Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022895 Staphylococcus aureus strain 85 chromosome, complete genome 6 crisprs csa3,cas3,DEDDh,DinG,WYL 5 0 7 0

Results visualization

1. CP022895
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_1 800165-800249 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_2 907718-907803 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_3 1934787-1934914 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_4 1979688-1979879 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_5 2284045-2284170 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022895_6 2324052-2324132 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022895_1 1.1|800191|33|CP022895|CRISPRCasFinder 800191-800223 33 CP022895.1 1035453-1035485 1 0.97
CP022895_1 1.1|800191|33|CP022895|CRISPRCasFinder 800191-800223 33 CP022895.1 2359378-2359410 1 0.97
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 1061719-1061749 1 0.968
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 1634704-1634734 1 0.968
CP022895_2 2.1|907748|26|CP022895|CRISPRCasFinder 907748-907773 26 CP022895.1 2099752-2099777 2 0.923
CP022895_2 2.1|907748|26|CP022895|CRISPRCasFinder 907748-907773 26 CP022895.1 2159833-2159858 2 0.923
CP022895_4 4.1|1979709|37|CP022895|CRT 1979709-1979745 37 CP022895.1 813446-813482 2 0.946
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 255915-255948 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 330672-330705 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 767026-767059 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 800230-800263 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 1061656-1061689 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 1755696-1755729 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 2324016-2324049 2 0.941
CP022895_4 4.2|1979767|34|CP022895|CRT 1979767-1979800 34 CP022895.1 2467190-2467223 2 0.941
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 813570-813600 2 0.935
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 862879-862909 2 0.935
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 907709-907739 2 0.935
CP022895_6 6.1|2324077|31|CP022895|CRISPRCasFinder 2324077-2324107 31 CP022895.1 1969151-1969181 2 0.935

1. spacer 1.1|800191|33|CP022895|CRISPRCasFinder matches to position: 1035453-1035485, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 1.1|800191|33|CP022895|CRISPRCasFinder matches to position: 2359378-2359410, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 1061719-1061749, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

4. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 1634704-1634734, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

5. spacer 2.1|907748|26|CP022895|CRISPRCasFinder matches to position: 2099752-2099777, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

6. spacer 2.1|907748|26|CP022895|CRISPRCasFinder matches to position: 2159833-2159858, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

7. spacer 4.1|1979709|37|CP022895|CRT matches to position: 813446-813482, mismatch: 2, identity: 0.946

ccaacttgcacattattgtaagctgacagaaagtcag	CRISPR spacer
ccaacttgcacattattgtaagctggcggaaagtcag	Protospacer
*************************.*.*********

8. spacer 4.2|1979767|34|CP022895|CRT matches to position: 255915-255948, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

9. spacer 4.2|1979767|34|CP022895|CRT matches to position: 330672-330705, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

10. spacer 4.2|1979767|34|CP022895|CRT matches to position: 767026-767059, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

11. spacer 4.2|1979767|34|CP022895|CRT matches to position: 800230-800263, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

12. spacer 4.2|1979767|34|CP022895|CRT matches to position: 1061656-1061689, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

13. spacer 4.2|1979767|34|CP022895|CRT matches to position: 1755696-1755729, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 4.2|1979767|34|CP022895|CRT matches to position: 2324016-2324049, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

15. spacer 4.2|1979767|34|CP022895|CRT matches to position: 2467190-2467223, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

16. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 813570-813600, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgactttacgtcagct	Protospacer
********************** ***** **

17. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 862879-862909, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctggcttttcgtcagct	Protospacer
*****************.********** **

18. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 907709-907739, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgccagct	Protospacer
*************************.** **

19. spacer 6.1|2324077|31|CP022895|CRISPRCasFinder matches to position: 1969151-1969181, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattatcgtaagctgacttttcgtcagct	Protospacer
********.******************* **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 354181 : 370046 26 Staphylococcus_phage(76.19%) NA NA
DBSCAN-SWA_2 745407 : 753227 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 765199 : 779337 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 1606324 : 1614636 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_5 1684078 : 1693121 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1823923 : 1893904 65 Staphylococcus_phage(90.91%) protease,tRNA NA
DBSCAN-SWA_7 2025161 : 2072468 67 Staphylococcus_phage(100.0%) portal,capsid,tail,holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage