Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP012217 Campylobacter jejuni strain CJ071CC464, complete genome 1 crisprs DEDDh,cas14j,cas2,cas1,csa3 0 1 3 0

Results visualization

1. CP012217
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP012217_1 1664925-1665030 Unclear NA
1 spacers
cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 MN530981 Campylobacter phage DA10, complete genome 14803-14828 0 1.0
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 795123-795148 5 0.808
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 NZ_CP040856 Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence 90292-90317 5 0.808
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 NZ_CP026733 Shigella boydii strain ATCC 8700 plasmid unnamed2, complete sequence 50101-50126 5 0.808
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 NZ_CP026794 Shigella flexneri strain 74-1170 plasmid unnamed 250198-250223 5 0.808
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 13249-13274 5 0.808
CP012217_1 1.1|1664965|26|CP012217|CRISPRCasFinder 1664965-1664990 26 KF302034 UNVERIFIED: Pseudoalteromonas phage HM1, complete genome 58041-58066 5 0.808

1. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 0, identity: 1.0

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
aatgaaaaaaaagtttaaagatagct	Protospacer
**************************

2. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
catgagaaaaaagtttaaagataaag	Protospacer
 ****.*****************.  

3. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to NZ_CP040856 (Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
aatgaaaaaaaagtttaaatatccgc	Protospacer
******************* **   .

4. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to NZ_CP026733 (Shigella boydii strain ATCC 8700 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
gatgaaaaaaaatttaaaagatagtg	Protospacer
.*********** ** ********. 

5. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to NZ_CP026794 (Shigella flexneri strain 74-1170 plasmid unnamed) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
gatgaaaaaaaatttaaaagatagtg	Protospacer
.*********** ** ********. 

6. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
aatgaaaaaagagtttaaagacataa	Protospacer
**********.**********.*   

7. spacer 1.1|1664965|26|CP012217|CRISPRCasFinder matches to KF302034 (UNVERIFIED: Pseudoalteromonas phage HM1, complete genome) position: , mismatch: 5, identity: 0.808

aatgaaaaaaaagtttaaagatagct	CRISPR spacer
catgaagaaaaagtttaaagatgaat	Protospacer
 *****.***************.. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 166113 : 256204 109 Campylobacter_phage(46.15%) protease,integrase,bacteriocin,plate,tail attL 167464:167481|attR 258014:258031
DBSCAN-SWA_2 788126 : 797127 10 Acinetobacter_phage(83.33%) protease NA
DBSCAN-SWA_3 1572663 : 1579299 8 Tupanvirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage