Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030910 Pseudomonas aeruginosa strain Y31 chromosome, complete genome 3 crisprs csa3,DEDDh,cas3,PD-DExK,WYL,DinG 1 1 6 0

Results visualization

1. CP030910
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030910_1 340729-340842 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030910_2 2734301-2734402 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030910_3 4589864-4590035 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP030910_3 3.1|4589892|30|CP030910|CRISPRCasFinder 4589892-4589921 30 CP030910.1 1641812-1641841 0 1.0
CP030910_3 3.1|4589892|30|CP030910|CRISPRCasFinder 4589892-4589921 30 CP030910.1 1983466-1983495 2 0.933

1. spacer 3.1|4589892|30|CP030910|CRISPRCasFinder matches to position: 1641812-1641841, mismatch: 0, identity: 1.0

ggccgcgtagggcgaataaccgcttgcggt	CRISPR spacer
ggccgcgtagggcgaataaccgcttgcggt	Protospacer
******************************

2. spacer 3.1|4589892|30|CP030910|CRISPRCasFinder matches to position: 1983466-1983495, mismatch: 2, identity: 0.933

ggccgcgtagggcgaataaccgcttgcggt	CRISPR spacer
ggcctggtagggcgaataaccgcttgcggt	Protospacer
****  ************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030910_2 2.1|2734326|52|CP030910|CRISPRCasFinder 2734326-2734377 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 2.1|2734326|52|CP030910|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 650232 : 713096 61 Pseudomonas_phage(24.14%) plate,tRNA,holin,integrase,tail attL 645182:645196|attR 681573:681587
DBSCAN-SWA_2 797544 : 804017 10 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_3 2310757 : 2319819 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 3550532 : 3557426 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_5 5360244 : 5367673 11 Pseudomonas_phage(85.71%) tRNA NA
DBSCAN-SWA_6 5757436 : 5764718 11 Pseudomonas_phage(85.71%) integrase attL 5756861:5756920|attR 5768779:5768860
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage