1. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.857
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gcggcctgctgcttcgccagcacgggag Protospacer
** ****************** *** .*
2. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.857
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gcggcctgctgcttcgccagcacgggag Protospacer
** ****************** *** .*
3. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP014329 (Corynebacterium glutamicum strain USDA-ARS-USMARC-56828 plasmid p48A, complete sequence) position: , mismatch: 4, identity: 0.857
--gccgcctgctgcttcgccagctcggcgg CRISPR spacer
atgcgggc--ctgcttcgccagctcggcgg Protospacer
** * * ********************
4. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_010905 (Amycolatopsis benzoatilytica strain DSM 43387 plasmid pA387, complete sequence) position: , mismatch: 4, identity: 0.857
-gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tgctg-ctgctccttggccagctcggcgg Protospacer
**.* ***** *** *************
5. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcc-cggccgtcccgcccgcggcggc CRISPR spacer
-tcccgcccacgaccgtcccgcccgcggcggc Protospacer
***.** **.*******************
6. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcccg--cggcggc CRISPR spacer
ccgccgccccggccgtcccgcccgaacgccg-- Protospacer
* ****.***************** ** **
7. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcc-cggccgtcccgcccgcggcggc CRISPR spacer
-tcccgcccacgaccgtcccgcccgcggcggc Protospacer
***.** **.*******************
8. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcc-cggccgtcccgcccgcggcggc CRISPR spacer
-tcccgcccacgaccgtcccgcccgcggcggc Protospacer
***.** **.*******************
9. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcccg--cggcggc CRISPR spacer
ccgccgccccggccgtcccgcccgaacgccg-- Protospacer
* ****.***************** ** **
10. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.839
cggccg-tcccggccgtcccgcccgcggcggc CRISPR spacer
-gcccgcccccggccgtcccgcccgcgccgac Protospacer
* *** .******************* **.*
11. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcc-cgcggcggc CRISPR spacer
cggccgtcccggccgccccgccacgcagtcg- Protospacer
***************.****** ***.*. *
12. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcc-cgcggcggc CRISPR spacer
cggccgtcccggccgccccgccacgcagtcg- Protospacer
***************.****** ***.*. *
13. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcc-cgcggcggc CRISPR spacer
cggccgtcccggccgccccgccacgcagtcg- Protospacer
***************.****** ***.*. *
14. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.839
cggccgtcccggccgtcccgcc-cgcggcggc CRISPR spacer
cggccgtcccggccgccccgccacgcagtcg- Protospacer
***************.****** ***.*. *
15. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 5, identity: 0.839
-cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
gcgaccg-gccggccgtcccgctcgcgccggc Protospacer
**.*** *************.**** ****
16. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 5, identity: 0.821
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
aacgcctgcttctgcgccagctcggcga Protospacer
. ******** ** *************.
17. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gccgcctgctgctccgccagcgacgcgc Protospacer
*************.******* ***
18. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.821
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gccgcctgctgcttggccagcacctggg Protospacer
************** ****** * **
19. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gccgcctgctgctccgccagcgacgcgc Protospacer
*************.******* ***
20. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 5, identity: 0.821
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
gccgcctgctgcttcaccagcatgtcga Protospacer
***************.***** .* **.
21. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cgccgcccccggccgccccgcctgcggcggc Protospacer
** * .********.******.********
22. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.806
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
ccggcgtcccggccgtcccgcccgggggaga Protospacer
* * ******************** ** .*
23. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.806
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
ccggcgtcccggccgtcccgcccgggggaga Protospacer
* * ******************** ** .*
24. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_029005 (Streptomyces phage phiSAJS1, complete genome) position: , mismatch: 6, identity: 0.806
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cggccgtcgcggccgtcccgtccgccctgtc Protospacer
******** ***********.**** .* *
25. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cggcgaggccggcggccccgcccgcggcggc Protospacer
**** . ***** *.***************
26. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tccggccgctgcttcgccagctcgacca Protospacer
*** *.*****************.* .
27. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tcggcctgcttcttggccagctcggcct Protospacer
* ******* *** ***********
28. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_020303 (Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tccgcctgctgctgggccagctcgcggt Protospacer
************ ********* *
29. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tccggccgctgcttcgccagctcgacca Protospacer
*** *.*****************.* .
30. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
accgcctgcggctgcgccagctcgtgcg Protospacer
.******** *** ********** *
31. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.786
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
tccggccgctgcttcgccagctcgacca Protospacer
*** *.*****************.* .
32. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 6, identity: 0.8
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
gccgcgctgatctgcctgttcggcgtcgac Protospacer
******* ********* ****** * *
33. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cggccgtcccggccgtcccggccgtacccct Protospacer
******************** ***.. * .
34. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cggccgtcacggccgtcacgcccgccatgaa Protospacer
******** ******** ******* ..*.
35. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cccacgaagcggccgtcccgcccgcggccgc Protospacer
* ** ******************* **
36. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cccacgaagcggccgtcccgcccgcggccgc Protospacer
* ** ******************* **
37. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cccacgaagcggccgtcccgcccgcggccgc Protospacer
* ** ******************* **
38. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
taacggtcccggccgtcctgcccgcgggagc Protospacer
...* *************.******** .**
39. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN871482 (UNVERIFIED: Pseudomonas virus PaSz-6, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
40. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN871486 (UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
41. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MH791403 (UNVERIFIED: Pseudomonas phage PaTs-2, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
42. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN871463 (UNVERIFIED: Pseudomonas phage Pa-L, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
43. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN871469 (UNVERIFIED: Pseudomonas phage Pa-S, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
44. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN871478 (UNVERIFIED: Pseudomonas phage PaSt-2_45_61k, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
45. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MT118302 (Pseudomonas phage Epa38, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
46. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
aggccgtcccggccggcgcgcccgcccccga Protospacer
************** * ******* * *
47. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cccacgaagcggccgtcccgcccgcggccgc Protospacer
* ** ******************* **
48. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccg--cggcggc CRISPR spacer
tggccgtccgggccgacccgcccgatcaccg-- Protospacer
.******** ***** ******** *. **
49. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MH791406 (UNVERIFIED: Pseudomonas phage PaSz-4, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
50. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_028980 (Pseudomonas phage PAE1, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
51. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to DQ163916 (Bacteriophage M6, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
52. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to KC758116 (Pseudomonas phage LKO4, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
53. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_007809 (Pseudomonas phage M6, complete genome) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
agtccgtcccgcccgtcccgcccacggtgaa Protospacer
* ******** ***********.***.*.
54. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cggccgacccgaccgtcccgcccctggtcga Protospacer
****** ****.*********** .**. *
55. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
ccgtctgcccggccgtcgcgccggcggcggt Protospacer
* *.* ********** **** *******.
56. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.774
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
gcgcggagccggccgccccgcgcgcggcggc Protospacer
** * *******.***** *********
57. spacer 9.1|4499080|28|CP026730|CRISPRCasFinder matches to MH426726 (Erwinia phage Pavtok, complete genome) position: , mismatch: 7, identity: 0.75
gccgcctgctgcttcgccagctcggcgg CRISPR spacer
agatccggatgcttcgccagctcggcgt Protospacer
. ** * ******************
58. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to MK356557 (Salmonella sp. strain Sa1423 plasmid pSa1423-90k, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
gccacgctgttcggcctgtagggcgtgcta Protospacer
*.******** ******* ****** *
59. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
60. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
61. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
62. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
63. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
64. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
65. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
66. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
67. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
68. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
69. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
70. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
71. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
72. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
73. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
74. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
75. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
76. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
77. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
78. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
79. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
80. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
81. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
82. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
83. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
84. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
85. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
86. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
87. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
88. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggc Protospacer
...********** **********..** *
89. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tctcccggccggccgtccggcccgcgccggc Protospacer
. ** ********** ******* ****
90. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tgatcatcccggccgtcctgccggcggcgca Protospacer
.*..*.************.*** ******
91. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
cccttgcgccggccgtcacgccggcggcggc Protospacer
* ..*. ********* **** ********
92. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN369753 (Gordonia phage Sukkupi, complete genome) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tcgacgtcccggccgtcccgccggaggagat Protospacer
. * ****************** * ** *..
93. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MK376960 (Gordonia phage BiPauneto, complete genome) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tcgacgtcccggccgtcccgccggaggagat Protospacer
. * ****************** * ** *..
94. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tcgacgtcccggccgtcccgccggaggagat Protospacer
. * ****************** * ** *..
95. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN369766 (Gordonia phage Yndexa, complete genome) position: , mismatch: 8, identity: 0.742
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tcgacgtcccggccgtcccgccggaggagat Protospacer
. * ****************** * ** *..
96. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.771
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
cgtcgacgccggtggcggaggcgggggcggtggct Protospacer
.* **.* ******** *** ************
97. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.771
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
ggccagcatgggtggcggcggcggtggcggtggcg Protospacer
* *.** ************* * *********
98. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.771
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
ggccagcatgggtggcggcggcggtggcggtggcg Protospacer
* *.** ************* * *********
99. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.771
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
ggccagcatgggtggcggcggcggtggcggtggcg Protospacer
* *.** ************* * *********
100. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggt Protospacer
...********** **********..** .
101. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 8, identity: 0.733
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
ggcgcgctgttcagcctgaacggcatcaca Protospacer
*********** ***** *****.* ..
102. spacer 10.1|5386165|30|CP026730|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgcgcgctgttctgcctgtacggcgtggtc CRISPR spacer
catgcgctgttcttcctgtacggcacgggt Protospacer
...********** **********..** .
103. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
ttgccgtcccggccctcccgcccgaagttct Protospacer
. ************ ********* .*. .
104. spacer 3.1|2012556|31|CP026730|CRISPRCasFinder matches to MN428063 (Gordonia phage NadineRae, complete genome) position: , mismatch: 9, identity: 0.71
cggccgtcccggccgtcccgcccgcggcggc CRISPR spacer
tcgacgtcccggccgtcccgccggaggacat Protospacer
. * ****************** * ** ..
105. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.743
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
cggcggccagggtggtggcggcgggggcaacagtg Protospacer
.**************.****** *****....*.
106. spacer 6.3|3613857|35|CP026730|CRT matches to NC_023610 (Erwinia phage PhiEaH1, complete genome) position: , mismatch: 10, identity: 0.714
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
cggcggccagggcggcggcggttggggcaaacctc Protospacer
.***********.********.******.. ..
107. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 10, identity: 0.714
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
tggcggccagggtggcgacggctcggacaaccaga Protospacer
*****************.***** **.*... .
108. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
tggcggccagggtggcgacggctcggacaaccaga Protospacer
*****************.***** **.*... .
109. spacer 6.3|3613857|35|CP026730|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 10, identity: 0.714
tggcggccagggtggcggcggctggggcggtggct CRISPR spacer
gcaggtgcagggttgcggcggcttgggcggtgacg Protospacer
. * ****** ********* ********.*
