Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033522 Acinetobacter pittii strain 2012N08-034 plasmid p2012N08-034-2, complete sequence 0 crisprs NA 0 0 0 0
CP033521 Acinetobacter pittii strain 2012N08-034 plasmid p2012N08-034-1, complete sequence 0 crisprs NA 0 0 0 0
CP033520 Acinetobacter pittii strain 2012N08-034 chromosome, complete genome 2 crisprs WYL,csa3,DEDDh 1 0 1 0
CP033524 Acinetobacter pittii strain 2012N08-034 plasmid p2012N08-034-4, complete sequence 0 crisprs NA 0 0 0 0
CP033523 Acinetobacter pittii strain 2012N08-034 plasmid p2012N08-034-3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033520
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033520_1 435558-435782 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033520_2 1897491-1897591 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033520_1 1.3|435726|33|CP033520|CRISPRCasFinder 435726-435758 33 CP033520.1 435783-435815 2 0.939

1. spacer 1.3|435726|33|CP033520|CRISPRCasFinder matches to position: 435783-435815, mismatch: 2, identity: 0.939

gagttcaattcagatcgcccacgtcgtgaaggt	CRISPR spacer
gagttcaattcagatcgtccgcgtcgtgaaggt	Protospacer
*****************.**.************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2560382 : 2597851 44 Acinetobacter_phage(75.68%) terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage