Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029489 Acinetobacter pittii strain 2010C01-170 chromosome, complete genome 2 crisprs DEDDh,WYL,csa3 0 1 2 0

Results visualization

1. CP029489
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029489_1 258205-258311 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029489_2 2172904-2172984 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 29226-29260 7 0.8
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 29194-29228 7 0.8
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024446 Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence 63668-63702 7 0.8
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024446 Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence 38673-38707 9 0.743
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024448 Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence 20098-20132 9 0.743
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 25313-25347 10 0.714
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 25281-25315 10 0.714
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP040258 Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence 46821-46855 10 0.714
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP014235 Moraxella osloensis strain CCUG 350 plasmid unnamed4, complete sequence 11249-11283 10 0.714
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_AP017383 Moraxella osloensis strain KMC41 plasmid pMOSL2, complete sequence 53808-53842 11 0.686
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP014238 Moraxella osloensis strain CCUG 350 plasmid unnamed1, complete sequence 7606-7640 11 0.686
CP029489_2 2.1|2172927|35|CP029489|CRISPRCasFinder 2172927-2172961 35 NZ_CP024183 Moraxella osloensis strain KSH plasmid p3, complete sequence 11704-11738 11 0.686

1. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.8

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cctactcgagcatagctctcgccttgcgctcgggc	Protospacer
.. ******.*****.**************** .*

2. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 7, identity: 0.8

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cctactcgagcatagctctcgccttgcgctcgggc	Protospacer
.. ******.*****.**************** .*

3. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024446 (Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence) position: , mismatch: 7, identity: 0.8

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgctcgggc	Protospacer
.. ******.*****.**************** .*

4. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024446 (Moraxella osloensis strain NP7 plasmid pNP7-3, complete sequence) position: , mismatch: 9, identity: 0.743

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
ctcactcgagcatagctctcgccttgcgtcggggc	Protospacer
.* ******.*****.************.. * .*

5. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024448 (Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence) position: , mismatch: 9, identity: 0.743

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
ccactacgagcatagctctcgccttgcgctcgggc	Protospacer
..* . ***.*****.**************** .*

6. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgtcggggc	Protospacer
.. ******.*****.************.. * .*

7. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 10, identity: 0.714

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgtcggggc	Protospacer
.. ******.*****.************.. * .*

8. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP040258 (Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence) position: , mismatch: 10, identity: 0.714

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgtcggggc	Protospacer
.. ******.*****.************.. * .*

9. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP014235 (Moraxella osloensis strain CCUG 350 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.714

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
ggtactcgagcatagctctcgccttgcgtcggggc	Protospacer
   ******.*****.************.. * .*

10. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_AP017383 (Moraxella osloensis strain KMC41 plasmid pMOSL2, complete sequence) position: , mismatch: 11, identity: 0.686

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgtcgcggc	Protospacer
.. ******.*****.************..   .*

11. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP014238 (Moraxella osloensis strain CCUG 350 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
ggtactcgagcatagatctcgccttgcgtcgaggc	Protospacer
   ******.***** ************.. . .*

12. spacer 2.1|2172927|35|CP029489|CRISPRCasFinder matches to NZ_CP024183 (Moraxella osloensis strain KSH plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.686

ttaactcgaacatagttctcgccttgcgctcgtac	CRISPR spacer
cccactcgagcatagctctcgccttgcgtcgcggc	Protospacer
.. ******.*****.************..   .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1221115 : 1234281 17 Acinetobacter_phage(57.14%) NA NA
DBSCAN-SWA_2 1242962 : 1253952 12 Acinetobacter_phage(81.82%) coat,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage