Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022901 Staphylococcus aureus strain 466 chromosome, complete genome 10 crisprs csa3,cas3,DEDDh,DinG,WYL 5 0 8 0

Results visualization

1. CP022901
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_1 806580-806664 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_2 864984-865063 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_3 914104-914189 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_4 1215354-1215446 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_5 1938258-1938385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_6 2021570-2021761 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_7 2088351-2088439 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_8 2238138-2238339 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_9 2296671-2296796 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022901_10 2336678-2336758 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022901_1 1.1|806606|33|CP022901|CRISPRCasFinder 806606-806638 33 CP022901.1 1039941-1039973 1 0.97
CP022901_1 1.1|806606|33|CP022901|CRISPRCasFinder 806606-806638 33 CP022901.1 2372004-2372036 1 0.97
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 1066219-1066249 1 0.968
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 1640329-1640359 1 0.968
CP022901_3 3.1|914134|26|CP022901|CRISPRCasFinder 914134-914159 26 CP022901.1 2112392-2112417 2 0.923
CP022901_3 3.1|914134|26|CP022901|CRISPRCasFinder 914134-914159 26 CP022901.1 2172476-2172501 2 0.923
CP022901_6 6.1|2021591|37|CP022901|CRT 2021591-2021627 37 CP022901.1 819872-819908 2 0.946
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 257684-257717 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 334357-334390 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 773441-773474 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 806645-806678 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 1066156-1066189 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 1760241-1760274 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 2336642-2336675 2 0.941
CP022901_6 6.2|2021649|34|CP022901|CRT 2021649-2021682 34 CP022901.1 2479636-2479669 2 0.941
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 819996-820026 2 0.935
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 869265-869295 2 0.935
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 914095-914125 2 0.935
CP022901_10 10.1|2336703|31|CP022901|CRISPRCasFinder 2336703-2336733 31 CP022901.1 2011033-2011063 2 0.935

1. spacer 1.1|806606|33|CP022901|CRISPRCasFinder matches to position: 1039941-1039973, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 1.1|806606|33|CP022901|CRISPRCasFinder matches to position: 2372004-2372036, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 1066219-1066249, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

4. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 1640329-1640359, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

5. spacer 3.1|914134|26|CP022901|CRISPRCasFinder matches to position: 2112392-2112417, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

6. spacer 3.1|914134|26|CP022901|CRISPRCasFinder matches to position: 2172476-2172501, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

7. spacer 6.1|2021591|37|CP022901|CRT matches to position: 819872-819908, mismatch: 2, identity: 0.946

ccaacttgcacattattgtaagctgacagaaagtcag	CRISPR spacer
ccaacttgcacattattgtaagctggcggaaagtcag	Protospacer
*************************.*.*********

8. spacer 6.2|2021649|34|CP022901|CRT matches to position: 257684-257717, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

9. spacer 6.2|2021649|34|CP022901|CRT matches to position: 334357-334390, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

10. spacer 6.2|2021649|34|CP022901|CRT matches to position: 773441-773474, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

11. spacer 6.2|2021649|34|CP022901|CRT matches to position: 806645-806678, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

12. spacer 6.2|2021649|34|CP022901|CRT matches to position: 1066156-1066189, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

13. spacer 6.2|2021649|34|CP022901|CRT matches to position: 1760241-1760274, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 6.2|2021649|34|CP022901|CRT matches to position: 2336642-2336675, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

15. spacer 6.2|2021649|34|CP022901|CRT matches to position: 2479636-2479669, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

16. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 819996-820026, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgactttacgtcagct	Protospacer
********************** ***** **

17. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 869265-869295, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctggcttttcgtcagct	Protospacer
*****************.********** **

18. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 914095-914125, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgccagct	Protospacer
*************************.** **

19. spacer 10.1|2336703|31|CP022901|CRISPRCasFinder matches to position: 2011033-2011063, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattatcgtaagctgacttttcgtcagct	Protospacer
********.******************* **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 357866 : 376087 27 Staphylococcus_phage(90.48%) NA NA
DBSCAN-SWA_2 751822 : 759642 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 771614 : 785752 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 1611949 : 1620261 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_5 1689697 : 1698740 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1828468 : 1897375 65 Staphylococcus_phage(93.18%) protease,tRNA NA
DBSCAN-SWA_7 1932348 : 2000893 82 Staphylococcus_phage(84.13%) portal,tail,protease,capsid,tRNA,holin NA
DBSCAN-SWA_8 2078077 : 2092411 22 Staphylococcus_phage(68.42%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage