1. spacer 6.35|1928058|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 4, identity: 0.867
ttacggtcaaagtaagcaattcgattcagc CRISPR spacer
ttacggtcaatgtaagcaattcgagcaagc Protospacer
********** ************* . ***
2. spacer 5.1|1712813|27|CP027806|CRISPRCasFinder matches to NZ_CP026273 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-ea2b, complete sequence) position: , mismatch: 5, identity: 0.815
atagcgggtcggcgtttgtttttgcta CRISPR spacer
ttagcgagtcggcgtttgtgtttgtaa Protospacer
*****.************ ****. *
3. spacer 5.1|1712813|27|CP027806|CRISPRCasFinder matches to MN694262 (Marine virus AFVG_250M733, complete genome) position: , mismatch: 6, identity: 0.778
atagcgggtcggcgtttgtttttgcta CRISPR spacer
gaagcgggtcggcgtttgttctggccc Protospacer
. ******************.* **.
4. spacer 6.37|1928190|30|CP027806|CRISPRCasFinder,CRT matches to MT601270 (Bacillus phage vB_BsuM-Goe9, complete genome) position: , mismatch: 6, identity: 0.8
aagggattgataaagcccgcagatgtttta CRISPR spacer
caaggattgataaagcccgcagatgaaaaa Protospacer
*.********************** *
5. spacer 6.37|1928190|30|CP027806|CRISPRCasFinder,CRT matches to MT601271 (Bacillus phage vB_BsuM-Goe10, complete genome) position: , mismatch: 6, identity: 0.8
aagggattgataaagcccgcagatgtttta CRISPR spacer
caaggattgataaagcccgcagatgaaaaa Protospacer
*.********************** *
6. spacer 6.37|1928190|30|CP027806|CRISPRCasFinder,CRT matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 6, identity: 0.8
aagggattgataaagcccgcagatgtttta CRISPR spacer
caaggattgataaagcccgcagatgaaaaa Protospacer
*.********************** *
7. spacer 6.37|1928190|30|CP027806|CRISPRCasFinder,CRT matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 6, identity: 0.8
aagggattgataaagcccgcagatgtttta CRISPR spacer
caaggattgataaagcccgcagatgaaaaa Protospacer
*.********************** *
8. spacer 6.37|1928190|30|CP027806|CRISPRCasFinder,CRT matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 6, identity: 0.8
aagggattgataaagcccgcagatgtttta CRISPR spacer
caaggattgataaagcccgcagatgaaaaa Protospacer
*.********************** *
9. spacer 6.46|1928784|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MN695335 (Synechococcus phage B23, complete genome) position: , mismatch: 6, identity: 0.8
--cggttaaaaatgttcaccacacaatacaat CRISPR spacer
atcattt--aaatgttcaccaaacaatacaac Protospacer
*. ** ************ *********.
10. spacer 6.46|1928784|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MN695334 (Synechococcus phage B3, complete genome) position: , mismatch: 6, identity: 0.8
--cggttaaaaatgttcaccacacaatacaat CRISPR spacer
atcattt--aaatgttcaccaaacaatacaac Protospacer
*. ** ************ *********.
11. spacer 6.47|1928850|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
gcagcgcataaaatggggtttgattttacc CRISPR spacer
gcagcgcaaaaaatggtgtttgatggtgca Protospacer
******** ******* ******* *.*
12. spacer 6.2|1925881|30|CP027806|CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
catatcaaaatgagcgagaacaaaaccaca CRISPR spacer
ctgtccaaaatcagcgacaacaaaaccata Protospacer
* .****** ***** **********.*
13. spacer 6.12|1926541|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MK562505 (Shigella phage Silverhawkium, complete genome) position: , mismatch: 7, identity: 0.767
ttctaagattgagaagcaaattgatgacct CRISPR spacer
taaaaagattgataagcaaattgatgaaga Protospacer
* ******** **************
14. spacer 6.12|1926541|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MF158040 (Shigella phage Sf13, complete genome) position: , mismatch: 7, identity: 0.767
ttctaagattgagaagcaaattgatgacct CRISPR spacer
taaaaagattgataagcaaattgatgaaga Protospacer
* ******** **************
15. spacer 6.13|1926607|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018442 (Undibacterium sp. YM2 plasmid pUYM01, complete sequence) position: , mismatch: 7, identity: 0.767
gttgacatggcattgcgcaaatactttaac CRISPR spacer
catgacatggctttgcgccaatacttgatt Protospacer
********* ****** ******* * .
16. spacer 6.16|1926805|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_009705 (Yersinia pseudotuberculosis IP 31758 plasmid p_153kb, complete sequence) position: , mismatch: 7, identity: 0.767
cacaaactcagacgcaaaatggtgggcttg CRISPR spacer
cttatcgtcaggcgcaaaatggggggcttg Protospacer
* .* ****.********** *******
17. spacer 6.21|1927135|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MK562505 (Shigella phage Silverhawkium, complete genome) position: , mismatch: 7, identity: 0.767
ttctaagattgagaagcaaattgatgacct CRISPR spacer
taaaaagattgataagcaaattgatgaaga Protospacer
* ******** **************
18. spacer 6.21|1927135|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MF158040 (Shigella phage Sf13, complete genome) position: , mismatch: 7, identity: 0.767
ttctaagattgagaagcaaattgatgacct CRISPR spacer
taaaaagattgataagcaaattgatgaaga Protospacer
* ******** **************
19. spacer 6.38|1928256|30|CP027806|CRISPRCasFinder,CRT matches to NZ_CP029775 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaggtggtgttgtggacgcagacatcctc CRISPR spacer
gaaagtggtgatgtggacgcagaaacgggc Protospacer
***.****** ************ *. *
20. spacer 6.40|1928388|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
aattatcagcgaggagcaagcccgcgcaaa CRISPR spacer
gagcatcagcgaggagtacgcccgcgccga Protospacer
.* .************.* ******** .*
21. spacer 6.40|1928388|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
aattatcagcgaggagcaagcccgcgcaaa CRISPR spacer
gagcatcagcgaggagtacgcccgcgccga Protospacer
.* .************.* ******** .*
22. spacer 6.41|1928454|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
caaccgcatattcgatcaggtcgaagatgc CRISPR spacer
gcacgccggattcgatcaggtcgaggatgc Protospacer
** *. ***************.*****
23. spacer 6.41|1928454|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 7, identity: 0.767
caaccgcatattcgatcaggtcgaagatgc CRISPR spacer
cgcgcgcataggcgatcaggtcgaagacga Protospacer
*. ****** ***************.*
24. spacer 6.45|1928718|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
aaattgattgatgaatcaaagctgaaaaaa CRISPR spacer
cagaaaattgatgaatctaagctgaaagaa Protospacer
*. .*********** *********.**
25. spacer 6.1|1925815|30|CP027806|CRISPRCasFinder,CRT matches to MH595538 (Vibrio phage BONAISHI, complete genome) position: , mismatch: 8, identity: 0.733
tggctgcccgcctgaccacgattgcacaga CRISPR spacer
agcaaaaccgactgatcacgattgcacaga Protospacer
* . *** ****.**************
26. spacer 6.2|1925881|30|CP027806|CRISPRCasFinder,CRT matches to MN694112 (Marine virus AFVG_250M84, complete genome) position: , mismatch: 8, identity: 0.733
catatcaaaatgagcgagaacaaaaccaca CRISPR spacer
ggtatcaaaatgagcgagagtaaaattgga Protospacer
.*****************..****... *
27. spacer 6.10|1926409|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.733
gcataaagcaatttatcgcggtcactccta CRISPR spacer
cgaacaagcaatttatcgcggccaatccgg Protospacer
* ****************.** *** .
28. spacer 6.10|1926409|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.733
gcataaagcaatttatcgcggtcactccta CRISPR spacer
cgaacaagcaatttatcgcggccaatccgg Protospacer
* ****************.** *** .
29. spacer 6.11|1926475|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tcgccctccccggcatgtgcaggaatagcg CRISPR spacer
ccgccctccccggcccgtgcaggatgcgtc Protospacer
.************* .******** *.
30. spacer 6.11|1926475|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MT889377 (Microbacterium phage Zayuliv, complete genome) position: , mismatch: 8, identity: 0.733
tcgccctccccggcatgtgcaggaatagcg CRISPR spacer
acgccttccccggcatgagcaggatggccc Protospacer
****.*********** ****** . *
31. spacer 6.12|1926541|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032366 (Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttctaagattgagaagcaaattgatgacct CRISPR spacer
agagaagattaagaagcaaattgatgatta Protospacer
******.****************..
32. spacer 6.12|1926541|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to AP014503 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C30, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.733
ttctaagattgagaagcaaattgatgacct CRISPR spacer
ctataatattgagatgcaaattgatgtaac Protospacer
.* *** ******* *********** .
33. spacer 6.20|1927069|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tcgccctccccggcatgtgcaggaatagcg CRISPR spacer
ccgccctccccggcccgtgcaggatgcgtc Protospacer
.************* .******** *.
34. spacer 6.20|1927069|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MT889377 (Microbacterium phage Zayuliv, complete genome) position: , mismatch: 8, identity: 0.733
tcgccctccccggcatgtgcaggaatagcg CRISPR spacer
acgccttccccggcatgagcaggatggccc Protospacer
****.*********** ****** . *
35. spacer 6.21|1927135|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032366 (Bacillus wiedmannii strain SR52 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttctaagattgagaagcaaattgatgacct CRISPR spacer
agagaagattaagaagcaaattgatgatta Protospacer
******.****************..
36. spacer 6.21|1927135|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to AP014503 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C30, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.733
ttctaagattgagaagcaaattgatgacct CRISPR spacer
ctataatattgagatgcaaattgatgtaac Protospacer
.* *** ******* *********** .
37. spacer 6.26|1927465|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.733
aagcggcttgtcttcctgctcatacttcag CRISPR spacer
gagcggcttgtcgtccagctcataaagcgc Protospacer
.*********** *** ******* *.
38. spacer 6.27|1927531|29|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to KT997860 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C269, complete genome) position: , mismatch: 8, identity: 0.724
acttcttagtatatgtatatcactgttag CRISPR spacer
gcttcctagtatatgtatatcagctacat Protospacer
.****.**************** . .*
39. spacer 6.34|1927992|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039693 (Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence) position: , mismatch: 8, identity: 0.733
agcatgaacggcgttgacatggcattggtc CRISPR spacer
ttctcgatcgccgttgacatggcattggct Protospacer
* .** ** *****************..
40. spacer 6.38|1928256|30|CP027806|CRISPRCasFinder,CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 8, identity: 0.733
gaaggtggtgttgtggacgcagacatcctc CRISPR spacer
ttccttggtgatgtggacgaagacatcctt Protospacer
***** ******** *********.
41. spacer 6.38|1928256|30|CP027806|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaggtggtgttgtggacgcagacatcctc CRISPR spacer
gcgcatggtggtgtgcacgcagacatccgt Protospacer
* . .***** **** ************ .
42. spacer 6.40|1928388|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 8, identity: 0.733
aattatcagcgaggagcaagcccgcgcaaa CRISPR spacer
cgacatcagcgaggaccaggcccgcgccta Protospacer
. .*********** **.******** *
43. spacer 6.40|1928388|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 8, identity: 0.733
aattatcagcgaggagcaagcccgcgcaaa CRISPR spacer
cgacatcagcgaggaccaggcccgcgccta Protospacer
. .*********** **.******** *
44. spacer 6.41|1928454|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 8, identity: 0.733
caaccgcatattcgatcaggtcgaagatgc CRISPR spacer
ggctcgcattttcgagcaggtcgaagacac Protospacer
. .***** ***** ***********..*
45. spacer 6.44|1928652|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 8, identity: 0.733
ttcgacatccccgcacatgctggggagggc CRISPR spacer
cggttcatccccgcacatgcggggaaggga Protospacer
. *************** ***.****
46. spacer 6.45|1928718|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to AP018277 (Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome) position: , mismatch: 8, identity: 0.733
aaattgattgatgaatcaaagctgaaaaaa CRISPR spacer
tctcgaattgatgaagcaaagcttaaaaaa Protospacer
. .********* ******* ******
47. spacer 6.47|1928850|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015632 (Borrelia turicatae strain BTE5EL plasmid lp30) position: , mismatch: 8, identity: 0.733
-gcagcgcataaaatggggtttgattttacc CRISPR spacer
ttctatg-ataaaatggggtttgtttttata Protospacer
* ..* *************** *****.
48. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
49. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
50. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
51. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
52. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
53. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
54. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
55. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
56. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
57. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
58. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atctgccgaggacgggcgcgatttcttcaa Protospacer
.* .************** ******. .
59. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
60. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
61. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
62. spacer 6.8|1926277|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
cgggtcggcttctgaagcgattgagtacgt CRISPR spacer
cgggtcggcttctgaggcgatatgcctgat Protospacer
***************.***** . . .*
63. spacer 6.8|1926277|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
cgggtcggcttctgaagcgattgagtacgt CRISPR spacer
cgggtcggcttctgaggcgatatgcctgat Protospacer
***************.***** . . .*
64. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
65. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
66. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
67. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
68. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
69. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
70. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
71. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
72. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
73. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
74. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atctgccgaggacgggcgcgatttcttcaa Protospacer
.* .************** ******. .
75. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
76. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
77. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.7
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
ttcggccgaggacgggcgcgatttcttcga Protospacer
* . .************** ******. .
78. spacer 6.33|1927926|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 9, identity: 0.7
taccactcagcgttgaagcgttcgggccac CRISPR spacer
cgaaactcagtgttgaagcgttcgagctcg Protospacer
.. ******.*************.**.
79. spacer 6.40|1928388|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to MK686069 (Streptomyces phage Heather, complete genome) position: , mismatch: 9, identity: 0.7
aattatcagcgaggagcaagcccgcgcaaa CRISPR spacer
cttgggcagcgaggagcaaacccgcgcgtg Protospacer
* . *************.*******. .
80. spacer 6.41|1928454|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.7
caaccgcatattcgatcaggtcgaagatgc CRISPR spacer
ggaccgcaaattcgatcaggtcgggagcga Protospacer
.****** **************.....*
81. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.667
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atcggccgaggacgggcgcgatttcttcaa Protospacer
. .************** ******. .
82. spacer 6.6|1926145|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.667
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atcggccgaggacgggcgcgatttcttcaa Protospacer
. .************** ******. .
83. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.667
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atcggccgaggacgggcgcgatttcttcaa Protospacer
. .************** ******. .
84. spacer 6.31|1927794|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.667
tattctcgaggacgggcgcgctttctttcg CRISPR spacer
atcggccgaggacgggcgcgatttcttcaa Protospacer
. .************** ******. .
85. spacer 6.47|1928850|30|CP027806|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028874 (Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence) position: , mismatch: 10, identity: 0.667
gcagcgcataaaatggggtttgattttacc CRISPR spacer
ttctaatataaaatggggtttgtttttata Protospacer
. ..*************** *****.
