Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031330 Neisseria meningitidis strain M21955 chromosome, complete genome 8 crisprs NA 4 0 0 0

Results visualization

1. CP031330
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_1 446316-446421 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_2 1328451-1328549 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_3 1502721-1502818 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_4 1547608-1547691 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_5 1642348-1642428 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_6 1887547-1887771 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_7 1891111-1891209 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031330_8 2214422-2214576 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031330_1 1.1|446347|44|CP031330|CRISPRCasFinder 446347-446390 44 CP031330.1 1630032-1630075 0 1.0
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 82283-82308 0 1.0
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 82801-82826 0 1.0
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 614576-614601 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 81944-81993 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 82462-82511 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 587728-587777 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 1067683-1067732 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 1507435-1507484 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 2094303-2094352 0 1.0
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 2095380-2095429 0 1.0
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 81766-81791 1 0.962
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 791920-791945 1 0.962
CP031330_4 4.1|1547637|26|CP031330|CRISPRCasFinder 1547637-1547662 26 CP031330.1 792566-792591 1 0.962
CP031330_1 1.1|446347|44|CP031330|CRISPRCasFinder 446347-446390 44 CP031330.1 1629755-1629798 2 0.955
CP031330_1 1.1|446347|44|CP031330|CRISPRCasFinder 446347-446390 44 CP031330.1 1631695-1631738 2 0.955
CP031330_5 5.1|1642374|29|CP031330|CRISPRCasFinder 1642374-1642402 29 CP031330.1 81763-81791 2 0.931
CP031330_6 6.3|1887696|50|CP031330|CRISPRCasFinder 1887696-1887745 50 CP031330.1 942879-942928 2 0.96

1. spacer 1.1|446347|44|CP031330|CRISPRCasFinder matches to position: 1630032-1630075, mismatch: 0, identity: 1.0

atgaaaagattgttgtcgcttcggataaatttttgtcgcgttgg	CRISPR spacer
atgaaaagattgttgtcgcttcggataaatttttgtcgcgttgg	Protospacer
********************************************

2. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 82283-82308, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

3. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 82801-82826, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

4. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 614576-614601, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

5. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 81944-81993, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

6. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 82462-82511, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

7. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 587728-587777, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

8. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 1067683-1067732, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

9. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 1507435-1507484, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

10. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 2094303-2094352, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

11. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 2095380-2095429, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

12. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 81766-81791, mismatch: 1, identity: 0.962

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgcaggttttcttaaccctgcgtc	Protospacer
****.*********************

13. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 791920-791945, mismatch: 1, identity: 0.962

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgagtc	Protospacer
********************** ***

14. spacer 4.1|1547637|26|CP031330|CRISPRCasFinder matches to position: 792566-792591, mismatch: 1, identity: 0.962

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgagtc	Protospacer
********************** ***

15. spacer 1.1|446347|44|CP031330|CRISPRCasFinder matches to position: 1629755-1629798, mismatch: 2, identity: 0.955

atgaaaagattgttgtcgcttcggataaatttttgtcgcgttgg	CRISPR spacer
atgaaaagattgttgtcgcttcggataaatttttgccgtgttgg	Protospacer
***********************************.**.*****

16. spacer 1.1|446347|44|CP031330|CRISPRCasFinder matches to position: 1631695-1631738, mismatch: 2, identity: 0.955

atgaaaagattgttgtcgcttcggataaatttttgtcgcgttgg	CRISPR spacer
atgaaaagattgttgtcgcttcggataaatttttgccgtgttgg	Protospacer
***********************************.**.*****

17. spacer 5.1|1642374|29|CP031330|CRISPRCasFinder matches to position: 81763-81791, mismatch: 2, identity: 0.931

gatgcaggttttcttaaccccgcgttcta	CRISPR spacer
gatgcaggttttcttaaccctgcgtccta	Protospacer
********************.****.***

18. spacer 6.3|1887696|50|CP031330|CRISPRCasFinder matches to position: 942879-942928, mismatch: 2, identity: 0.96

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaacaaaaaccttccg	Protospacer
************************************ ***** *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage