Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033557 Acinetobacter nosocomialis strain 2012C01-137 chromosome, complete genome 1 crisprs DEDDh,WYL,csa3 0 3 1 0
CP033560 Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-3, complete sequence 0 crisprs NA 0 0 0 0
CP033559 Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-2, complete sequence 0 crisprs NA 0 0 0 0
CP033558 Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033557
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033557_3 3401617-3401759 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033557_1 1.3|509084|36|CP033557|CRT 509084-509119 36 KU594606 Cyanophage S-RIM32 isolate RW_108_0702, complete genome 101492-101527 10 0.722
CP033557_1 1.4|509144|36|CP033557|CRT 509144-509179 36 KU594606 Cyanophage S-RIM32 isolate RW_108_0702, complete genome 101492-101527 10 0.722
CP033557_3 3.1|3401661|55|CP033557|CRISPRCasFinder 3401661-3401715 55 NC_003315 Haemophilus phage HP2, complete genome 401-455 11 0.8
CP033557_3 3.1|3401661|55|CP033557|CRISPRCasFinder 3401661-3401715 55 AY027935 Haemophilus influenzae phage HP2, complete genome 401-455 11 0.8
CP033557_3 3.1|3401661|55|CP033557|CRISPRCasFinder 3401661-3401715 55 Z71579 Bacteriophage S2 type A 5.6 kb DNA fragment 401-455 12 0.782
CP033557_3 3.1|3401661|55|CP033557|CRISPRCasFinder 3401661-3401715 55 U24159 Bacteriophage HP1 strain HP1c1, complete genome 399-453 12 0.782
CP033557_3 3.1|3401661|55|CP033557|CRISPRCasFinder 3401661-3401715 55 NC_001697 Haemophilus phage HP1, complete genome 399-453 12 0.782

1. spacer 1.3|509084|36|CP033557|CRT matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 10, identity: 0.722

gccaagagggttaccaccagtaacaccaccagttaa	CRISPR spacer
aagttgaatcttaccaccagtaacactaccagtgaa	Protospacer
.    **.  ****************.****** **

2. spacer 1.4|509144|36|CP033557|CRT matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 10, identity: 0.722

gccaagagggttaccaccagtaacaccaccagttaa	CRISPR spacer
aagttgaatcttaccaccagtaacactaccagtgaa	Protospacer
.    **.  ****************.****** **

3. spacer 3.1|3401661|55|CP033557|CRISPRCasFinder matches to NC_003315 (Haemophilus phage HP2, complete genome) position: , mismatch: 11, identity: 0.8

cttatctgttttga----acctatttgggtcgttagctcagttggtagagcagcggact	CRISPR spacer
----tttactttaaaatcatctaattgggtcgttagctcagtcggtagagcagcggact	Protospacer
    *.*..***.*    *.*** ******************.****************

4. spacer 3.1|3401661|55|CP033557|CRISPRCasFinder matches to AY027935 (Haemophilus influenzae phage HP2, complete genome) position: , mismatch: 11, identity: 0.8

cttatctgttttga----acctatttgggtcgttagctcagttggtagagcagcggact	CRISPR spacer
----tttactttaaaatcatctaattgggtcgttagctcagtcggtagagcagcggact	Protospacer
    *.*..***.*    *.*** ******************.****************

5. spacer 3.1|3401661|55|CP033557|CRISPRCasFinder matches to Z71579 (Bacteriophage S2 type A 5.6 kb DNA fragment) position: , mismatch: 12, identity: 0.782

cttatctgttttga----acctatttgggtcgttagctcagttggtagagcagcggact	CRISPR spacer
----ttcactttaaaatcatctaattgggtcgttagctcagtcggtagagcagcggact	Protospacer
    *....***.*    *.*** ******************.****************

6. spacer 3.1|3401661|55|CP033557|CRISPRCasFinder matches to U24159 (Bacteriophage HP1 strain HP1c1, complete genome) position: , mismatch: 12, identity: 0.782

cttatctgttttga----acctatttgggtcgttagctcagttggtagagcagcggact	CRISPR spacer
----ttcactttaaaatcatctaattgggtcgttagctcagtcggtagagcagcggact	Protospacer
    *....***.*    *.*** ******************.****************

7. spacer 3.1|3401661|55|CP033557|CRISPRCasFinder matches to NC_001697 (Haemophilus phage HP1, complete genome) position: , mismatch: 12, identity: 0.782

cttatctgttttga----acctatttgggtcgttagctcagttggtagagcagcggact	CRISPR spacer
----ttcactttaaaatcatctaattgggtcgttagctcagtcggtagagcagcggact	Protospacer
    *....***.*    *.*** ******************.****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1226785 : 1242410 23 Acinetobacter_phage(64.71%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage