238490 Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence 14780-14809 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MK070495 Escherichia coli strain MB6212 plasmid pMB5876, complete sequence 35899-35928 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027127 Escherichia coli strain AR_0374 plasmid unnamed2 74829-74858 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MF078004 Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence 40168-40197 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP037994 Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5 16078-16107 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP031903 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence 12893-12922 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP013224 Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence 97845-97874 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KX246268 Escherichia coli strain RD174 plasmid pHNRD174, complete sequence 54816-54845 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KU355874 Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence 65850-65879 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 62761-62790 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KT282968 Escherichia coli strain EC012 plasmid pEC012, complete sequence 109622-109651 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KX452392 Escherichia coli strain JB10 plasmid pJB10, complete sequence 78133-78162 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_015965 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence 61963-61992 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025455 Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76334 plasmid pSAG-76334, complete sequence 65386-65415 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KP987217 Klebsiella pneumoniae strain 628 plasmid p628-CTXM, complete sequence 54809-54838 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KM409652 Escherichia coli strain REL5382 plasmid pB15, complete sequence 66256-66285 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KM377238 Escherichia coli strain HV114 plasmid pHV114, complete sequence 76045-76074 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KM377239 Escherichia coli strain HV292 plasmid pHV292, complete sequence 82326-82355 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KP198616 Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence 77604-77633 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KM377240 Escherichia coli strain HV295 plasmid pHV295, complete sequence 70144-70173 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018625 Escherichia coli strain FORC_044 plasmid pFORC44_1, complete sequence 93245-93274 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024918 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.2, complete sequence 66082-66111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP035009 Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence 54343-54372 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045763 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence 88694-88723 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP028485 Escherichia coli strain E41-1 plasmid p2, complete sequence 68638-68667 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP010142 Escherichia coli strain D3 plasmid B, complete sequence 49541-49570 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP032445 Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence 52316-52345 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014494 Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence 50438-50467 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 156-185 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 189064-189093 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_022267 Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence 56309-56338 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 87718-87747 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 88790-88819 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 318077-318106 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014622 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence 63742-63771 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP039299 Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence 74630-74659 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 57394-57423 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LS992187 Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence 10437-10466 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053786 Escherichia coli isolate 2-101 plasmid p2-101, complete sequence 74082-74111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045523 Shigella flexneri strain 5908.2 plasmid p5908-2 86889-86918 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 70568-70597 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 88153-88182 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053788 Escherichia coli isolate J31 plasmid pJ31, complete sequence 74082-74111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KF290378 Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence 68262-68291 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_010119 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence 95706-95735 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 100080-100109 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 99330-99359 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_EU418931 Escherichia coli strain JIE174 plasmid pJIE174, complete sequence 64482-64511 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_EU418923 Escherichia coli strain JIE113 plasmid pJIE113, complete sequence 60082-60111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_EU418926 Escherichia coli strain JIE139 plasmid pJIE139, complete sequence 56800-56829 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 79762-79791 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_013120 Escherichia coli plasmid pEK204, complete sequence 59801-59830 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025198 Escherichia coli plasmid pJIE512b, complete sequence 60403-60432 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP026726 Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence 51376-51405 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019252 Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence 100321-100350 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP006641 Escherichia coli PCN061 plasmid PCN061p5, complete sequence 71664-71693 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 165749-165778 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 55415-55444 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 93198-93227 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 71105-71134 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 286524-286553 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP032524 Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence 55115-55144 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 70906-70935 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LT985289 Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p 57444-57473 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019249 Escherichia coli strain Combat13F7 plasmid pCombat13F7-4, complete sequence 4431-4460 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023329 Escherichia coli strain B3804 plasmid pIFM3804, complete sequence 69820-69849 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP022064 Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence 83824-83853 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP021841 Escherichia coli strain EC974 plasmid pEC974-1, complete sequence 90739-90768 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016572 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence 67892-67921 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CM019852 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-2, complete sequence, whole genome shotgun sequence 24119-24148 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_018659 Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence 4947-4976 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MH579767 Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence 48593-48622 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 80710-80739 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 179246-179275 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP038417 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence 56868-56897 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014662 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 plasmid pSAN1-2010K-2577, complete sequence 72448-72477 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP044183 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence 50231-50260 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 16113-16142 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 65464-65493 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181557 Escherichia coli plasmid p14019095, complete sequence 73502-73531 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181558 Escherichia coli plasmid p15076331, complete sequence 73510-73539 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181559 Escherichia coli plasmid p199, complete sequence 85088-85117 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181560 Escherichia coli plasmid p14006165, complete sequence 74986-75015 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181561 Escherichia coli plasmid p14011252, complete sequence 73226-73255 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181562 Escherichia coli plasmid p15090172, complete sequence 72717-72746 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181563 Escherichia coli plasmid p15095941, complete sequence 74739-74768 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181564 Escherichia coli plasmid p15124679, complete sequence 73673-73702 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181565 Escherichia coli plasmid pESBL20140131, complete sequence 76362-76391 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181566 Escherichia coli plasmid p15078279, complete sequence 75622-75651 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181567 Escherichia coli plasmid pESBL20150097, complete sequence 73487-73516 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MK181568 Escherichia coli plasmid pESBL20150178, complete sequence 73469-73498 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 200954-200983 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 75605-75634 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030000 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence 70069-70098 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027333 Escherichia coli strain 2013C-3277 plasmid unnamed2 19685-19714 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MF152729 Escherichia coli plasmid pCTXM1-MU2, complete sequence 75352-75381 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 45503-45532 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024979 Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence 72973-73002 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024980 Escherichia coli strain ESBL-315 plasmid pESBL-315, complete sequence 68476-68505 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP042618 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence 77545-77574 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024975 Escherichia coli strain E17.16 plasmid pE17.16, complete sequence 69715-69744 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024977 Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence 64493-64522 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024978 Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence 78564-78593 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985295 Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII 60082-60111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 78478-78507 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP040548 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence 67406-67435 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019043 Escherichia coli plasmid pND11_107, complete sequence 72529-72558 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019044 Escherichia coli plasmid pND12_96, complete sequence 59093-59122 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 AP017892 Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23 26352-26381 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 AP017893 Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11 26352-26381 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP030839 Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence 58147-58176 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029110 Escherichia coli strain AR436 plasmid unnamed2 23892-23921 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030232 Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence 58020-58049 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052382 Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence 59282-59311 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053867 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence 55802-55831 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053868 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence 55802-55831 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LN735558 Escherichia coli plasmid pC193, complete sequence, strain C193 94492-94521 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LN735559 Escherichia coli plasmid pM105, complete sequence, strain M105 93252-93281 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LN735560 Escherichia coli plasmid pV408, complete sequence, strain V408 84911-84940 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LN735561 Escherichia coli plasmid pC271, complete sequence, strain C271 95315-95344 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024854 Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence 65079-65108 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045519 Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_CMY, complete sequence 68183-68212 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045467 Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence 105881-105910 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP021208 Escherichia coli strain strain Z247 plasmid p2474-3, complete sequence 81865-81894 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_005014 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence 88891-88920 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023290 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dT, complete sequence 78681-78710 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019205 Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence 17020-17049 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP040270 Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence 59278-59307 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985231 Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII 83180-83209 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985321 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pI 87668-87697 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023275 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134, complete sequence 85192-85221 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023276 Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dAT, complete sequence 60902-60931 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP039490 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence 99536-99565 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP031615 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence 39915-39944 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023376 Escherichia coli strain 1283 plasmid p92, complete sequence 60032-60061 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024822 Escherichia coli strain CREC-591 plasmid pCREC-591_1, complete sequence 60519-60548 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024976 Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence 76467-76496 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 60639-60668 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 76869-76898 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024481 Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence 75472-75501 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932026 Escherichia coli plasmid pEC14II_1, complete sequence 85970-85999 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932027 Escherichia coli plasmid pEC14II_2, complete sequence 85788-85817 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932032 Escherichia coli plasmid pEC16I_1, complete sequence 87944-87973 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 KU932033 Escherichia coli plasmid pEC16I_2, complete sequence 88999-89028 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MG516908 Escherichia coli plasmid pEc42, complete sequence 81293-81322 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019954 Escherichia coli M8 plasmid unnamed1, complete sequence 155395-155424 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 87661-87690 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP051745 Escherichia coli strain SCU-484 plasmid pSCU-484-1, complete sequence 50817-50846 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025140 Escherichia coli plasmid pH1519-88, complete sequence 39940-39969 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025142 Escherichia coli plasmid pC60-108, complete sequence 93789-93818 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_025147 Escherichia coli plasmid pV404, complete sequence 69729-69758 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016533 Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence 60044-60073 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024146 Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence 38934-38963 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019123 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence 75720-75749 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019137 Salmonella enterica subsp. enterica serovar Derby plasmid pSD107, complete sequence 76104-76133 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019099 Salmonella enterica plasmid pNF1358, complete sequence 67768-67797 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_032100 Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence 38577-38606 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KJ406378 Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence 59720-59749 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030025 Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence 67483-67512 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP042944 Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35472_2 21568-21597 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_006856 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence 54626-54655 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016516 Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence 67891-67920 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025751 Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence 86325-86354 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_017642 Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence 59083-59112 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP051282 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence 48065-48094 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP014972 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence 65128-65157 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP032495 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence 86283-86312 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024234 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed2 25981-26010 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP047578 Escherichia coli strain 94EC plasmid p94EC-2, complete sequence 104018-104047 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP012936 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence 67892-67921 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019061 Escherichia coli plasmid pPWD4_103, complete sequence 71156-71185 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019097 Escherichia coli plasmid Plm, complete sequence 65407-65436 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023370 Escherichia coli strain 1428 plasmid p96, complete sequence 45634-45663 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023385 Escherichia coli strain 1223 plasmid p87, complete sequence 55390-55419 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP012923 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence 67904-67933 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_011419 Escherichia coli SE11 plasmid pSE11-1, complete sequence 70421-70450 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP042886 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence 58571-58600 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP012929 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence 64935-64964 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP040542 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence 67411-67440 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_002122 Shigella sonnei plasmid P9 DNA, complete sequence 61836-61865 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023382 Escherichia coli strain 127 plasmid p95, complete sequence 60031-60060 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419434 Escherichia coli strain 2016-40-21249 plasmid p21249, complete sequence 27486-27515 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419435 Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence 14010-14039 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN419438 Escherichia coli strain 2016-40-24003 plasmid p24003, complete sequence 106706-106735 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025279 Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence 58269-58298 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053560 Escherichia coli strain EC1 plasmid pEC1, complete sequence 79041-79070 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053677 Escherichia coli strain EC38 plasmid pEC38, complete sequence 73447-73476 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_011081 Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 plasmid pSL476_91, complete sequence 60884-60913 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP023362 Escherichia coli strain 1943 plasmid p85, complete sequence 53479-53508 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 180195-180224 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KT868530 Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence 52978-53007 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP025709 Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized 70626-70655 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP030340 Escherichia coli strain AR_451 plasmid unnamed2 21957-21986 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP015916 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence 26375-26404 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP049876 Salmonella enterica subsp. enterica serovar Adjame strain 388789 plasmid unnamed, complete sequence 75503-75532 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP052880 Escherichia coli strain C21 plasmid pC21-3, complete sequence 56806-56835 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LC480203 Escherichia coli B64 plasmid pB64 DNA, complete sequence 77596-77625 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024251 Escherichia coli O182:H21 strain D181 plasmid unnamed3 23081-23110 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019996 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence 53779-53808 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 128837-128866 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP016585 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-009 plasmid pSH14-009_99, complete sequence 67537-67566 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP043947 Escherichia coli strain AR202.2 plasmid pMPTEM-30, complete sequence 23783-23812 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP031111 Escherichia coli strain AMSCJX02 plasmid pAMSC6, complete sequence 803-832 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 191146-191175 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP019215 Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence 53376-53405 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029837 Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093A, complete sequence 34470-34499 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP024292 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence 61185-61214 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 71810-71839 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP047572 Escherichia coli strain 2EC1 plasmid p2EC1-1, complete sequence 97237-97266 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016522 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence 70617-70646 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 52846-52875 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 114273-114302 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP053328 Salmonella enterica subsp. salamae serovar 60:z10:z39 strain 2011K-1889 plasmid unnamed3, complete sequence 21921-21950 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 75371-75400 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 LC485173 Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence 52322-52351 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_016904 Escherichia coli KO11FL plasmid pEKO1101, complete sequence 54106-54135 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_017665 Escherichia coli W plasmid pRK1, complete sequence 27940-27969 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LN890525 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence 25864-25893 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016865 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence 70157-70186 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053678 Escherichia coli strain EC28 plasmid pEC28, complete sequence 78786-78815 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029842 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence 69871-69900 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP018104 Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence 176424-176453 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP032888 Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence 77242-77271 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_022742 Escherichia coli plasmid pHUSEC2011-1, complete sequence 57110-57139 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_024955 Escherichia coli strain AHC4 plasmid pHNAH4-1, complete sequence 77618-77647 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP043943 Escherichia coli strain AR216.2b plasmid pMPTEM-30, complete sequence 83589-83618 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027415 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence 86347-86376 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 172310-172339 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP029903 Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence 57110-57139 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP050758 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence 56641-56670 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_023915 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome 68077-68106 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP028312 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence 116727-116756 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP054413 Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence 54219-54248 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985248 Escherichia coli strain 720 plasmid RCS48_pI, complete sequence 49461-49490 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP036203 Escherichia coli strain L725 plasmid punnamed1, complete sequence 27836-27865 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP026941 Escherichia coli strain CFS3313 plasmid pCFS3313-2, complete sequence 76948-76977 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP041441 Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence 90036-90065 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985273 Escherichia coli strain 03-235 plasmid RCS72_pI, complete sequence 74082-74111 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985280 Escherichia coli strain 13947 plasmid RCS75_pI, complete sequence 73026-73055 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985286 Escherichia coli strain 13948 plasmid RCS76_pI, complete sequence 74077-74106 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985288 Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence 61277-61306 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985256 Escherichia coli strain 580 plasmid RCS49_p, complete sequence 49641-49670 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985268 Escherichia coli strain 699 plasmid RCS58_p, complete sequence 86263-86292 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_LT985235 Escherichia coli strain 654 plasmid RCS34_p, complete sequence 75418-75447 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH674341 Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence 73518-73547 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MN540570 Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence 21890-21919 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 33352-33381 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP045951 Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_02, complete sequence 62138-62167 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 82300-82329 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN124285 Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence 83110-83139 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP053081 Escherichia coli strain HB37 plasmid pHB37-1, complete sequence 71562-71591 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 201497-201526 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG904995 Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence 92764-92793 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH847038 Escherichia coli strain 04-021 plasmid p04-021, complete sequence 87688-87717 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG948334 Escherichia coli strain 2305 plasmid p2305, complete sequence 75457-75486 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH847571 Escherichia coli strain 17-461F plasmid p17-461F, complete sequence 14828-14857 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH257955 Escherichia coli strain 104 plasmid pHXH-3, complete sequence 78650-78679 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH422553 Escherichia coli strain L-I1 plasmid pIncI1, complete sequence 61549-61578 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 74587-74616 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 79029-79058 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG764547 Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence 80410-80439 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MH472638 Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence 70059-70088 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MN702386 Escherichia coli strain LWY24J plasmid pLWY24J-4, complete sequence 58737-58766 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG948330 Escherichia coli strain 2309 plasmid p2309, complete sequence 58929-58958 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MF344577 Klebsiella pneumoniae strain N201205880 plasmid p205880-NR2, complete sequence 52499-52528 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 74587-74616 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG825376 Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence 66641-66670 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MF344575 Escherichia coli strain 140611011 plasmid p11011-CTXM, complete sequence 102121-102150 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 91819-91848 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG844436 Escherichia coli strain EC13 plasmid pCMY-136, complete sequence 58454-58483 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG545910 Escherichia coli strain EC014 plasmid pEC014, complete sequence 89195-89224 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP016568 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318 plasmid pAMR588-04-00318_99, complete sequence 67891-67920 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_KY964068 Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence 46202-46231 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG948332 Escherichia coli strain 2411 plasmid p2411, complete sequence 58939-58968 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG948333 Escherichia coli strain 2454 plasmid p2454, complete sequence 55822-55851 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_MG948331 Escherichia coli strain 2319 plasmid p2319, complete sequence 58911-58940 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NC_019104 Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A_95, complete sequence 64102-64131 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 81904-81933 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP048361 Escherichia coli strain 53 plasmid p53_B, complete sequence 55907-55936 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN548042 Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence 68248-68277 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 MN816371 Escherichia coli strain A117 plasmid pA117-CTX-M-8, complete sequence 26365-26394 7 0.767
CP031153_2 2.2|2517366|30|CP031153|CRISPRCasFinder 2517366-2517395 30 NZ_CP040536 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence 67406-67435 7 0.767
CP031153_2 2.3|2517442|30|CP031153|CRISPRCasFinder 2517442-2517471 30 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 363605-363634 7 0.767
CP031153_2 2.5|2517594|30|CP031153|CRISPRCasFinder,PILER-CR 2517594-2517623 30 MF417893 Uncultured Caudovirales phage clone 9AX_2, partial genome 942-971 7 0.767
CP031153_2 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR 2517670-2517699 30 NZ_CP035936 Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence 16587-16616 7 0.767
CP031153_2 2.7|2517746|30|CP031153|CRISPRCasFinder,PILER-CR 2517746-2517775 30 NC_019730 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.02, complete sequence 218576-218605 7 0.767
CP031153_2 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR 2517822-2517851 30 MF418016 Bacillus phage vB_BceM-HSE3, complete genome 17829-17858 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 NC_019290 Periwinkle little leaf phytoplasma plasmid pPLLHn-1, complete sequence 1901-1930 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 KF751797 Campylobacter phage CJIE4-5, complete genome 4942-4971 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 KF751794 Campylobacter phage CJIE4-2, complete genome 3052-3081 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 KF751795 Campylobacter phage CJIE4-3, complete genome 3019-3048 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 KF751796 Campylobacter phage CJIE4-4, complete genome 3057-3086 7 0.767
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 KF751793 Campylobacter phage CJIE4-1, complete genome 4495-4524 7 0.767
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 NC_031006 Bacillus phage DIGNKC, complete genome 4319-4348 7 0.767
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MN694132 Marine virus AFVG_250M1196, complete genome 43202-43231 7 0.767
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MF288917 Bacillus phage PPIsBest, complete genome 4372-4401 7 0.767
CP031153_2 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR 2518734-2518763 30 MK288021 Bacillus phage pW2, complete genome 30885-30914 7 0.767
CP031153_2 2.22|2518886|30|CP031153|CRISPRCasFinder,PILER-CR 2518886-2518915 30 NZ_CP032092 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence 11088-11117 7 0.767
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 49586-49615 7 0.767
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1502685-1502714 7 0.767
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 73835-73864 7 0.767
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 258125-258154 7 0.767
CP031153_2 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR 2519190-2519219 30 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 183859-183888 7 0.767
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 MN693558 Marine virus AFVG_25M213, complete genome 2136-2165 7 0.767
CP031153_2 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR 2519610-2519639 30 KY368639 Bacillus phage vB_BsuM-Goe2, complete genome 87083-87112 7 0.767
CP031153_2 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR 2519610-2519639 30 KF669649 Bacillus phage CampHawk, complete genome 87754-87783 7 0.767
CP031153_2 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR 2519610-2519639 30 NC_011421 Bacillus phage SPO1, complete genome 86893-86922 7 0.767
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NZ_CP008900 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-d4a, complete sequence 21483-21512 7 0.767
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NZ_CP043384 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid p1_045001, complete sequence 11356-11385 7 0.767
CP031153_2 2.38|2520142|30|CP031153|CRISPRCasFinder,PILER-CR 2520142-2520171 30 NZ_CP006906 Clostridium baratii str. Sullivan plasmid pCBJ, complete sequence 40140-40169 7 0.767
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448928 Streptococcus phage Javan40, complete genome 31844-31873 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448728 Streptococcus phage Javan3, complete genome 31848-31877 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448776 Streptococcus phage Javan49, complete genome 31670-31699 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448809 Streptococcus phage Javan57, complete genome 31844-31873 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK449007 Streptococcus phage Javan8, complete genome 31656-31685 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448872 Streptococcus phage Javan20, complete genome 31844-31873 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448802 Streptococcus phage Javan55, complete genome 31844-31873 8 0.733
CP031153_2 2.1|2517290|30|CP031153|CRISPRCasFinder 2517290-2517319 30 MK448787 Streptococcus phage Javan51, complete genome 31656-31685 8 0.733
CP031153_2 2.9|2517898|30|CP031153|CRISPRCasFinder,PILER-CR 2517898-2517927 30 NZ_CP018234 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence 104942-104971 8 0.733
CP031153_2 2.9|2517898|30|CP031153|CRISPRCasFinder,PILER-CR 2517898-2517927 30 NZ_CP018234 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence 110822-110851 8 0.733
CP031153_2 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR 2518050-2518079 30 NZ_CP029389 Acinetobacter defluvii strain WCHA30 plasmid p1_010030, complete sequence 27268-27297 8 0.733
CP031153_2 2.13|2518202|30|CP031153|CRISPRCasFinder,PILER-CR 2518202-2518231 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 18720-18749 8 0.733
CP031153_2 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR 2518658-2518687 30 MK415406 Phage FAKO27_000238F, complete genome 8148-8177 8 0.733
CP031153_2 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR 2518734-2518763 30 JN638751 Bacillus phage G, complete genome 239983-240012 8 0.733
CP031153_2 2.24|2519038|30|CP031153|CRISPRCasFinder,PILER-CR 2519038-2519067 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 18720-18749 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 97027-97056 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 242027-242056 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 MK719750 Rheinheimera phage vB_RspM_Barba31A, complete genome 31841-31870 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NC_048190 Rheinheimera phage vB_RspM_Barba19A, complete genome 31829-31858 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 286049-286078 8 0.733
CP031153_2 2.28|2519382|30|CP031153|CRISPRCasFinder 2519382-2519411 30 MN698240 Pelagibacter phage HTVC026P, complete genome 28807-28836 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NZ_CP014487 Bacillus cereus strain FORC021 plasmid unnamed, complete sequence 19450-19479 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NZ_CP041205 Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence 719460-719489 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NC_024985 Lactobacillus plantarum subsp. plantarum strain Zhang-11 plasmid pZL2, complete sequence 856-885 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NC_014919 Lactobacillus brevis strain D11 plasmid pSD11, complete sequence 1438-1467 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 460410-460439 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 NC_012722 Lactobacillus pentosus p1-4 plasmid complete sequence, strain F121-1 2235-2264 8 0.733
CP031153_2 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR 2519990-2520019 30 MN694289 Marine virus AFVG_250M1105, complete genome 22076-22105 8 0.733
CP031153_2 2.38|2520142|30|CP031153|CRISPRCasFinder,PILER-CR 2520142-2520171 30 HQ317390 Colwellia phage 9A, complete genome 53982-54011 8 0.733
CP031153_2 2.41|2520370|30|CP031153|CRISPRCasFinder,PILER-CR 2520370-2520399 30 NC_023605 Vibrio phage PVA1, complete genome 26893-26922 8 0.733
CP031153_2 2.41|2520370|30|CP031153|CRISPRCasFinder,PILER-CR 2520370-2520399 30 MN693961 Marine virus AFVG_250M531, complete genome 40341-40370 8 0.733
CP031153_2 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR 2517822-2517851 30 AP014494 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C46-MedDCM-OCT-S46-C77, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 16083-16112 9 0.7
CP031153_2 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR 2517822-2517851 30 AP014120 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S44-C113, *** SEQUENCING IN PROGRESS *** 1874-1903 9 0.7
CP031153_2 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR 2517822-2517851 30 AP014119 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S41-C69, *** SEQUENCING IN PROGRESS *** 12717-12746 9 0.7
CP031153_2 2.15|2518354|30|CP031153|CRISPRCasFinder,PILER-CR 2518354-2518383 30 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 58230-58259 9 0.7
CP031153_2 2.15|2518354|30|CP031153|CRISPRCasFinder,PILER-CR 2518354-2518383 30 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 77458-77487 9 0.7
CP031153_2 2.17|2518506|30|CP031153|CRISPRCasFinder,PILER-CR 2518506-2518535 30 NZ_CP003425 Serratia sp. SCBI plasmid SCBI_Pl, complete sequence 3613-3642 9 0.7
CP031153_2 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR 2518734-2518763 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 659177-659206 9 0.7
CP031153_2 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR 2518734-2518763 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 650493-650522 9 0.7
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 13354-13383 9 0.7
CP031153_2 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR 2519114-2519143 30 NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 41246-41275 9 0.7
CP031153_2 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR 2520218-2520247 30 NC_013085 Synechococcus phage S-RSM4, complete genome 108507-108536 9 0.7
CP031153_2 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR 2520218-2520247 30 FM207411 Synechococcus phage S-RSM4 complete genome 108507-108536 9 0.7
CP031153_2 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR 2520218-2520247 30 MT774383 CrAssphage cr11_1, complete genome 36400-36429 9 0.7
CP031153_2 2.42|2520446|30|CP031153|CRISPRCasFinder 2520446-2520475 30 MN855948 Bacteriophage sp. isolate 524, complete genome 870-899 9 0.7

1. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MH572290 (Microviridae sp. isolate SD_SC_45, complete genome) position: , mismatch: 4, identity: 0.867

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
tcattattaaaagtaagagtgacaaaacaa	Protospacer
******.*************.******  *

2. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MG945625 (UNVERIFIED: Microviridae sp. isolate 6123-1602, complete genome) position: , mismatch: 4, identity: 0.867

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
tcattattataagtaagagtaacaaacgta	Protospacer
******.** **************** .**

3. spacer 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 5, identity: 0.833

aaacgcgcattaactattgcaaacatccaa	CRISPR spacer
caactcgcattaactattgaaaacatcaat	Protospacer
 *** ************** ******* * 

4. spacer 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 5, identity: 0.833

aaacgcgcattaactattgcaaacatccaa	CRISPR spacer
caactcgcattaactattgaaaacatcaat	Protospacer
 *** ************** ******* * 

5. spacer 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 5, identity: 0.833

aaacgcgcattaactattgcaaacatccaa	CRISPR spacer
caactcgcattaactattgaaaacatcaat	Protospacer
 *** ************** ******* * 

6. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_031024 (Bacillus phage Belinda, complete genome) position: , mismatch: 5, identity: 0.833

tcattact-aaaagtaagagtaacaaaaata	CRISPR spacer
-gataactggaaagtaagagtaacaaaagta	Protospacer
  ** *** .******************.**

7. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 5, identity: 0.833

acaaaataaagtattaattttagtgtatga	CRISPR spacer
ccaaaataaattattaattttagagttaga	Protospacer
 ********* ************ **  **

8. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to LC425521 (Uncultured phage DNA, contig: NODE562) position: , mismatch: 6, identity: 0.8

ctgaca--tattactactactgacatattgac	CRISPR spacer
--gacggttattactactactatcatattgag	Protospacer
  ***.  *************. ******** 

9. spacer 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_MK275620 (Clostridium perfringens strain JXJA17 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.8

agttcaacaatttaaaatcttataacgatg	CRISPR spacer
tgttcaattatttaaaatcttataatcacg	Protospacer
 ******. ****************. *.*

10. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to CP002509 (Bacillus thuringiensis serovar finitimus YBT-020 plasmid pBMB26, complete sequence) position: , mismatch: 6, identity: 0.8

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
ccaccaataaaagtgacagtaacaaaaata	Protospacer
.**..* *******.* *************

11. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 6, identity: 0.8

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
ttagttttaaaactaacagtaacaaaaata	Protospacer
*.* * .***** *** *************

12. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 6, identity: 0.8

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gaataaagcataatgaaacaagaagtttat	Protospacer
.   ************** **.********

13. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 6, identity: 0.8

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gaataaagcataatgaaacaagaagtttat	Protospacer
.   ************** **.********

14. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP017230 (Campylobacter jejuni strain FORC_046 isolate Not reported plasmid pFORC46.1, complete sequence) position: , mismatch: 6, identity: 0.8

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gaataaagcataatgaaacaagaagtttat	Protospacer
.   ************** **.********

15. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_AP018564 (Staphylococcus argenteus strain 58113 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.8

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
tttgaaagcataaggaaagaaaaagcgtaa	Protospacer
 .*********** ***********. ** 

16. spacer 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR matches to CP013734 (Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence) position: , mismatch: 6, identity: 0.8

ttttttgattttgtacccacttacacgcga-	CRISPR spacer
ttttttgattttatactcacttat-tgtgat	Protospacer
************.***.******. .*.** 

17. spacer 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP038864 (Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.8

ttttttgattttgtacccacttacacgcga-	CRISPR spacer
ttttttgattttatactcacttat-tgtgat	Protospacer
************.***.******. .*.** 

18. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NC_019688 (Clostridium perfringens plasmid pNetB-NE10, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
gtaaaataaagtattaaatttagttaatta	Protospacer
..*************** ******  ** *

19. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP025502 (Clostridium perfringens strain EHE-NE18 plasmid pJIR3535, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
gtaaaataaagtattaaatttagttaatta	Protospacer
..*************** ******  ** *

20. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP042495 (Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
agaaatgtaagtattaattttattgtatgt	Protospacer
* ***   ************** ****** 

21. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to MG945874 (UNVERIFIED: Microviridae sp. isolate 125-1801, partial genome) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga-	CRISPR spacer
acaaaataaattattaatttttat-tgtaaa	Protospacer
********** ********** .* *.*.* 

22. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
agaaaataaaatattaattttagataaaga	Protospacer
* ********.************   * **

23. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
agaaatgtaagtattaattttattgtatgt	Protospacer
* ***   ************** ****** 

24. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
agaaatgtaagtattaattttattgtatgt	Protospacer
* ***   ************** ****** 

25. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 6, identity: 0.8

acaaaataaagtattaattttagtgtatga	CRISPR spacer
agaaatgtaagtattaattttattgtatgt	Protospacer
* ***   ************** ****** 

26. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP028168 (Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

27. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG569891 (Shigella sonnei strain DE105 plasmid pDE105, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

28. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

29. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP022456 (Shigella sonnei strain 2015C-3794 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

30. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

31. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KT779550 (Escherichia coli strain 369 plasmid p369, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

32. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

33. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KJ866866 (Escherichia coli strain SKLX3330 plasmid pSKLX3330, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

34. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_020991 (Shigella sonnei 10188 plasmid pKHSB1 complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

35. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

36. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP042631 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

37. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

38. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

39. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024226 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

40. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP049350 (Escherichia coli strain 3R plasmid p3R-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

41. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

42. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

43. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP043738 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

44. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP020511 (Escherichia coli strain 165 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

45. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

46. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

47. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

48. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP021845 (Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

49. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP021845 (Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

50. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP039714 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014853 plasmid p09-3649.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

51. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP012627 (Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

52. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT838199 (Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

53. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

54. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP041621 (Shigella flexneri strain C32 plasmid pC32_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

55. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP015996 (Escherichia coli strain S51 plasmid pS51_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

56. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045189 (Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

57. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

58. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

59. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019248 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

60. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

61. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

62. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014096 (Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

63. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014966 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

64. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP049984 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N40391 plasmid pN40391-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

65. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024230 (Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

66. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP041413 (Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

67. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP015161 (Escherichia coli strain Eco889 plasmid pECO-93a, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

68. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP045527 (Shigella sonnei strain 6607.69 plasmid p6607-69, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

69. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP019691 (Shigella sonnei strain 75/02 plasmid p75-02_3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

70. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

71. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP032264 (Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

72. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

73. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

74. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016387 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

75. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018993 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

76. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LC019731 (Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

77. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP053754 (Shigella sonnei strain 506 plasmid pMHMC-003, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

78. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

79. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP050747 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

80. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

81. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

82. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP035469 (Escherichia coli strain U12A plasmid pU12A_B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

83. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

84. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932029 (Escherichia coli plasmid pEC15I_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

85. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932030 (Escherichia coli plasmid pEC15I_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

86. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025176 (Escherichia coli plasmid pH2291-112, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

87. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023899 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM7, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

88. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023900 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

89. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP010831 (Shigella sonnei strain FORC_011 plasmid pFORC11.2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

90. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

91. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024152 (Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

92. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

93. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025143 (Escherichia coli plasmid pC59-112, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

94. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025144 (Escherichia coli plasmid pC49-108, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

95. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP009566 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

96. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

97. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP049180 (Shigella sonnei strain L4094 plasmid pL4094, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

98. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_014383 (Escherichia coli plasmid pEC_Bactec, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

99. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP049178 (Shigella sonnei strain 1205.3131 plasmid p1205-3131, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

100. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

101. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

102. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_021811 (Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

103. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

104. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

105. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP049176 (Shigella sonnei strain 7111.69 plasmid p7111-69, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

106. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

107. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018946 (Escherichia coli strain Ecol_224 plasmid pEC224_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

108. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018975 (Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

109. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023365 (Escherichia coli strain 144 plasmid p92, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

110. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

111. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP039475 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

112. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419430 (Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

113. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419431 (Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

114. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419432 (Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

115. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419433 (Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

116. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419436 (Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

117. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419437 (Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

118. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP035721 (Escherichia coli strain U15A plasmid pU15A_A, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

119. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

120. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

121. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019207 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004174 plasmid pCFSAN004174, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

122. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP039604 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

123. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

124. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN125610 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.11-3A7 plasmid pIncI1-CTX-M-14, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

125. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

126. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

127. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019173 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004175 plasmid pCFSAN004175, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

128. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023534 (Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

129. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019111 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

130. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027135 (Escherichia coli strain AR_0369 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

131. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MT230324 (Escherichia coli strain DH5alpha plasmid pESBL71, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

132. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029975 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

133. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025339 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

134. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP043228 (Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

135. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH430881 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

136. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH884650 (Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

137. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

138. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

139. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH884654 (Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

140. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

141. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

142. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

143. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019905 (Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

144. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MN241905 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

145. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH430883 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

146. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MK238490 (Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

147. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MK070495 (Escherichia coli strain MB6212 plasmid pMB5876, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

148. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027127 (Escherichia coli strain AR_0374 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

149. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MF078004 (Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

150. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP037994 (Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

151. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP031903 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

152. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

153. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KX246268 (Escherichia coli strain RD174 plasmid pHNRD174, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

154. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KU355874 (Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

155. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

156. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

157. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KX452392 (Escherichia coli strain JB10 plasmid pJB10, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

158. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

159. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025455 (Salmonella enterica subsp. enterica serovar Agona strain USDA-ARS-USMARC-76334 plasmid pSAG-76334, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

160. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KP987217 (Klebsiella pneumoniae strain 628 plasmid p628-CTXM, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

161. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KM409652 (Escherichia coli strain REL5382 plasmid pB15, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

162. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KM377238 (Escherichia coli strain HV114 plasmid pHV114, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

163. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KM377239 (Escherichia coli strain HV292 plasmid pHV292, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

164. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KP198616 (Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

165. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KM377240 (Escherichia coli strain HV295 plasmid pHV295, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

166. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018625 (Escherichia coli strain FORC_044 plasmid pFORC44_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

167. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024918 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

168. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP035009 (Shigella sonnei strain LC1477/18 plasmid pLC1477_18-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

169. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045763 (Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

170. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP028485 (Escherichia coli strain E41-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

171. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP010142 (Escherichia coli strain D3 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

172. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP032445 (Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

173. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014494 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

174. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

175. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

176. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_022267 (Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

177. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

178. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

179. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

180. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014622 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

181. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP039299 (Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

182. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

183. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LS992187 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

184. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053786 (Escherichia coli isolate 2-101 plasmid p2-101, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

185. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045523 (Shigella flexneri strain 5908.2 plasmid p5908-2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

186. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

187. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

188. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053788 (Escherichia coli isolate J31 plasmid pJ31, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

189. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KF290378 (Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

190. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_010119 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

191. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

192. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

193. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_EU418931 (Escherichia coli strain JIE174 plasmid pJIE174, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

194. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_EU418923 (Escherichia coli strain JIE113 plasmid pJIE113, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

195. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_EU418926 (Escherichia coli strain JIE139 plasmid pJIE139, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

196. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP048295 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

197. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_013120 (Escherichia coli plasmid pEK204, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

198. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

199. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP026726 (Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

200. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019252 (Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

201. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP006641 (Escherichia coli PCN061 plasmid PCN061p5, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

202. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

203. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

204. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

205. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP028315 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

206. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

207. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP032524 (Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

208. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

209. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LT985289 (Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

210. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019249 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-4, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

211. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023329 (Escherichia coli strain B3804 plasmid pIFM3804, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

212. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP022064 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

213. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP021841 (Escherichia coli strain EC974 plasmid pEC974-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

214. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016572 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

215. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CM019852 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-2, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

216. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_018659 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

217. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MH579767 (Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

218. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

219. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

220. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP038417 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

221. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014662 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 plasmid pSAN1-2010K-2577, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

222. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP044183 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

223. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

224. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

225. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181557 (Escherichia coli plasmid p14019095, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

226. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181558 (Escherichia coli plasmid p15076331, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

227. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181559 (Escherichia coli plasmid p199, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

228. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181560 (Escherichia coli plasmid p14006165, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

229. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181561 (Escherichia coli plasmid p14011252, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

230. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181562 (Escherichia coli plasmid p15090172, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

231. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181563 (Escherichia coli plasmid p15095941, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

232. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181564 (Escherichia coli plasmid p15124679, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

233. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181565 (Escherichia coli plasmid pESBL20140131, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

234. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181566 (Escherichia coli plasmid p15078279, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

235. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181567 (Escherichia coli plasmid pESBL20150097, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

236. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MK181568 (Escherichia coli plasmid pESBL20150178, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

237. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

238. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

239. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030000 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

240. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027333 (Escherichia coli strain 2013C-3277 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

241. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MF152729 (Escherichia coli plasmid pCTXM1-MU2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

242. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

243. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024979 (Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

244. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024980 (Escherichia coli strain ESBL-315 plasmid pESBL-315, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

245. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

246. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024975 (Escherichia coli strain E17.16 plasmid pE17.16, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

247. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024977 (Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

248. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024978 (Escherichia coli strain ESBL-283 plasmid pESBL-283, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

249. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985295 (Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

250. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

251. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP040548 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

252. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019043 (Escherichia coli plasmid pND11_107, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

253. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019044 (Escherichia coli plasmid pND12_96, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

254. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to AP017892 (Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

255. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to AP017893 (Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

256. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP030839 (Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

257. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029110 (Escherichia coli strain AR436 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

258. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030232 (Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

259. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052382 (Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

260. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053867 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

261. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053868 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

262. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LN735558 (Escherichia coli plasmid pC193, complete sequence, strain C193) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

263. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LN735559 (Escherichia coli plasmid pM105, complete sequence, strain M105) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

264. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LN735560 (Escherichia coli plasmid pV408, complete sequence, strain V408) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

265. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LN735561 (Escherichia coli plasmid pC271, complete sequence, strain C271) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

266. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024854 (Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

267. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045519 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_CMY, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

268. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045467 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

269. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP021208 (Escherichia coli strain strain Z247 plasmid p2474-3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

270. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_005014 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

271. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023290 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dT, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

272. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019205 (Salmonella enterica subsp. enterica serovar Saintpaul strain CFSAN004173 plasmid pCFSAN004173, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

273. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP040270 (Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

274. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985231 (Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

275. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985321 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pI) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

276. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023275 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

277. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023276 (Salmonella enterica subsp. enterica serovar Typhimurium strain 9134 plasmid p9134dAT, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

278. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP039490 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

279. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP031615 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

280. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023376 (Escherichia coli strain 1283 plasmid p92, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

281. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024822 (Escherichia coli strain CREC-591 plasmid pCREC-591_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

282. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024976 (Escherichia coli strain CV839-15 plasmid pCV839-15-p2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

283. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

284. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

285. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024481 (Escherichia coli strain 2011C-4315 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

286. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932026 (Escherichia coli plasmid pEC14II_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

287. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932027 (Escherichia coli plasmid pEC14II_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

288. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932032 (Escherichia coli plasmid pEC16I_1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

289. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to KU932033 (Escherichia coli plasmid pEC16I_2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

290. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MG516908 (Escherichia coli plasmid pEc42, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

291. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019954 (Escherichia coli M8 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

292. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

293. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP051745 (Escherichia coli strain SCU-484 plasmid pSCU-484-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

294. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025140 (Escherichia coli plasmid pH1519-88, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

295. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025142 (Escherichia coli plasmid pC60-108, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

296. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_025147 (Escherichia coli plasmid pV404, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

297. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016533 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

298. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024146 (Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

299. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

300. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019137 (Salmonella enterica subsp. enterica serovar Derby plasmid pSD107, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

301. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019099 (Salmonella enterica plasmid pNF1358, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

302. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_032100 (Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

303. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KJ406378 (Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

304. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030025 (Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

305. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP042944 (Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35472_2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

306. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_006856 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

307. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016516 (Salmonella enterica subsp. enterica serovar Heidelberg strain 11-004736-1-7 plasmid p11-004736-1-7_99, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

308. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

309. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_017642 (Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

310. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP051282 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

311. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP014972 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

312. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

313. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024234 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

314. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP047578 (Escherichia coli strain 94EC plasmid p94EC-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

315. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP012936 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

316. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019061 (Escherichia coli plasmid pPWD4_103, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

317. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019097 (Escherichia coli plasmid Plm, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

318. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023370 (Escherichia coli strain 1428 plasmid p96, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

319. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023385 (Escherichia coli strain 1223 plasmid p87, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

320. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP012923 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

321. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_011419 (Escherichia coli SE11 plasmid pSE11-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

322. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP042886 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

323. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP012929 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

324. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP040542 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

325. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_002122 (Shigella sonnei plasmid P9 DNA, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

326. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023382 (Escherichia coli strain 127 plasmid p95, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

327. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419434 (Escherichia coli strain 2016-40-21249 plasmid p21249, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

328. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419435 (Escherichia coli strain 2016-40-14263 plasmid p14263, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

329. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN419438 (Escherichia coli strain 2016-40-24003 plasmid p24003, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

330. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025279 (Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

331. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053560 (Escherichia coli strain EC1 plasmid pEC1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

332. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053677 (Escherichia coli strain EC38 plasmid pEC38, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

333. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_011081 (Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 plasmid pSL476_91, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

334. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP023362 (Escherichia coli strain 1943 plasmid p85, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

335. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

336. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KT868530 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

337. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP025709 (Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

338. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP030340 (Escherichia coli strain AR_451 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

339. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP015916 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy4, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

340. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP049876 (Salmonella enterica subsp. enterica serovar Adjame strain 388789 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

341. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

342. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LC480203 (Escherichia coli B64 plasmid pB64 DNA, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

343. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024251 (Escherichia coli O182:H21 strain D181 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

344. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019996 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

345. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

346. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP016585 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-009 plasmid pSH14-009_99, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

347. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP043947 (Escherichia coli strain AR202.2 plasmid pMPTEM-30, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

348. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP031111 (Escherichia coli strain AMSCJX02 plasmid pAMSC6, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

349. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

350. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

351. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029837 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093A, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

352. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP024292 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

353. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

354. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP047572 (Escherichia coli strain 2EC1 plasmid p2EC1-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

355. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016522 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

356. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

357. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

358. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP053328 (Salmonella enterica subsp. salamae serovar 60:z10:z39 strain 2011K-1889 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

359. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

360. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to LC485173 (Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

361. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_016904 (Escherichia coli KO11FL plasmid pEKO1101, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

362. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_017665 (Escherichia coli W plasmid pRK1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

363. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

364. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016865 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

365. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053678 (Escherichia coli strain EC28 plasmid pEC28, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

366. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029842 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

367. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP018104 (Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

368. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP032888 (Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

369. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_022742 (Escherichia coli plasmid pHUSEC2011-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

370. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_024955 (Escherichia coli strain AHC4 plasmid pHNAH4-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

371. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP043943 (Escherichia coli strain AR216.2b plasmid pMPTEM-30, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

372. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027415 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

373. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

374. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP029903 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

375. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP050758 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

376. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_023915 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

377. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP028312 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

378. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP054413 (Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

379. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985248 (Escherichia coli strain 720 plasmid RCS48_pI, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

380. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP036203 (Escherichia coli strain L725 plasmid punnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

381. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP026941 (Escherichia coli strain CFS3313 plasmid pCFS3313-2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

382. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP041441 (Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

383. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985273 (Escherichia coli strain 03-235 plasmid RCS72_pI, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

384. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985280 (Escherichia coli strain 13947 plasmid RCS75_pI, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

385. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985286 (Escherichia coli strain 13948 plasmid RCS76_pI, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

386. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985288 (Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

387. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985256 (Escherichia coli strain 580 plasmid RCS49_p, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

388. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

389. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_LT985235 (Escherichia coli strain 654 plasmid RCS34_p, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

390. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH674341 (Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

391. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MN540570 (Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

392. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

393. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP045951 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_02, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

394. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

395. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN124285 (Escherichia coli strain RKI3099 plasmid pRKI3099a, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

396. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP053081 (Escherichia coli strain HB37 plasmid pHB37-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

397. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

398. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG904995 (Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

399. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH847038 (Escherichia coli strain 04-021 plasmid p04-021, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

400. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG948334 (Escherichia coli strain 2305 plasmid p2305, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

401. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH847571 (Escherichia coli strain 17-461F plasmid p17-461F, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

402. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH257955 (Escherichia coli strain 104 plasmid pHXH-3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

403. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH422553 (Escherichia coli strain L-I1 plasmid pIncI1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

404. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

405. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

406. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG764547 (Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

407. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MH472638 (Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

408. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MN702386 (Escherichia coli strain LWY24J plasmid pLWY24J-4, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

409. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG948330 (Escherichia coli strain 2309 plasmid p2309, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

410. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MF344577 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NR2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

411. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

412. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG825376 (Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

413. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MF344575 (Escherichia coli strain 140611011 plasmid p11011-CTXM, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

414. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

415. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG844436 (Escherichia coli strain EC13 plasmid pCMY-136, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

416. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG545910 (Escherichia coli strain EC014 plasmid pEC014, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

417. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP016568 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00318 plasmid pAMR588-04-00318_99, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

418. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_KY964068 (Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

419. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG948332 (Escherichia coli strain 2411 plasmid p2411, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

420. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG948333 (Escherichia coli strain 2454 plasmid p2454, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

421. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_MG948331 (Escherichia coli strain 2319 plasmid p2319, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

422. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NC_019104 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A_95, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

423. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

424. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP048361 (Escherichia coli strain 53 plasmid p53_B, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

425. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN548042 (Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

426. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to MN816371 (Escherichia coli strain A117 plasmid pA117-CTX-M-8, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

427. spacer 2.2|2517366|30|CP031153|CRISPRCasFinder matches to NZ_CP040536 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence) position: , mismatch: 7, identity: 0.767

acatatactgacatatattgatactgacat	CRISPR spacer
ccgtataccggcatatattgatactgcagt	Protospacer
 *.*****.*.***************  .*

428. spacer 2.3|2517442|30|CP031153|CRISPRCasFinder matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 7, identity: 0.767

acatatattgacaaagatactgatactgac	CRISPR spacer
aaagatattgacaaagatattgaaactctt	Protospacer
* * ***************.*** ***  .

429. spacer 2.5|2517594|30|CP031153|CRISPRCasFinder,PILER-CR matches to MF417893 (Uncultured Caudovirales phage clone 9AX_2, partial genome) position: , mismatch: 7, identity: 0.767

aagtcttcataaacattcctaaatacaaaa	CRISPR spacer
acccatccataaatattgctaaatacaaaa	Protospacer
*  . *.******.*** ************

430. spacer 2.6|2517670|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP035936 (Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence) position: , mismatch: 7, identity: 0.767

aaacgcgcattaactattgcaaacatccaa	CRISPR spacer
caacgcgcattaaatattgcaattgaacaa	Protospacer
 ************ ******** ..  ***

431. spacer 2.7|2517746|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_019730 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.02, complete sequence) position: , mismatch: 7, identity: 0.767

--caagtggttttgtttattttccagttactg	CRISPR spacer
gctagaagg--ttgtttattttccaattactg	Protospacer
  .*.. **  **************.******

432. spacer 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR matches to MF418016 (Bacillus phage vB_BceM-HSE3, complete genome) position: , mismatch: 7, identity: 0.767

agttcaacaatttaaaatcttataacgatg	CRISPR spacer
atttcaacaatttaagatctaataattgta	Protospacer
* *************.**** ****. .*.

433. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_019290 (Periwinkle little leaf phytoplasma plasmid pPLLHn-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
aatttattaaaaattgatttcaatttttaa	Protospacer
  *******.**************  *  *

434. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF751797 (Campylobacter phage CJIE4-5, complete genome) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
gatagaatagaaaatgatatcaatgatgca	Protospacer
  *  * ****** **** ***********

435. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
gatagaatagaaaatgatatcaatgatgca	Protospacer
  *  * ****** **** ***********

436. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
gatagaatagaaaatgatatcaatgatgca	Protospacer
  *  * ****** **** ***********

437. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
gatagaatagaaaatgatatcaatgatgca	Protospacer
  *  * ****** **** ***********

438. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF751793 (Campylobacter phage CJIE4-1, complete genome) position: , mismatch: 7, identity: 0.767

cctttattagaaattgatttcaatgatgca	CRISPR spacer
gatagaatagaaaatgatatcaatgatgca	Protospacer
  *  * ****** **** ***********

439. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_031006 (Bacillus phage DIGNKC, complete genome) position: , mismatch: 7, identity: 0.767

tcattacta-----aaagtaagagtaacaaaaata	CRISPR spacer
-----gctaactggaaagtaagagtaacaaaagta	Protospacer
     .***     ******************.**

440. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MN694132 (Marine virus AFVG_250M1196, complete genome) position: , mismatch: 7, identity: 0.767

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
agaataccaaaagtaagtgtaacaaaagtt	Protospacer
  * ***.********* *********.* 

441. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MF288917 (Bacillus phage PPIsBest, complete genome) position: , mismatch: 7, identity: 0.767

tcattacta-----aaagtaagagtaacaaaaata	CRISPR spacer
-----gctaactggaaagtaagagtaacaaaagta	Protospacer
     .***     ******************.**

442. spacer 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR matches to MK288021 (Bacillus phage pW2, complete genome) position: , mismatch: 7, identity: 0.767

tctttattagcaatggaatcaatgtgtttt	CRISPR spacer
cgtgagttagcaatggaatcaatgaatttt	Protospacer
. *  .****************** .****

443. spacer 2.22|2518886|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP032092 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

attcgcgtataatgtcacaaattcaaatta	CRISPR spacer
cttcgcgtttactgtcacaaattcagtcaa	Protospacer
 ******* ** *************. . *

444. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.767

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
aagaatagcataataaaagaataagtttag	Protospacer
*  .* ********.****** ******* 

445. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 7, identity: 0.767

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gctgaaagtttaatgaaagaaaaatctaag	Protospacer
.*******. ************** .* * 

446. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 7, identity: 0.767

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gctgaaagtttaatgaaagaaaaatctaag	Protospacer
.*******. ************** .* * 

447. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 7, identity: 0.767

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gctgaaagtttaatgaaagaaaaatctaag	Protospacer
.*******. ************** .* * 

448. spacer 2.26|2519190|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 7, identity: 0.767

ttttttgattttgtacccacttacacgcga	CRISPR spacer
tgttttgattatgaacccacttacacaacg	Protospacer
* ******** ** ************.  .

449. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to MN693558 (Marine virus AFVG_25M213, complete genome) position: , mismatch: 7, identity: 0.767

acaaaataaagtattaattttagtgtatga	CRISPR spacer
acaaaataaattattaatttttcttttttt	Protospacer
********** **********  * * *  

450. spacer 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 7, identity: 0.767

agttggttccaacatacattcatgtagaaa	CRISPR spacer
acaaacttccaacaggcattcatgtagaaa	Protospacer
*   . ******** .**************

451. spacer 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 7, identity: 0.767

agttggttccaacatacattcatgtagaaa	CRISPR spacer
acaaacttccaacaggcattcatgtagaaa	Protospacer
*   . ******** .**************

452. spacer 2.31|2519610|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 7, identity: 0.767

agttggttccaacatacattcatgtagaaa	CRISPR spacer
acaaacttccaacaggcattcatgtagaaa	Protospacer
*   . ******** .**************

453. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP008900 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-d4a, complete sequence) position: , mismatch: 7, identity: 0.767

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
tacggaatgcaattaaaagacgctgaagaa	Protospacer
 ..*.*****************.****. *

454. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP043384 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid p1_045001, complete sequence) position: , mismatch: 7, identity: 0.767

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
tacggaatgcaattaaaagacgctgaagaa	Protospacer
 ..*.*****************.****. *

455. spacer 2.38|2520142|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP006906 (Clostridium baratii str. Sullivan plasmid pCBJ, complete sequence) position: , mismatch: 7, identity: 0.767

ctttctatttgaaaataataacctctttgc	CRISPR spacer
tgttccatttgaaaataataatctcttatt	Protospacer
. ***.***************.*****  .

456. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448928 (Streptococcus phage Javan40, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

457. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448728 (Streptococcus phage Javan3, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

458. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448776 (Streptococcus phage Javan49, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

459. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448809 (Streptococcus phage Javan57, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

460. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK449007 (Streptococcus phage Javan8, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

461. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448872 (Streptococcus phage Javan20, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

462. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448802 (Streptococcus phage Javan55, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

463. spacer 2.1|2517290|30|CP031153|CRISPRCasFinder matches to MK448787 (Streptococcus phage Javan51, complete genome) position: , mismatch: 8, identity: 0.733

ctgacatattactactactgacatattgac	CRISPR spacer
gtccgttattactactagtgacattttgaa	Protospacer
 *    *********** ****** **** 

464. spacer 2.9|2517898|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP018234 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatcgttgttgctccaattgccgctatt	CRISPR spacer
ttgatcgttgtagcaccaattgcggtacgg	Protospacer
*********** ** ******** *.    

465. spacer 2.9|2517898|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP018234 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatcgttgttgctccaattgccgctatt	CRISPR spacer
ttgatcgttgtagcaccaattgcggtacgg	Protospacer
*********** ** ******** *.    

466. spacer 2.11|2518050|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP029389 (Acinetobacter defluvii strain WCHA30 plasmid p1_010030, complete sequence) position: , mismatch: 8, identity: 0.733

cctttattagaaattgatttcaatgatgca	CRISPR spacer
cctttattagaaagtgagttcaaacgccta	Protospacer
************* *** *****  .. .*

467. spacer 2.13|2518202|30|CP031153|CRISPRCasFinder,PILER-CR matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 8, identity: 0.733

cgccaataccgcattaactacttcattaga	CRISPR spacer
aacgaataccgcattaactacgtcaattag	Protospacer
 .* ***************** *** * ..

468. spacer 2.19|2518658|30|CP031153|CRISPRCasFinder,PILER-CR matches to MK415406 (Phage FAKO27_000238F, complete genome) position: , mismatch: 8, identity: 0.733

tcattactaaaagtaagagtaacaaaaata	CRISPR spacer
aagagaataagagtaagagtaacaacaata	Protospacer
  .  * ***.************** ****

469. spacer 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733

tctttattagcaatggaatcaatgtgtttt	CRISPR spacer
actttattagcaatgcaatcaaatgatact	Protospacer
 ************** ******   .* .*

470. spacer 2.24|2519038|30|CP031153|CRISPRCasFinder,PILER-CR matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 8, identity: 0.733

cgccaataccgcattaactacttcattaga	CRISPR spacer
aacgaataccgcattaactacgtcaattag	Protospacer
 .* ***************** *** * ..

471. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
acaaaataaagtatttattttatttggaat	Protospacer
*************** ****** *  . . 

472. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
taaaaataaaatattaatttttgtgttgtg	Protospacer
  ********.********** ****   .

473. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
atcaagtaaagtattaattgtagtgttgct	Protospacer
*. **.************* ******    

474. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NC_048190 (Rheinheimera phage vB_RspM_Barba19A, complete genome) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
atcaagtaaagtattaattgtagtgttgct	Protospacer
*. **.************* ******    

475. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
tttaaataaattattaattttagtagttaa	Protospacer
 . ******* *************.  *.*

476. spacer 2.28|2519382|30|CP031153|CRISPRCasFinder matches to MN698240 (Pelagibacter phage HTVC026P, complete genome) position: , mismatch: 8, identity: 0.733

acaaaataaagtattaattttagtgtatga	CRISPR spacer
ttcaaataaaatattaattttagttgattt	Protospacer
 . *******.*************  **  

477. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP014487 (Bacillus cereus strain FORC021 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
ggtgaaatgaaattgaaagacgttgctgct	Protospacer
.******** ****.**********  .. 

478. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
ccggaaatgcaattaaaaaacgtcgatttc	Protospacer
   ***************.****.**  * 

479. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_024985 (Lactobacillus plantarum subsp. plantarum strain Zhang-11 plasmid pZL2, complete sequence) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
aagcagttgcaattagaagacgttgaaaat	Protospacer
*.  *. ********.************  

480. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_014919 (Lactobacillus brevis strain D11 plasmid pSD11, complete sequence) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
aagcagttgcaattagaagacgttgaaaat	Protospacer
*.  *. ********.************  

481. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
ccggaaatgcaattaaaaaacgtcgatttc	Protospacer
   ***************.****.**  * 

482. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_012722 (Lactobacillus pentosus p1-4 plasmid complete sequence, strain F121-1) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
aagcagttgcaattagaagacgttgaaaat	Protospacer
*.  *. ********.************  

483. spacer 2.36|2519990|30|CP031153|CRISPRCasFinder,PILER-CR matches to MN694289 (Marine virus AFVG_250M1105, complete genome) position: , mismatch: 8, identity: 0.733

agtgaaatgcaattaaaagacgttgaaata	CRISPR spacer
acctcaaagcaattaaaaggcgttgaaaag	Protospacer
* .  ** ***********.******** .

484. spacer 2.38|2520142|30|CP031153|CRISPRCasFinder,PILER-CR matches to HQ317390 (Colwellia phage 9A, complete genome) position: , mismatch: 8, identity: 0.733

ctttctatttgaaaataataacctctttgc	CRISPR spacer
agatcgtgatgaaaataataacctcttagc	Protospacer
   **    ****************** **

485. spacer 2.41|2520370|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_023605 (Vibrio phage PVA1, complete genome) position: , mismatch: 8, identity: 0.733

tttgctatagcgttatttgcaattctgtca	CRISPR spacer
ccgtttataacgttatttgcaattcttgca	Protospacer
..  .****.****************  **

486. spacer 2.41|2520370|30|CP031153|CRISPRCasFinder,PILER-CR matches to MN693961 (Marine virus AFVG_250M531, complete genome) position: , mismatch: 8, identity: 0.733

tttgctatagcgttatttgcaattctgtca	CRISPR spacer
tttgctatagcgatagttgcaatggctata	Protospacer
************ ** *******  .  .*

487. spacer 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR matches to AP014494 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C46-MedDCM-OCT-S46-C77, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 9, identity: 0.7

agttcaacaatttaaaatcttataacgatg	CRISPR spacer
cagacaataatttaaaattttataacggaa	Protospacer
 .  ***.**********.********. .

488. spacer 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR matches to AP014120 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S44-C113, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

agttcaacaatttaaaatcttataacgatg	CRISPR spacer
cagacaataatttaaaattttataacggaa	Protospacer
 .  ***.**********.********. .

489. spacer 2.8|2517822|30|CP031153|CRISPRCasFinder,PILER-CR matches to AP014119 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S41-C69, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

agttcaacaatttaaaatcttataacgatg	CRISPR spacer
cagacaataatttaaaattttataacggaa	Protospacer
 .  ***.**********.********. .

490. spacer 2.15|2518354|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aagtaaatgtcagaggtttttgcttacgga	CRISPR spacer
gtaggatcgtcagaggtttttgcttatggt	Protospacer
. . .* .******************.** 

491. spacer 2.15|2518354|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

aagtaaatgtcagaggtttttgcttacgga	CRISPR spacer
gtaggatcgtcagaggtttttgcttatggt	Protospacer
. . .* .******************.** 

492. spacer 2.17|2518506|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP003425 (Serratia sp. SCBI plasmid SCBI_Pl, complete sequence) position: , mismatch: 9, identity: 0.7

taaaggatttagaatggttttcaattgctt	CRISPR spacer
aaaaggatttagcatgtttttcaaaaagaa	Protospacer
 *********** *** *******  .   

493. spacer 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.7

tctttattagcaatggaatcaatgtgtttt	CRISPR spacer
tgaaaatcagcaatggaatcaatgtggccg	Protospacer
*    **.****************** .. 

494. spacer 2.20|2518734|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.7

tctttattagcaatggaatcaatgtgtttt	CRISPR spacer
tgaaaatcagcaatggaatcaatgtggccg	Protospacer
*    **.****************** .. 

495. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 9, identity: 0.7

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gaataaagcataatgaaacaagaagttata	Protospacer
.   ************** **.*****   

496. spacer 2.25|2519114|30|CP031153|CRISPRCasFinder,PILER-CR matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 9, identity: 0.7

actgaaagcataatgaaagaaaaagtttat	CRISPR spacer
gaataaagcataatgaaacaagaagttata	Protospacer
.   ************** **.*****   

497. spacer 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 9, identity: 0.7

tatcatcttcagatttagtaccagcgatgt	CRISPR spacer
ctacatcttcagatttagtaacagtttcga	Protospacer
.  ***************** ***.  .* 

498. spacer 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 9, identity: 0.7

tatcatcttcagatttagtaccagcgatgt	CRISPR spacer
ctacatcttcagatttagtaacagtttcga	Protospacer
.  ***************** ***.  .* 

499. spacer 2.39|2520218|30|CP031153|CRISPRCasFinder,PILER-CR matches to MT774383 (CrAssphage cr11_1, complete genome) position: , mismatch: 9, identity: 0.7

tatcatcttcagatttagtaccagcgatgt	CRISPR spacer
tatcatattcagatttagtacgtttaacaa	Protospacer
****** **************   ..*.. 

500. spacer 2.42|2520446|30|CP031153|CRISPRCasFinder matches to MN855948 (Bacteriophage sp. isolate 524, complete genome) position: , mismatch: 9, identity: 0.7

tctacgatgattattgaaatgataactccc	CRISPR spacer
aattaaatgattattgaaatgttaactggt	Protospacer
  *  .*************** *****  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1088696 : 1099082 9 Ralstonia_phage(16.67%) NA NA
DBSCAN-SWA_2 1303226 : 1312543 9 Sphingomonas_phage(14.29%) NA NA
DBSCAN-SWA_3 4321726 : 4354496 25 Arthrobacter_phage(28.57%) protease,plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage