Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031455 Streptomyces olivoreticuli subsp. olivoreticuli strain ATCC 31159 chromosome, complete genome 17 crisprs NA 7 79 0 0

Results visualization

1. CP031455
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_2 1281376-1281588 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_1 1277093-1278280 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_3 1291170-1291808 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_4 1391926-1393115 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_5 3421230-3421333 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_6 3746358-3746453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_7 3991612-3991711 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_8 4485984-4486083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_9 4583156-4583273 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_10 5103631-5103793 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_11 5813256-5813381 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_12 5915411-5915520 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_13 6807282-6807372 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_14 6807599-6807842 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_15 7007596-7007719 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_16 8316316-8317625 Orphan NA
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031455_17 8322540-8323605 Orphan NA
17 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031455_3 3.7|1291564|33|CP031455|PILER-CR,CRT 1291564-1291596 33 CP031455.1 8066646-8066678 0 1.0
CP031455_3 3.17|1291565|32|CP031455|CRISPRCasFinder 1291565-1291596 32 CP031455.1 8066646-8066677 0 1.0
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 CP031455.1 3017984-3018015 0 1.0
CP031455_7 7.1|3991636|52|CP031455|CRISPRCasFinder 3991636-3991687 52 CP031455.1 6324826-6324877 1 0.981
CP031455_11 11.1|5813274|18|CP031455|CRT 5813274-5813291 18 CP031455.1 8303140-8303157 1 0.944
CP031455_11 11.3|5813346|18|CP031455|CRT 5813346-5813363 18 CP031455.1 3719219-3719236 1 0.944
CP031455_7 7.1|3991636|52|CP031455|CRISPRCasFinder 3991636-3991687 52 CP031455.1 6047189-6047240 2 0.962
CP031455_12 12.1|5915438|56|CP031455|CRISPRCasFinder 5915438-5915493 56 CP031455.1 3705570-3705625 2 0.964

1. spacer 3.7|1291564|33|CP031455|PILER-CR,CRT matches to position: 8066646-8066678, mismatch: 0, identity: 1.0 

aggatcgtgttgggtacggccacgccttcgaca	CRISPR spacer
aggatcgtgttgggtacggccacgccttcgaca	Protospacer
*********************************

2. spacer 3.17|1291565|32|CP031455|CRISPRCasFinder matches to position: 8066646-8066677, mismatch: 0, identity: 1.0 

ggatcgtgttgggtacggccacgccttcgaca	CRISPR spacer
ggatcgtgttgggtacggccacgccttcgaca	Protospacer
********************************

3. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to position: 3017984-3018015, mismatch: 0, identity: 1.0 

gcgcgcggggcactccgcccagctcgccgcct	CRISPR spacer
gcgcgcggggcactccgcccagctcgccgcct	Protospacer
********************************

4. spacer 7.1|3991636|52|CP031455|CRISPRCasFinder matches to position: 6324826-6324877, mismatch: 1, identity: 0.981 

gtcgggtgcggcccggcgggcgcttgttccccagccccgccccttcccgaaa	CRISPR spacer
gtcgggtgcggcccggcgggcacttgttccccagccccgccccttcccgaaa	Protospacer
*********************.******************************

5. spacer 11.1|5813274|18|CP031455|CRT matches to position: 8303140-8303157, mismatch: 1, identity: 0.944 

gacaacggcgcggccacg	CRISPR spacer
gacaacggcgcggccccg	Protospacer
*************** **

6. spacer 11.3|5813346|18|CP031455|CRT matches to position: 3719219-3719236, mismatch: 1, identity: 0.944 

accaacgacgccgccacg	CRISPR spacer
acgaacgacgccgccacg	Protospacer
** ***************

7. spacer 7.1|3991636|52|CP031455|CRISPRCasFinder matches to position: 6047189-6047240, mismatch: 2, identity: 0.962 

gtcgggtgcggcccggcgggcgcttgttccccagccccgccccttcccgaaa	CRISPR spacer
gtcgggtgcggcccggtgggcacttgttccccagccccgccccttcccgaaa	Protospacer
****************.****.******************************

8. spacer 12.1|5915438|56|CP031455|CRISPRCasFinder matches to position: 3705570-3705625, mismatch: 2, identity: 0.964 

cttgttccccagccccgccccttcccgaactggggctcgtgccccaggcccccggc	CRISPR spacer
ctttttccccagccccgccccttcccgaactggggctcgtgccccagacccccggc	Protospacer
*** *******************************************.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031455_16 16.14|8317138|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317138-8317169 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 315649-315680 0 1.0
CP031455_16 16.14|8317138|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317138-8317169 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 687338-687369 0 1.0
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 49961-49992 1 0.969
CP031455_1 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277427-1277458 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 296302-296333 2 0.938
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 57543-57574 3 0.906
CP031455_1 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277427-1277458 32 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 126426-126457 5 0.844
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP019872 Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence 108726-108757 5 0.844
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP049912 Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence 32826-32857 5 0.844
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP022425 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence 10364-10395 5 0.844
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NC_014154 Thiomonas intermedia K12 plasmid pTINT01, complete sequence 35743-35774 5 0.844
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 AF068845 Mycobacteriophage TM4, complete genome 19006-19037 5 0.844
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 KC787101 Mycobacterium phage 33D, partial genome 29392-29423 5 0.844
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NC_003387 Mycobacterium phage TM4, complete genome 19006-19037 5 0.844
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 443889-443920 5 0.844
CP031455_16 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316406-8316437 32 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 288395-288426 5 0.844
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 MK759884 Salmonella phage vB_SenM_SB18, complete genome 70877-70908 5 0.844
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 MH426725 Erwinia phage SunLIRen, complete genome 70618-70649 5 0.844
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 MK033137 UNVERIFIED: Pseudomonas phage UNO-SLW1, complete genome 10343-10374 5 0.844
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 KX449362 Pseudomonas phage UNO-SLW3, complete genome 7729-7760 5 0.844
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 KX449363 Pseudomonas phage UNO-SLW4, complete genome 7729-7760 5 0.844
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NC_047873 Pseudomonas phage UNO-SLW1, complete genome 7729-7760 5 0.844
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 KX449361 Pseudomonas phage UNO-SLW2, complete genome 7729-7760 5 0.844
CP031455_1 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277427-1277458 32 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 12865-12896 6 0.812
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 54412-54443 6 0.812
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP020556 Streptomyces sp. Sge12 plasmid pSGE, complete sequence 43456-43487 6 0.812
CP031455_2 2.3|1281528|31|CP031455|CRT 1281528-1281558 31 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 183926-183956 6 0.806
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1618334-1618365 6 0.812
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1623002-1623033 6 0.812
CP031455_3 3.1|1291198|33|CP031455|PILER-CR,CRT 1291198-1291230 33 KC787101 Mycobacterium phage 33D, partial genome 29391-29423 6 0.818
CP031455_3 3.1|1291198|33|CP031455|PILER-CR,CRT 1291198-1291230 33 AF068845 Mycobacteriophage TM4, complete genome 19006-19038 6 0.818
CP031455_3 3.1|1291198|33|CP031455|PILER-CR,CRT 1291198-1291230 33 NC_003387 Mycobacterium phage TM4, complete genome 19006-19038 6 0.818
CP031455_3 3.8|1291625|33|CP031455|PILER-CR,CRT 1291625-1291657 33 CP033573 Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence 7783-7815 6 0.818
CP031455_3 3.8|1291625|33|CP031455|PILER-CR,CRT 1291625-1291657 33 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 40204-40236 6 0.818
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 443888-443920 6 0.818
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 257236-257268 6 0.818
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 228669-228700 6 0.812
CP031455_3 3.18|1291626|32|CP031455|CRISPRCasFinder 1291626-1291657 32 CP033573 Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence 7783-7814 6 0.812
CP031455_3 3.18|1291626|32|CP031455|CRISPRCasFinder 1291626-1291657 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 40204-40235 6 0.812
CP031455_3 3.18|1291626|32|CP031455|CRISPRCasFinder 1291626-1291657 32 NZ_CP015616 Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence 150510-150541 6 0.812
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 AY320035 Bacteriophage VWB, complete genome 19213-19244 6 0.812
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_005345 Streptomyces phage VWB, complete genome 19213-19244 6 0.812
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 283026-283057 6 0.812
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 356843-356874 6 0.812
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1084205-1084236 6 0.812
CP031455_4 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT 1392872-1392903 32 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 203624-203655 6 0.812
CP031455_4 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT 1392872-1392903 32 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 263666-263697 6 0.812
CP031455_4 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT 1392872-1392903 32 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 203385-203416 6 0.812
CP031455_4 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT 1392872-1392903 32 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 203469-203500 6 0.812
CP031455_4 4.17|1392933|32|CP031455|CRISPRCasFinder,CRT 1392933-1392964 32 NZ_CP045376 Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence 25737-25768 6 0.812
CP031455_16 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316406-8316437 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 321706-321737 6 0.812
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 30645-30676 6 0.812
CP031455_16 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317077-8317108 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 360589-360620 6 0.812
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 56929-56960 6 0.812
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 79012-79043 6 0.812
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1170513-1170544 6 0.812
CP031455_17 17.6|8322874|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322874-8322905 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1460647-1460678 6 0.812
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 82029-82060 6 0.812
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 144830-144861 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 192431-192462 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1549386-1549417 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 467181-467212 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1514064-1514095 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 209086-209117 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 192190-192221 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1632147-1632178 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1615616-1615647 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1427514-1427545 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 187592-187623 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 186281-186312 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1118156-1118187 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 453578-453609 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 968337-968368 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 485175-485206 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 437389-437420 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1789248-1789279 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1239183-1239214 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 975075-975106 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 829543-829574 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 340791-340822 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 191374-191405 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 82095-82126 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1164038-1164069 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1443074-1443105 6 0.812
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1549400-1549431 6 0.812
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 346315-346346 6 0.812
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 120450-120481 7 0.781
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 24531-24562 7 0.781
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 24531-24562 7 0.781
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 17306-17337 7 0.781
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 216520-216551 7 0.781
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 MH617641 Microviridae sp. isolate ctji855, complete genome 2757-2788 7 0.781
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 323492-323523 7 0.781
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_CP019438 Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence 211959-211989 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 507377-507407 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 85283-85313 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 85308-85338 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 85305-85335 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 85421-85451 7 0.774
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 84433-84463 7 0.774
CP031455_2 2.6|1281528|32|CP031455|CRISPRCasFinder 1281528-1281559 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 183926-183957 7 0.781
CP031455_3 3.1|1291198|33|CP031455|PILER-CR,CRT 1291198-1291230 33 MF140411 Mycobacterium phage Findley, complete genome 18940-18972 7 0.788
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 51668-51700 7 0.788
CP031455_3 3.8|1291625|33|CP031455|PILER-CR,CRT 1291625-1291657 33 NZ_CP015616 Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence 150510-150542 7 0.788
CP031455_3 3.9|1291686|33|CP031455|PILER-CR,CRT 1291686-1291718 33 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 148506-148538 7 0.788
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 MF140411 Mycobacterium phage Findley, complete genome 18940-18971 7 0.781
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 483190-483221 7 0.781
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP032328 Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence 6655-6686 7 0.781
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP032328 Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence 153979-154010 7 0.781
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 48388-48419 7 0.781
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 KJ510412 Mycobacterium phage ZoeJ, complete genome 18884-18915 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 113324-113355 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 51669-51700 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 103641-103672 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 141343-141374 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5246831-5246862 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 183202-183233 7 0.781
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 155033-155064 7 0.781
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 148507-148538 7 0.781
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 188268-188299 7 0.781
CP031455_4 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392138-1392169 32 NZ_CP014677 Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence 58124-58155 7 0.781
CP031455_4 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392138-1392169 32 NZ_CP014677 Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence 87890-87921 7 0.781
CP031455_4 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392138-1392169 32 NZ_CP014677 Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence 128357-128388 7 0.781
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR134445 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence 44923-44954 7 0.781
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 359947-359978 7 0.781
CP031455_4 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT 1392994-1393025 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 32539-32570 7 0.781
CP031455_16 16.4|8316528|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316528-8316559 32 NZ_CP020041 Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence 152489-152520 7 0.781
CP031455_16 16.5|8316589|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316589-8316620 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 734433-734464 7 0.781
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 839679-839710 7 0.781
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 841404-841435 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 MG812490 Mycobacterium phage Holeinone, complete genome 7100-7131 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 MH001452 Mycobacterium phage Kheth, complete genome 7100-7131 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 KT365402 Mycobacterium phage Tres, complete genome 7100-7131 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 KM101117 Mycobacterium phage LizLemon, complete genome 7217-7248 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 NC_043767 Mycobacterium virus TA17a, complete genome 7100-7131 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 MG812491 Mycobacterium phage ItsyBitsy1, complete genome 7091-7122 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 KR997932 Mycobacterium phage Godines, complete genome 7100-7131 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 KX443696 Mycobacterium phage Laurie, complete genome 7101-7132 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 MH727546 Mycobacterium phage Eaglehorse, complete genome 7118-7149 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 KT880194 Mycobacterium phage Glass, complete genome 7217-7248 7 0.781
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 NZ_HG917973 Mycobacterium marinum E11 plasmid pRAW, complete sequence 94426-94457 7 0.781
CP031455_16 16.10|8316894|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316894-8316925 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 145687-145718 7 0.781
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NZ_CP024864 Escherichia coli strain AR_0015 plasmid unitig_2_pilon, complete sequence 4403-4434 7 0.781
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NC_011413 Escherichia coli SE11 plasmid pSE11-2, complete sequence 65992-66023 7 0.781
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 CP054565 Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence 97823-97854 7 0.781
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NZ_CP010201 Escherichia coli strain M10 plasmid A, complete sequence 42514-42545 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 KY092484 Streptomyces phage Raleigh, complete genome 20141-20172 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 213199-213230 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP023440 Thauera sp. K11 plasmid pTX1, complete sequence 76588-76619 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 628703-628734 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1184368-1184399 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 46962-46993 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 KX589269 Mycobacterium phage Fortunato, complete genome 57578-57609 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134466 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence 51317-51348 7 0.781
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 20862-20893 7 0.781
CP031455_17 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT 8322691-8322722 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 476053-476084 7 0.781
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1153361-1153392 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 799824-799855 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 349890-349921 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 584672-584703 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 459859-459890 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 107538-107569 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 555830-555861 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 213308-213339 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 276566-276597 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 434514-434545 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 530729-530760 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1708378-1708409 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 66218-66249 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 777556-777587 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 376563-376594 7 0.781
CP031455_17 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322996-8323027 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 807861-807892 7 0.781
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 47198-47229 7 0.781
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 MK524494 Mycobacterium phage Rabbs, complete genome 14868-14899 7 0.781
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 KX641266 Mycobacterium phage Terror, complete genome 14880-14911 7 0.781
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NC_031102 Mycobacterium phage Sneeze, complete genome 14867-14898 7 0.781
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 KX641265 Mycobacterium phage Taheera, complete genome 14880-14911 7 0.781
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1526286-1526317 7 0.781
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 286974-287005 7 0.781
CP031455_17 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323423-8323454 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 291370-291401 7 0.781
CP031455_17 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323423-8323454 32 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 120746-120777 7 0.781
CP031455_17 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323423-8323454 32 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 204095-204126 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 MF150911 Ralstonia phage DU_RP_II, complete genome 28113-28144 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 MN996301 Ralstonia phage RpY1, complete genome 2106-2137 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 674197-674228 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 573401-573432 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 635216-635247 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 483227-483258 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 447914-447945 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 483024-483055 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 537890-537921 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 424408-424439 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 578408-578439 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 445634-445665 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 615265-615296 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 489942-489973 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 674199-674230 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 522725-522756 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 517677-517708 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 460006-460037 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 239338-239369 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 59165-59196 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 422978-423009 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 399011-399042 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 318169-318200 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 577192-577223 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1034797-1034828 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 609614-609645 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 487544-487575 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 156321-156352 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 161768-161799 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 2729-2760 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 44466-44497 7 0.781
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 223149-223180 7 0.781
CP031455_1 1.3|1277244|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277244-1277275 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66101-66132 8 0.75
CP031455_1 1.4|1277305|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277305-1277336 32 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 456199-456230 8 0.75
CP031455_1 1.7|1277488|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277488-1277519 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1134544-1134575 8 0.75
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 57540-57571 8 0.75
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 255815-255846 8 0.75
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 61796-61827 8 0.75
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_007801 Jannaschia sp. CCS1 plasmid p1, complete sequence 7914-7945 8 0.75
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 246810-246841 8 0.75
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 264013-264044 8 0.75
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NZ_CP015745 Shinella sp. HZN7 plasmid pShin-09, complete sequence 121354-121385 8 0.75
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 539680-539711 8 0.75
CP031455_1 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277915-1277946 32 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 170829-170860 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 133290-133321 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 391934-391965 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1235376-1235407 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 704800-704831 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 277907-277938 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 115136-115167 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 420262-420293 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP016621 Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence 134448-134479 8 0.75
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 495292-495323 8 0.75
CP031455_1 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278098-1278129 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 158870-158901 8 0.75
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 MN693196 Marine virus AFVG_25M118, complete genome 2830-2861 8 0.75
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 264448-264479 8 0.75
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 244878-244908 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 MN693196 Marine virus AFVG_25M118, complete genome 2830-2860 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 872380-872410 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 264448-264478 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 474149-474179 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 131405-131435 8 0.742
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 136010-136040 8 0.742
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1959039-1959069 8 0.742
CP031455_2 2.2|1281467|31|CP031455|CRT 1281467-1281497 31 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 355919-355949 8 0.742
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 MN693196 Marine virus AFVG_25M118, complete genome 2830-2861 8 0.75
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 264448-264479 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP019438 Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence 211959-211990 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 507377-507408 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 85282-85313 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 85307-85338 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 85304-85335 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 85420-85451 8 0.75
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 84432-84463 8 0.75
CP031455_3 3.3|1291320|33|CP031455|PILER-CR,CRT 1291320-1291352 33 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 23581-23613 8 0.758
CP031455_3 3.4|1291381|33|CP031455|PILER-CR,CRT 1291381-1291413 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1835680-1835712 8 0.758
CP031455_3 3.4|1291381|33|CP031455|PILER-CR,CRT 1291381-1291413 33 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 614410-614442 8 0.758
CP031455_3 3.4|1291381|33|CP031455|PILER-CR,CRT 1291381-1291413 33 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1028253-1028285 8 0.758
CP031455_3 3.4|1291381|33|CP031455|PILER-CR,CRT 1291381-1291413 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 117192-117224 8 0.758
CP031455_3 3.9|1291686|33|CP031455|PILER-CR,CRT 1291686-1291718 33 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 188267-188299 8 0.758
CP031455_3 3.9|1291686|33|CP031455|PILER-CR,CRT 1291686-1291718 33 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 529556-529588 8 0.758
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 MH727545 Mycobacterium phage DismalStressor, complete genome 18940-18971 8 0.75
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NC_026598 Mycobacterium phage Milly, complete genome 18940-18971 8 0.75
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 KX688047 Mycobacterium phage Marcoliusprime, complete genome 18940-18971 8 0.75
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 MF140408 Mycobacterium phage DismalFunk, complete genome 18940-18971 8 0.75
CP031455_3 3.13|1291321|32|CP031455|CRISPRCasFinder 1291321-1291352 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 23581-23612 8 0.75
CP031455_3 3.13|1291321|32|CP031455|CRISPRCasFinder 1291321-1291352 32 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 128857-128888 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1835680-1835711 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 614411-614442 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1028253-1028284 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 117192-117223 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP021360 Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence 32480-32511 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 45667-45698 8 0.75
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 31718-31749 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1875366-1875397 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP010417 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50b, complete sequence 4745-4776 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP010420 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence 92948-92979 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 858919-858950 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1314108-1314139 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 755353-755384 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1916494-1916525 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 504783-504814 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1567947-1567978 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1691655-1691686 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1350867-1350898 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1818047-1818078 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1503633-1503664 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1320232-1320263 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1316958-1316989 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1282976-1283007 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 672612-672643 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1371008-1371039 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1306349-1306380 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1371008-1371039 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1371008-1371039 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1306371-1306402 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1371012-1371043 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1306371-1306402 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1306371-1306402 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1371007-1371038 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1392921-1392952 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1306371-1306402 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1306371-1306402 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 635331-635362 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 635331-635362 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1317964-1317995 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1345286-1345317 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1401374-1401405 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1267098-1267129 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1389134-1389165 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1396428-1396459 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1144018-1144049 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1312949-1312980 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1731136-1731167 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1396591-1396622 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1330420-1330451 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1106270-1106301 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1355704-1355735 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1266120-1266151 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1308755-1308786 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1308746-1308777 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1507127-1507158 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1267090-1267121 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1266444-1266475 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1267081-1267112 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1720892-1720923 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1408055-1408086 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1507094-1507125 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1407312-1407343 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1505888-1505919 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1407312-1407343 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1505924-1505955 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1345427-1345458 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1407312-1407343 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1407312-1407343 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1407312-1407343 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1505924-1505955 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 647066-647097 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1505913-1505944 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1314205-1314236 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1345409-1345440 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1294867-1294898 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1346833-1346864 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1386986-1387017 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 777848-777879 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1505913-1505944 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1506914-1506945 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1505924-1505955 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1407315-1407346 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1505935-1505966 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1505736-1505767 8 0.75
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1345394-1345425 8 0.75
CP031455_3 3.17|1291565|32|CP031455|CRISPRCasFinder 1291565-1291596 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 1123993-1124024 8 0.75
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 CP000665 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA04, complete sequence 28648-28679 8 0.75
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 529556-529587 8 0.75
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP021374 Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence 46777-46808 8 0.75
CP031455_4 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392138-1392169 32 NZ_CP014677 Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence 92165-92196 8 0.75
CP031455_4 4.11|1392565|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392565-1392596 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 284917-284948 8 0.75
CP031455_4 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392626-1392657 32 KC139640 Salmonella phage FSL SP-107 putative tail fiber protein gene, partial cds; hypothetical proteins, putative baseplate component, hypothetical protein, putative baseplate assembly protein, hypothetical proteins, structural protein, hypothetical proteins, major capsid protein, structural protein, putative prohead protease, hypothetical proteins, terminase large subunit, and hypothetical protein genes, complete cds; tRNA-Cys, tRNA-OTHER, and tRNA-Phe genes, complete sequence; hypothetical protein gene, complete cds; tRNA-Gln, tRNA-Leu, tRNA-Gln, tRNA-Leu, tRNA-Val, tRNA-Thr, tRNA-Gly, tRNA-Ala, tRNA-Lys, and tRNA-Leu genes, complete sequence; hypothetical protein genes, complete cds; tRNA-Ile, tRNA-Met, tRNA-Lys, tRNA-Asp, tRNA-OTHER, tRNA-Asn, and tRNA-Met genes, complete sequence; hypothetical protein gene, complete cds; tRNA-Glu and tRNA-Pro genes, complete sequence; hypothetical proteins, putative tail protein, lysin, and hypothetical proteins genes, complete cds; and hypothetical protein gene, partial cds 30744-30775 8 0.75
CP031455_4 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392626-1392657 32 MN850610 Escherichia phage andreotti, complete genome 76384-76415 8 0.75
CP031455_4 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392626-1392657 32 MN908690 Microbacterium phage Hubbs, complete genome 34850-34881 8 0.75
CP031455_4 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392626-1392657 32 MK937596 Microbacterium phage PhillyPhilly, complete genome 34231-34262 8 0.75
CP031455_4 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392687-1392718 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 986422-986453 8 0.75
CP031455_4 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392687-1392718 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 991102-991133 8 0.75
CP031455_4 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392687-1392718 32 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 111153-111184 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 307256-307287 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 258723-258754 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 136276-136307 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 601687-601718 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 75096-75127 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 504396-504427 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 404026-404057 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 54063-54094 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 151328-151359 8 0.75
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP045421 Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence 20596-20627 8 0.75
CP031455_4 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT 1392994-1393025 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 566479-566510 8 0.75
CP031455_4 4.19|1393055|32|CP031455|CRISPRCasFinder,CRT 1393055-1393086 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 461426-461457 8 0.75
CP031455_16 16.4|8316528|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316528-8316559 32 KY092484 Streptomyces phage Raleigh, complete genome 32067-32098 8 0.75
CP031455_16 16.5|8316589|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316589-8316620 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 413425-413456 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1306700-1306731 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 908796-908827 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 565686-565717 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 571006-571037 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 228807-228838 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 80540-80571 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3359921-3359952 8 0.75
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 839719-839750 8 0.75
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1730585-1730616 8 0.75
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NZ_CP026517 Deinococcus sp. NW-56 plasmid unnamed1, complete sequence 57928-57959 8 0.75
CP031455_16 16.16|8317260|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317260-8317291 32 CP000876 Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence 133256-133287 8 0.75
CP031455_16 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317382-8317413 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 697736-697767 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_021295 Burkholderia insecticola plasmid p2, complete sequence 196989-197020 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 657079-657110 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 46329-46360 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 119444-119475 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 15561-15592 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 229424-229455 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 444982-445013 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 468036-468067 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 66563-66594 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 MN369759 Mycobacterium phage Mithril, complete genome 57735-57766 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 MT818419 Mycobacterium phage Lolalove, complete genome 57581-57612 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 MH513970 Mycobacterium phage Hangman, complete genome 57620-57651 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 KT221034 Streptomyces phage SF3, complete genome 16689-16720 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_042035 Mycobacterium phage Zemanar, complete sequence 57447-57478 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 KT221033 Streptomyces phage SF1, complete genome 34389-34420 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_028968 Mycobacterium phage BrownCNA, complete genome 57880-57911 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 36032-36063 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 151727-151758 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 25074-25105 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 115371-115402 8 0.75
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 974598-974629 8 0.75
CP031455_17 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT 8322691-8322722 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 131038-131069 8 0.75
CP031455_17 17.6|8322874|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322874-8322905 32 MT498057 Microbacterium phage Cicada, complete genome 38095-38126 8 0.75
CP031455_17 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323118-8323149 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 638647-638678 8 0.75
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 479053-479084 8 0.75
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 367989-368020 8 0.75
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1133454-1133485 8 0.75
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1117460-1117491 8 0.75
CP031455_17 17.13|8323301|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323301-8323332 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 799541-799572 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 498667-498698 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 683364-683395 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 438817-438848 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 657025-657056 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 314042-314073 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 585257-585288 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP024583 Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence 218436-218467 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 340056-340087 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 203026-203057 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 126944-126975 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1402153-1402184 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_AP022339 Mameliella alba strain KU6B plasmid pKUB112, complete sequence 29929-29960 8 0.75
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 DQ115852 Cyanobacteria phage AS-1 contig_45 genomic sequence 221-252 8 0.75
CP031455_1 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277427-1277458 32 MF919491 Propionibacterium phage Aquarius, complete genome 23704-23735 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 248664-248695 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 268634-268665 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 466818-466849 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1346251-1346282 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 365756-365787 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 101407-101438 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 CP016643 Mycobacterium sp. djl-10 plasmid djl-10_3, complete sequence 15871-15902 9 0.719
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 MH632120 Mycobacterium phage Thonko, complete genome 15586-15617 9 0.719
CP031455_1 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277610-1277641 32 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 147592-147623 9 0.719
CP031455_1 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277610-1277641 32 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 107744-107775 9 0.719
CP031455_1 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277610-1277641 32 NC_019713 Vibrio phage vB_VpaS_MAR10, complete genome 26810-26841 9 0.719
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 4721-4752 9 0.719
CP031455_1 1.11|1277732|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277732-1277763 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 458703-458734 9 0.719
CP031455_1 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277915-1277946 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 521166-521197 9 0.719
CP031455_1 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277915-1277946 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 243685-243716 9 0.719
CP031455_1 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277915-1277946 32 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 108956-108987 9 0.719
CP031455_1 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277915-1277946 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 213264-213295 9 0.719
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 798416-798447 9 0.719
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 AJ550940 Bacteriophage phi-BT1 complete genome 20235-20266 9 0.719
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NC_004664 Streptomyces phage phiBT1, complete genome 20235-20266 9 0.719
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 136009-136040 9 0.719
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 872380-872411 9 0.719
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 474149-474180 9 0.719
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 131405-131436 9 0.719
CP031455_2 2.1|1281406|31|CP031455|CRT 1281406-1281436 31 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 157200-157230 9 0.71
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 136009-136040 9 0.719
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 872380-872411 9 0.719
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 474149-474180 9 0.719
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 131405-131436 9 0.719
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1959039-1959070 9 0.719
CP031455_2 2.5|1281467|32|CP031455|CRISPRCasFinder 1281467-1281498 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 355918-355949 9 0.719
CP031455_3 3.3|1291320|33|CP031455|PILER-CR,CRT 1291320-1291352 33 NZ_CP021405 Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence 73842-73874 9 0.727
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1875366-1875398 9 0.727
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP010417 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50b, complete sequence 4744-4776 9 0.727
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP010420 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence 92948-92980 9 0.727
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 471183-471215 9 0.727
CP031455_3 3.7|1291564|33|CP031455|PILER-CR,CRT 1291564-1291596 33 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 1123992-1124024 9 0.727
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 999795-999826 9 0.719
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 461474-461505 9 0.719
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 478194-478225 9 0.719
CP031455_3 3.13|1291321|32|CP031455|CRISPRCasFinder 1291321-1291352 32 NZ_CP021405 Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence 73842-73873 9 0.719
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 720183-720214 9 0.719
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 300477-300508 9 0.719
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 26746-26777 9 0.719
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 371297-371328 9 0.719
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 471184-471215 9 0.719
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 96423-96454 9 0.719
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 56915-56946 9 0.719
CP031455_3 3.15|1291443|32|CP031455|CRISPRCasFinder 1291443-1291474 32 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 149585-149616 9 0.719
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 385478-385509 9 0.719
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 257237-257268 9 0.719
CP031455_4 4.3|1392077|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392077-1392108 32 MN694416 Marine virus AFVG_250M895, complete genome 16041-16072 9 0.719
CP031455_4 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392687-1392718 32 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 309540-309571 9 0.719
CP031455_4 4.14|1392748|34|CP031455|CRISPRCasFinder,CRT 1392748-1392781 34 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 245171-245204 9 0.735
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 943111-943142 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 400881-400912 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 MN284895 Mycobacterium phage Marshawn, complete genome 56066-56097 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1134261-1134292 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP047174 Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence 88883-88914 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 120716-120747 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1134264-1134295 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 53003-53034 9 0.719
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 727904-727935 9 0.719
CP031455_4 4.19|1393055|32|CP031455|CRISPRCasFinder,CRT 1393055-1393086 32 NC_019933 Xanthomonas phage CP1 DNA, complete genome 6483-6514 9 0.719
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 368985-369016 9 0.719
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 371665-371696 9 0.719
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 370078-370109 9 0.719
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP011277 Planctomyces sp. SH-PL62 plasmid pPL62-4, complete sequence 7160-7191 9 0.719
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 MK759884 Salmonella phage vB_SenM_SB18, complete genome 70832-70863 9 0.719
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 MH426725 Erwinia phage SunLIRen, complete genome 70573-70604 9 0.719
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 NC_011811 Erwinia phage phiEa21-4, complete genome 70590-70621 9 0.719
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 MN304824 Catenulispora phage 69_17, complete genome 26312-26343 9 0.719
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 487412-487443 9 0.719
CP031455_16 16.12|8317016|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317016-8317047 32 NZ_CP044332 Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence 20338-20369 9 0.719
CP031455_16 16.12|8317016|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317016-8317047 32 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 354093-354124 9 0.719
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 364103-364134 9 0.719
CP031455_16 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317199-8317230 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 244653-244684 9 0.719
CP031455_16 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317382-8317413 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 865193-865224 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 763119-763150 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 178888-178919 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP047174 Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence 122008-122039 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_LR134458 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence 26465-26496 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 609781-609812 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 67057-67088 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NC_016907 Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence 144377-144408 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 11676-11707 9 0.719
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 264082-264113 9 0.719
CP031455_17 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT 8322691-8322722 32 NC_021209 Sinorhizobium sp. M14 plasmid pSinA, complete sequence 11660-11691 9 0.719
CP031455_17 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT 8322691-8322722 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 350649-350680 9 0.719
CP031455_17 17.5|8322813|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322813-8322844 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 283095-283126 9 0.719
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP024587 Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence 32626-32657 9 0.719
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 342837-342868 9 0.719
CP031455_17 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323118-8323149 32 NZ_CP027324 Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence 74755-74786 9 0.719
CP031455_17 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323118-8323149 32 NZ_CP025805 Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence 107341-107372 9 0.719
CP031455_17 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323240-8323271 32 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 39841-39872 9 0.719
CP031455_17 17.16|8323484|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323484-8323515 32 NC_016110 Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence 104119-104150 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 2377-2408 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 207081-207112 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_014811 Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence 152631-152662 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 19499-19530 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 522347-522378 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 429526-429557 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 974418-974449 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1354955-1354986 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 202696-202727 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 647194-647225 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 943104-943135 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 974502-974533 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 974498-974529 9 0.719
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 974483-974514 9 0.719
CP031455_1 1.3|1277244|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277244-1277275 32 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 44172-44203 10 0.688
CP031455_1 1.7|1277488|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277488-1277519 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 467052-467083 10 0.688
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP041158 Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence 16145-16176 10 0.688
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_CP044991 Deinococcus sp. AJ005 plasmid p115k, complete sequence 857-888 10 0.688
CP031455_1 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277671-1277702 32 MG214783 Sinorhizobium phage HMSP1-Susan, complete genome 38904-38935 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 15700-15731 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 262297-262328 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 15707-15738 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 217602-217633 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 15699-15730 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 455615-455646 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 468455-468486 10 0.688
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 93481-93512 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 275718-275749 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1428100-1428131 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1512152-1512183 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 270739-270770 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1032189-1032220 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 887619-887650 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 616522-616553 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 520666-520697 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 152017-152048 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 692533-692564 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 744903-744934 10 0.688
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1180026-1180057 10 0.688
CP031455_1 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278098-1278129 32 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 33531-33562 10 0.688
CP031455_1 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278098-1278129 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 1145292-1145323 10 0.688
CP031455_1 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278220-1278251 32 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 157200-157231 10 0.688
CP031455_2 2.3|1281528|31|CP031455|CRT 1281528-1281558 31 MT701595 Streptomyces phage Shaeky, complete genome 13264-13294 10 0.677
CP031455_2 2.4|1281406|32|CP031455|CRISPRCasFinder 1281406-1281437 32 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 157200-157231 10 0.688
CP031455_2 2.6|1281528|32|CP031455|CRISPRCasFinder 1281528-1281559 32 MT701595 Streptomyces phage Shaeky, complete genome 13264-13295 10 0.688
CP031455_3 3.5|1291442|33|CP031455|PILER-CR,CRT 1291442-1291474 33 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 371297-371329 10 0.697
CP031455_3 3.11|1291199|32|CP031455|CRISPRCasFinder 1291199-1291230 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 8138-8169 10 0.688
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 564869-564900 10 0.688
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 241877-241908 10 0.688
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 87597-87628 10 0.688
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1119968-1119999 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 276959-276990 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 276931-276962 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1725567-1725598 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1742272-1742303 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 276764-276795 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 276751-276782 10 0.688
CP031455_3 3.20|1291748|32|CP031455|CRISPRCasFinder 1291748-1291779 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1706517-1706548 10 0.688
CP031455_4 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392016-1392047 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 456198-456229 10 0.688
CP031455_4 4.5|1392199|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392199-1392230 32 MN234206 Arthrobacter phage Racecar, complete genome 127111-127142 10 0.688
CP031455_4 4.6|1392260|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392260-1392291 32 MH622937 Myoviridae sp. isolate ctcg_2, complete genome 18116-18147 10 0.688
CP031455_4 4.8|1392382|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392382-1392413 32 NZ_CP040989 Vibrio furnissii strain FDAARGOS_777 plasmid unnamed1, complete sequence 31367-31398 10 0.688
CP031455_4 4.10|1392504|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392504-1392535 32 NC_015409 Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence 4084-4115 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 357139-357170 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_LT900339 Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2 41966-41997 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 101218-101249 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_006672 Gluconobacter oxydans 621H plasmid pGOX1, complete sequence 41965-41996 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NC_006673 Gluconobacter oxydans 621H plasmid pGOX2, complete sequence 1691-1722 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP016288 Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence 5356-5387 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 836251-836282 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP043044 Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence 94184-94215 10 0.688
CP031455_4 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT 1392811-1392842 32 NZ_CP022669 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence 253572-253603 10 0.688
CP031455_4 4.17|1392933|32|CP031455|CRISPRCasFinder,CRT 1392933-1392964 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 89213-89244 10 0.688
CP031455_4 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT 1392994-1393025 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 51997-52028 10 0.688
CP031455_16 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316406-8316437 32 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 18442-18473 10 0.688
CP031455_16 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT 8316711-8316742 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 76225-76256 10 0.688
CP031455_16 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT 8316772-8316803 32 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 21171-21202 10 0.688
CP031455_16 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316833-8316864 32 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 29279-29310 10 0.688
CP031455_16 16.11|8316955|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8316955-8316986 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 41467-41498 10 0.688
CP031455_16 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317077-8317108 32 AY320035 Bacteriophage VWB, complete genome 43859-43890 10 0.688
CP031455_16 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317077-8317108 32 NC_005345 Streptomyces phage VWB, complete genome 43859-43890 10 0.688
CP031455_16 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317382-8317413 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 214039-214070 10 0.688
CP031455_16 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8317443-8317474 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2471957-2471988 10 0.688
CP031455_17 17.2|8322630|32|CP031455|CRISPRCasFinder,CRT 8322630-8322661 32 MT316461 Streptomyces phage Galactica, complete genome 17764-17795 10 0.688
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 389789-389820 10 0.688
CP031455_17 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8322935-8322966 32 NZ_CP013267 Sphingobium baderi strain DE-13 plasmid pDE3, complete sequence 3431-3462 10 0.688
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 MH926056 Corynebacterium phage Cruella, complete genome 23892-23923 10 0.688
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 MG198776 Corynebacterium phage C3PO, complete genome 23892-23923 10 0.688
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NC_042086 Corynebacterium phage Darwin, complete genome 23577-23608 10 0.688
CP031455_17 17.13|8323301|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323301-8323332 32 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 63422-63453 10 0.688
CP031455_17 17.16|8323484|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323484-8323515 32 NZ_CP007144 Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence 41277-41308 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_CP023440 Thauera sp. K11 plasmid pTX1, complete sequence 68630-68661 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 112448-112479 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 KU204984 Pseudomonas phage AAT-1, complete genome 51866-51897 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 NC_005887 Burkholderia phage BcepC6B, complete genome 17410-17441 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 AY605181 Burkholderia cepacia complex phage BcepC6B, complete genome 17410-17441 10 0.688
CP031455_17 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323545-8323576 32 KR011061 Skermania phage SPI1, complete genome 7904-7935 10 0.688
CP031455_1 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277549-1277580 32 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 217578-217609 11 0.656
CP031455_1 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1277854-1277885 32 NZ_CP044103 Streptococcus dysgalactiae strain FDAARGOS_654 plasmid unnamed1 14845-14876 11 0.656
CP031455_1 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1278037-1278068 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 748378-748409 11 0.656
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 276959-276991 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 276931-276963 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1725566-1725598 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1742271-1742303 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 276764-276796 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 276751-276783 11 0.667
CP031455_3 3.10|1291747|33|CP031455|PILER-CR,CRT 1291747-1291779 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1706516-1706548 11 0.667
CP031455_3 3.13|1291321|32|CP031455|CRISPRCasFinder 1291321-1291352 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 94280-94311 11 0.656
CP031455_3 3.14|1291382|32|CP031455|CRISPRCasFinder 1291382-1291413 32 KU708004 Pseudomonas phage phiAH14a, complete genome 32200-32231 11 0.656
CP031455_3 3.19|1291687|32|CP031455|CRISPRCasFinder 1291687-1291718 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 161294-161325 11 0.656
CP031455_17 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR 8323179-8323210 32 NC_013698 Clavibacter phage CMP1, complete genome 27146-27177 11 0.656
CP031455_4 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392016-1392047 32 NZ_CP010589 Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence 52356-52387 14 0.562
CP031455_4 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392016-1392047 32 NZ_CP010674 Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence 52356-52387 14 0.562
CP031455_4 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392016-1392047 32 NC_023138 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence 52428-52459 14 0.562
CP031455_4 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT 1392016-1392047 32 NZ_CP010637 Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence 52356-52387 14 0.562

1. spacer 16.14|8317138|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 0, identity: 1.0 

gctcccacagaccgcttgacgatctataggag	CRISPR spacer
gctcccacagaccgcttgacgatctataggag	Protospacer
********************************

2. spacer 16.14|8317138|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 0, identity: 1.0 

gctcccacagaccgcttgacgatctataggag	CRISPR spacer
gctcccacagaccgcttgacgatctataggag	Protospacer
********************************

3. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 1, identity: 0.969 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagatccgcgagaaaggcaaggaaggccacgt	Protospacer
**************.*****************

4. spacer 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 2, identity: 0.938 

cggtggcggatctacggccccacccggcaggc	CRISPR spacer
cggtggaagatctacggccccacccggcaggc	Protospacer
****** .************************

5. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 3, identity: 0.906 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gaccacgcgctggtcgagcgcgtcggcatcgc	Protospacer
***.************************  **

6. spacer 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 5, identity: 0.844 

cggtggcggatctacggccccacccggcaggc	CRISPR spacer
cggtggcggatctacggcaccacccgcccgtt	Protospacer
****************** ******* * * .

7. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 5, identity: 0.844 

-acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gacgaaagc-agcttgacggccttcacgaagtc	Protospacer
 ***.* ** *************** *** ***

8. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049912 (Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

-acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gacgaaagc-agcttgacggccttcacgaagtc	Protospacer
 ***.* ** *************** *** ***

9. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022425 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence) position: , mismatch: 5, identity: 0.844 

-acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gacgaaagc-agcttgacggccttcacgaagtc	Protospacer
 ***.* ** *************** *** ***

10. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_014154 (Thiomonas intermedia K12 plasmid pTINT01, complete sequence) position: , mismatch: 5, identity: 0.844 

-acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gacgaaagc-agcttgacggccttcacgaagtc	Protospacer
 ***.* ** *************** *** ***

11. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 5, identity: 0.844 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gtcgaggcccacgccgccagctcgtcgatgct	Protospacer
*.* ***** ************** ***** *

12. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 5, identity: 0.844 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gtcgaggcccacgccgccagctcgtcgatgct	Protospacer
*.* ***** ************** ***** *

13. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 5, identity: 0.844 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gtcgaggcccacgccgccagctcgtcgatgct	Protospacer
*.* ***** ************** ***** *

14. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

tcgtcg-gccccgcccgcccgccgtgttcctcc	CRISPR spacer
-ggccgcgccccgcccgcccgccgtggtccgcc	Protospacer
  *.** ******************* *** **

15. spacer 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 5, identity: 0.844 

aaggacaagcagtgcctcgcggctgtcggggt-	CRISPR spacer
aaggacaagcagtgcctcaaggc-gtcgcagtt	Protospacer
******************. *** **** .**

16. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to MK759884 (Salmonella phage vB_SenM_SB18, complete genome) position: , mismatch: 5, identity: 0.844 

-cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
ccaca-gtacggtgatgatgatgacggcgacga	Protospacer
 **** *  **** ******** **********

17. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to MH426725 (Erwinia phage SunLIRen, complete genome) position: , mismatch: 5, identity: 0.844 

-cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
ccaca-gtacggtgatgatgatgacggcgacga	Protospacer
 **** *  **** ******** **********

18. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MK033137 (UNVERIFIED: Pseudomonas phage UNO-SLW1, complete genome) position: , mismatch: 5, identity: 0.844 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagttccgcgtgaagggcaaggaaggcggtgt	Protospacer
*** ****** **************** ..**

19. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX449362 (Pseudomonas phage UNO-SLW3, complete genome) position: , mismatch: 5, identity: 0.844 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagttccgcgtgaagggcaaggaaggcggtgt	Protospacer
*** ****** **************** ..**

20. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX449363 (Pseudomonas phage UNO-SLW4, complete genome) position: , mismatch: 5, identity: 0.844 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagttccgcgtgaagggcaaggaaggcggtgt	Protospacer
*** ****** **************** ..**

21. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_047873 (Pseudomonas phage UNO-SLW1, complete genome) position: , mismatch: 5, identity: 0.844 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagttccgcgtgaagggcaaggaaggcggtgt	Protospacer
*** ****** **************** ..**

22. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX449361 (Pseudomonas phage UNO-SLW2, complete genome) position: , mismatch: 5, identity: 0.844 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
gagttccgcgtgaagggcaaggaaggcggtgt	Protospacer
*** ****** **************** ..**

23. spacer 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

cggtggcggatctacggccccacccggcaggc	CRISPR spacer
cggtggaggatctacggcaccacccgcccgtt	Protospacer
****** *********** ******* * * .

24. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 6, identity: 0.812 

-cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
acgtcgc-cgttgagacgctcgaccccgcaggc	Protospacer
 **  ** ******* ******.******** *

25. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 6, identity: 0.812 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
tcgtacgcgagcttgagggccttctccagctc	Protospacer
 ** ************ ********* *  **

26. spacer 2.3|1281528|31|CP031455|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.806 

cggcacaggcactgatccccgtggactaccg	CRISPR spacer
cggcacaggaaatgatccccgtgcccgcccg	Protospacer
********* * ***********  *  ***

27. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.812 

--tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
actggaaga--acggggttgagcgcgcccgggtc	Protospacer
  ***. **  ****************** .***

28. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.812 

--tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
actggaaga--acggggttgagcgcgcccgggtc	Protospacer
  ***. **  ****************** .***

29. spacer 3.1|1291198|33|CP031455|PILER-CR,CRT matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 6, identity: 0.818 

ggcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
cgtcgaggcccacgccgccagctcgtcgatgct	Protospacer
 *.* ***** ************** ***** *

30. spacer 3.1|1291198|33|CP031455|PILER-CR,CRT matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 6, identity: 0.818 

ggcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
cgtcgaggcccacgccgccagctcgtcgatgct	Protospacer
 *.* ***** ************** ***** *

31. spacer 3.1|1291198|33|CP031455|PILER-CR,CRT matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 6, identity: 0.818 

ggcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
cgtcgaggcccacgccgccagctcgtcgatgct	Protospacer
 *.* ***** ************** ***** *

32. spacer 3.8|1291625|33|CP031455|PILER-CR,CRT matches to CP033573 (Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence) position: , mismatch: 6, identity: 0.818 

--gcggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
tagcggct--ggcccagtgccggaactgctccgga	Protospacer
  ****.*  *** ******** ***********

33. spacer 3.8|1291625|33|CP031455|PILER-CR,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 6, identity: 0.818 

--gcggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
tagcggct--ggcccagtgccggaactgctccgga	Protospacer
  ****.*  *** ******** ***********

34. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818 

atcgtcg-gccccgcccgcccgccgtgttcctcc	CRISPR spacer
-cggccgcgccccgcccgcccgccgtggtccgcc	Protospacer
 . *.** ******************* *** **

35. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 6, identity: 0.818 

atcgtc-ggccccgcccgcccgccgtgttcctcc	CRISPR spacer
-tggtctaaccccgcccgcccgccgcgttcctca	Protospacer
 * *** ..****************.*******

36. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

--gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
tggccgag--caacgccgccatcgcgacgatggg	Protospacer
  *** **  *********** * *********

37. spacer 3.18|1291626|32|CP031455|CRISPRCasFinder matches to CP033573 (Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence) position: , mismatch: 6, identity: 0.812 

--cggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
agcggct--ggcccagtgccggaactgctccgga	Protospacer
  ***.*  *** ******** ***********

38. spacer 3.18|1291626|32|CP031455|CRISPRCasFinder matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 6, identity: 0.812 

--cggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
agcggct--ggcccagtgccggaactgctccgga	Protospacer
  ***.*  *** ******** ***********

39. spacer 3.18|1291626|32|CP031455|CRISPRCasFinder matches to NZ_CP015616 (Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence) position: , mismatch: 6, identity: 0.812 

--cggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
aacggct--ggcacagtgccggaactgctccgga	Protospacer
  ***.*  ***.******** ***********

40. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to AY320035 (Bacteriophage VWB, complete genome) position: , mismatch: 6, identity: 0.812 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
acgacgagcccgacggccccgacgtcgagccg	Protospacer
** .****** ********** *******  *

41. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_005345 (Streptomyces phage VWB, complete genome) position: , mismatch: 6, identity: 0.812 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
acgacgagcccgacggccccgacgtcgagccg	Protospacer
** .****** ********** *******  *

42. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812 

-accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
tggcgcg-gctggacggcgccgtcgtcgaggac	Protospacer
 . **** **.******* *************

43. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 6, identity: 0.812 

accgc-gagccggacggccccgtcgtcgaggag	CRISPR spacer
-cggctgagcccgacggccccgttgtcgacaag	Protospacer
 * ** ***** ***********.***** .**

44. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.812 

accgcg-agccggacggccccgtcgtcgaggag	CRISPR spacer
-ccgtgccgccggacgcccccgtcgccgaggtg	Protospacer
 ***.*  ******** ********.***** *

45. spacer 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 6, identity: 0.812 

gatcgtgaggccatcagctgccgccttcgttg	CRISPR spacer
gatcgtgaggccatttgctgccgctgtggctg	Protospacer
**************. ********. * *.**

46. spacer 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 6, identity: 0.812 

gatcgtgaggccatcagctgccgccttcgttg	CRISPR spacer
gatcgtgaggccatttgctgccgctgtggctg	Protospacer
**************. ********. * *.**

47. spacer 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 6, identity: 0.812 

gatcgtgaggccatcagctgccgccttcgttg	CRISPR spacer
gatcgtgaggccatttgctgccgctgtggctg	Protospacer
**************. ********. * *.**

48. spacer 4.16|1392872|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 6, identity: 0.812 

gatcgtgaggccatcagctgccgccttcgttg	CRISPR spacer
gatcgtgaggccatttgctgccgctgtggctg	Protospacer
**************. ********. * *.**

49. spacer 4.17|1392933|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP045376 (Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence) position: , mismatch: 6, identity: 0.812 

tacgttgcgcagtacggcagttccgttgacct----	CRISPR spacer
tacggggcgcagtacggcagttc----gacctcgtc	Protospacer
****  *****************    *****

50. spacer 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.812 

aaggacaag-cagtgcctcgcggctgtcggggt	CRISPR spacer
-cgggcaggccagtgcctcgcggctgtgggcgt	Protospacer
  **.**.* ***************** ** **

51. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 6, identity: 0.812 

-ccggcctccgaccagctcacctacaccgccga	CRISPR spacer
gtcaacct-cgacaagctcacctacgccgccga	Protospacer
 .*..*** **** ***********.*******

52. spacer 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 6, identity: 0.812 

gcccggcgaagcgcggcagtccggtacaacca----	CRISPR spacer
gcccggcgaagcgcggcagttcg----aacccggac	Protospacer
********************.**    ****

53. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 6, identity: 0.812 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcctccgcctcggcgagcacggcgcccacctg	Protospacer
**  *****************.*****.**

54. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.812 

---tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
cgctcga---cctcggcgcgcaggacgcccgcctc	Protospacer
   ****   ******** *** ********** *

55. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.812 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgcccgcctcgacgagcacgacgtcgccgac	Protospacer
*** ********.***********.*  * **

56. spacer 17.6|8322874|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.812 

gggccgggcgtgatggtgactgtgccccatga-	CRISPR spacer
gtgccgggcgtggtgatgactgtg-ctgatgat	Protospacer
* **********.**.******** *. ****

57. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 6, identity: 0.812 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
gccggatcctgctggagcagcacggcggcgaa	Protospacer
*** *  .*******.******** *******

58. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

---gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
tcggcct---tctgctcgggcagcactccggcgat	Protospacer
   ****   ****** ********* *******

59. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

60. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

61. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

62. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

63. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

64. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

65. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

66. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

67. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

68. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

69. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

70. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

71. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

72. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

73. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

74. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

75. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

76. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

77. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

78. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

79. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

80. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

81. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

82. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

83. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

84. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcatcccgctcg	Protospacer
***  .******** **************. *

85. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 6, identity: 0.812 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
aacgacgcgctggtcgagggcgtcggcaagcg	Protospacer
.** ************** *********.*

86. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tggccgagatcagcgccgcctacgactatcag	Protospacer
.*******  ****************  **

87. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
aggtcgaccgcagcgccgcctacgccatgcgc	Protospacer
 **.*** **************** *.* * *

88. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
aggtcgaccgcagcgccgcctacgccatgcgc	Protospacer
 **.*** **************** *.* * *

89. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
cgatcgagcgcagcgccgactacaacgcggcc	Protospacer
**..************** ****.***.  **

90. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 7, identity: 0.781 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
aggtcgaccgcagcgccgcctacgccatgcgc	Protospacer
 **.*** **************** *.* * *

91. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MH617641 (Microviridae sp. isolate ctji855, complete genome) position: , mismatch: 7, identity: 0.781 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
acgatgccgagcttgacggcctcttcgatgtt	Protospacer
***.   ***************..*******.

92. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
aagtccgcgagcttgtcggccttgtcgacggc	Protospacer
* *  ********** ******* ****.* *

93. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
tgggcgatcacgaggttgatcgcgaggtaga	Protospacer
************.****** ****   .**

94. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
ggggcgatcacggcgttgatcgcgctgcacg	Protospacer
 ************ ***** *****. **

95. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccct	Protospacer
.******* *******.*******.* *  *

96. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccct	Protospacer
.******* *******.*******.* *  *

97. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccct	Protospacer
.******* *******.*******.* *  *

98. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccct	Protospacer
.******* *******.*******.* *  *

99. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 7, identity: 0.774 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccct	Protospacer
.******* *******.*******.* *  *

100. spacer 2.6|1281528|32|CP031455|CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.781 

cggcacaggcactgatccccgtggactaccgc	CRISPR spacer
cggcacaggaaatgatccccgtgcccgcccgg	Protospacer
********* * ***********  *  ***

101. spacer 3.1|1291198|33|CP031455|PILER-CR,CRT matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 7, identity: 0.788 

ggcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gttactggcccacgccgccagctcgtcgatgct	Protospacer
* . * **** ************** ***** *

102. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.788 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
gacgtcgcaggcgatgccgtgcgcgacgggcag	Protospacer
**** .  .**** *** ***************

103. spacer 3.8|1291625|33|CP031455|PILER-CR,CRT matches to NZ_CP015616 (Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence) position: , mismatch: 7, identity: 0.788 

--gcggttcgggcgcagtgccgtaactgctccggc	CRISPR spacer
taacggct--ggcacagtgccggaactgctccgga	Protospacer
  .***.*  ***.******** ***********

104. spacer 3.9|1291686|33|CP031455|PILER-CR,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

-gctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
ggccagtac-gcagctccgcaggcgtggcgaacc	Protospacer
 **.. *.* ******** *** ***********

105. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 7, identity: 0.781 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ttactggcccacgccgccagctcgtcgatgct	Protospacer
 . * **** ************** ***** *

106. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.781 

--gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ccgatcag--caacgccgccaccgcgacgatggc	Protospacer
  * .***  *********** * *********.

107. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 7, identity: 0.781 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gtcaaggccatcgccgacagctcgacgggggg	Protospacer
*.* ****** ***** **********. **

108. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 7, identity: 0.781 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gtcaaggccatcgccgacagctcgacgggggg	Protospacer
*.* ****** ***** **********. **

109. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcccaggc---caacgccgccagctcgacgatggt	CRISPR spacer
---cagacacacaatgccgccagatcgacgatgga	Protospacer
   ***.*   ***.******** **********

110. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to KJ510412 (Mycobacterium phage ZoeJ, complete genome) position: , mismatch: 7, identity: 0.781 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ccactggcccacgccgccagctcgtcgacgct	Protospacer
 * * **** ************** ***.* *

111. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
gagggcggtgcgctgccgtgcgcgacgggcag	Protospacer
. *. *.* ******* ***************

112. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.781 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
acgtcgcaggcgatgccgtgcgcgacgggcag	Protospacer
*** .  .**** *** ***************

113. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781 

---acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cgcaaggtc---gcgctgcgctgcgctacgggcag	Protospacer
   * *.**   ******** ***** ********

114. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781 

---acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cgcaaggtc---gcgctgcgctgcgctacgggcag	Protospacer
   * *.**   ******** ***** ********

115. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgacgaccgcgctgcggtgctcgacgcgcag	Protospacer
 ***. *  ************ ***** ****

116. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgatcagg-gcgctgcggtgcgcgacgggcag	CRISPR spacer
-cggtcgagcgcggtgcggtgcgcgacgggaat	Protospacer
 **.**..* *** **************** *

117. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.781 

---acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cgcaaggtc---gcgctgcgctgcgctacgggcag	Protospacer
   * *.**   ******** ***** ********

118. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

-ctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
gccagtac-gcagctccgcaggcgtggcgaacc	Protospacer
 *.. *.* ******** *** ***********

119. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 7, identity: 0.781 

ctgctg--cagcagctcctcagccgtggcgaacc	CRISPR spacer
--gccggccagcagcgcctcaggcgtggcgaaga	Protospacer
  **.*  ******* ****** *********

120. spacer 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014677 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence) position: , mismatch: 7, identity: 0.781 

tccgcccgtcaggacttcctgtcgg-accccat	CRISPR spacer
atcgaccgtcaggacttcctgtcggcggctca-	Protospacer
 .** ******************** . *.**

121. spacer 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014677 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence) position: , mismatch: 7, identity: 0.781 

tccgcccgtcaggacttcctgtcgg-accccat	CRISPR spacer
atcgaccgtcaggacttcctgtcggcggctca-	Protospacer
 .** ******************** . *.**

122. spacer 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014677 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence) position: , mismatch: 7, identity: 0.781 

tccgcccgtcaggacttcctgtcgg-accccat	CRISPR spacer
atcgaccgtcaggacttcctgtcggcggctca-	Protospacer
 .** ******************** . *.**

123. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ccggcgagccgggcggcaccgtcgtcgaacgg	Protospacer
 * *********.**** **********. .*

124. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.781 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
acgacggcgcggtcggccccggcgtcgaggag	Protospacer
** .**.  *** ******** **********

125. spacer 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 7, identity: 0.781 

---tgtccggcgtggtctcgtacaccaggtacacg	CRISPR spacer
gcatgc---gcgtggtctcgtacagcaggttcatg	Protospacer
   **.   *************** ***** **.*

126. spacer 16.4|8316528|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgtacgcctcgaccagtgagccgcgttggcc	CRISPR spacer
tggaccgagtcgaccagtgggccgcgttgtcc	Protospacer
* *  **  **********.********* **

127. spacer 16.5|8316589|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.781 

gacatggaggtcgagagcgtcaccgtgcctga-	CRISPR spacer
atcatggagggcgtgagcgtcaccg-gcgtggt	Protospacer
. ******** ** *********** ** **.

128. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 7, identity: 0.781 

-cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
gcccgcg-ccggtcatgatgatcgcggcaacgc	Protospacer
 * *..* ***************.****.***

129. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 7, identity: 0.781 

-cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
gcccgcg-ccggtcatgatgatcgcggcaacgc	Protospacer
 * *..* ***************.****.***

130. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MG812490 (Mycobacterium phage Holeinone, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

131. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MH001452 (Mycobacterium phage Kheth, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

132. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KT365402 (Mycobacterium phage Tres, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

133. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KM101117 (Mycobacterium phage LizLemon, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

134. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_043767 (Mycobacterium virus TA17a, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

135. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MG812491 (Mycobacterium phage ItsyBitsy1, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

136. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

137. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

138. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

139. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KT880194 (Mycobacterium phage Glass, complete genome) position: , mismatch: 7, identity: 0.781 

ccggc--ctccgaccagctcacctacaccgccga	CRISPR spacer
--ggcaagtccgacccgctcccctacaccgccac	Protospacer
  ***   ******* **** ***********.

140. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 7, identity: 0.781 

ccggcctc--cgaccagctcacctacaccgccga	CRISPR spacer
--gatctcgtcgaccagctcacctccaccaccgc	Protospacer
  *..***  ************** ****.***

141. spacer 16.10|8316894|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

--cccagcagacgatggacgccgacgctgatgaa	CRISPR spacer
ataccag--gacgatcgacgcggacgctgatgtt	Protospacer
   ****  ****** ***** **********

142. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024864 (Escherichia coli strain AR_0015 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 7, identity: 0.781 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
gcagagttcgtcataccgctcatcgtccggat	Protospacer
 * * *******.******.**********.

143. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_011413 (Escherichia coli SE11 plasmid pSE11-2, complete sequence) position: , mismatch: 7, identity: 0.781 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
gcagagttcgtcataccgctcatcgtccggat	Protospacer
 * * *******.******.**********.

144. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to CP054565 (Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence) position: , mismatch: 7, identity: 0.781 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
gcagagttcgtcataccgctcatcgtccggat	Protospacer
 * * *******.******.**********.

145. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010201 (Escherichia coli strain M10 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.781 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
gcagagttcgtcataccgctcatcgtccggat	Protospacer
 * * *******.******.**********.

146. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KY092484 (Streptomyces phage Raleigh, complete genome) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
cgcgccgcctcgacgaccacgacgcccgcctc	Protospacer
.  .********.*** ************* *

147. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gcgcccgccgcggcgagcacgacgccgccgag	Protospacer
 ** ***** ****************  * *

148. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023440 (Thauera sp. K11 plasmid pTX1, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcc-cgccac	CRISPR spacer
tgcaccgcatcggcgagcaccacgccacgctg-	Protospacer
*  ***** *********** ***** ***..

149. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac-	CRISPR spacer
gcgaccgcctcggccagcgcgacg-ctgccgta	Protospacer
 ************* ***.***** *.***..

150. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac-	CRISPR spacer
gcgaccgcctcggccagcgcgacg-ctgccgta	Protospacer
 ************* ***.***** *.***..

151. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgaccgccacggcgaccacgacgggcccgag	Protospacer
********* ****** *******  * * *

152. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttctc	Protospacer
 * **********.**** ******** .* *

153. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
ccgaccgcctcgccgagcgcgacgacgagcac	Protospacer
.*********** *****.***** * . ***

154. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.781 

-tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gacaacc-tctcggcgaacaagacgcccgccat	Protospacer
  *.*** .********.** ***********.

155. spacer 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.781 

aacgcctcctgggcgttcttcgccatgccggt	CRISPR spacer
tgcgcctcctgggcgttcttcgccttgttctt	Protospacer
 .********************** **..  *

156. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
tctttcatctgctggggccgcaagccggccat	Protospacer
 *.* ************* *** ****** *

157. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgatggcatcccgctcg	Protospacer
***  .******** ***.**********. *

158. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

159. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

160. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggcattccgctgg	Protospacer
***  .******** *********.****..*

161. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

162. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

163. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgacggtatcccgctgg	Protospacer
***  .******** ******.*******..*

164. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctcttcgatggcatcccgctcg	Protospacer
***  .******** ***.**********. *

165. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
ccgccggatcatccgcgacggcatccgggccg	Protospacer
*  ******* **.************ * * *

166. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagattctcttcgacggcatcccgctcg	Protospacer
***  .***.**** **************. *

167. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

168. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagattctcttcgacggcatcccgctcg	Protospacer
***  .***.**** **************. *

169. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagattctcttcgacggcatcccgctcg	Protospacer
***  .***.**** **************. *

170. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

171. spacer 17.8|8322996|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

catccggatcctctgcgacggcatcccgccag	CRISPR spacer
catgaagatcctgttcgacggcatcccgctcg	Protospacer
***  .****** * **************. *

172. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 7, identity: 0.781 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
tatgggcgcgagcagggcaaggaaggctacgt	Protospacer
 * .  ****** **************.****

173. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 7, identity: 0.781 

gagatccgcgagaagggcaaggaaggccacgt----	CRISPR spacer
gagctccgcgcgaagggcaagga----cacgaccga	Protospacer
*** ****** ************    ****

174. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 7, identity: 0.781 

gagatccgcgagaagggcaaggaaggccacgt----	CRISPR spacer
gagctccgcgcgaagggcaagga----cacgaccga	Protospacer
*** ****** ************    ****

175. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 7, identity: 0.781 

gagatccgcgagaagggcaaggaaggccacgt----	CRISPR spacer
gagctccgcgcgaagggcaagga----cacgaccga	Protospacer
*** ****** ************    ****

176. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 7, identity: 0.781 

gagatccgcgagaagggcaaggaaggccacgt----	CRISPR spacer
gagctccgcgcgaagggcaagga----cacgaccga	Protospacer
*** ****** ************    ****

177. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgcgcggg---gcactccgcccagctcgccgcct	CRISPR spacer
---cgccgacccgctcaccgcccagctcgccgcct	Protospacer
   *** *.   ** * ******************

178. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgcgcggg---gcactccgcccagctcgccgcct	CRISPR spacer
---cgccgacccgctcaccgcccagctcgccgcct	Protospacer
   *** *.   ** * ******************

179. spacer 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgggcggagggggagggccggcgtgtgagcgg--	CRISPR spacer
acggcggagggggagacccggc--gtgagccgct	Protospacer
  *************. *****  ****** *

180. spacer 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.781 

tgggcggagggggagggccggcgtgtgagcgg--	CRISPR spacer
acggcggagggggagacccggc--gtgagccgct	Protospacer
  *************. *****  ****** *

181. spacer 17.15|8323423|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgggcggagggggagggccggcgtgtgagcgg--	CRISPR spacer
acggcggagggggagacccggc--gtgagccgct	Protospacer
  *************. *****  ****** *

182. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MF150911 (Ralstonia phage DU_RP_II, complete genome) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
aagaacgcgctggtcgagcgcgtcggcgcgct	Protospacer
.*  ***********************. * .

183. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
aagaacgcgctggtcgagcgcgtgggcaagct	Protospacer
.*  ******************* ****.* .

184. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

185. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

186. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

187. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

188. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

189. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

190. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

191. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

192. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

193. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

194. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

195. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

196. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

197. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

198. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

199. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

200. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

201. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

202. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

203. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

204. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

205. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
accgatccgctgatggagcgcgtcggcagggc	Protospacer
. * *. *****.* *****************

206. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
caccacgcgctggtcgagcgcatcgcgaatgc	Protospacer
 **.*****************.***  *. **

207. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
caccacgcgctggtcgagcgcatcgcgaatgc	Protospacer
 **.*****************.***  *. **

208. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggcgaggcgctggtcgagcgcatcggctggtg	Protospacer
*.* * ***************.***** **

209. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggcgaggcgctggtcgagcgcatcggctggtg	Protospacer
*.* * ***************.***** **

210. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggcgaggcgctggtcgagcgcatcggctggtg	Protospacer
*.* * ***************.***** **

211. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggcgaggcgctggtcgagcgcatcggctggtg	Protospacer
*.* * ***************.***** **

212. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcg-gcagggc	CRISPR spacer
gcctacgccctggtcgagcgcgacgtgcacta-	Protospacer
* ****** ************* ** ***  .

213. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 7, identity: 0.781 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gccgacgccctggccgagcgcgtcggcgcggt	Protospacer
* * **** ****.*************. **.

214. spacer 1.3|1277244|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtgacccgcctgaccccgggcgaagcgcgc	CRISPR spacer
tggtgatccgcatgaccccgggcgagacggtg	Protospacer
* ****.**** *************..**

215. spacer 1.4|1277305|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 8, identity: 0.75 

acccaggcggctgaagaaaagcggcttcagag	CRISPR spacer
attacggcggctgaaaaaaagcggctacattg	Protospacer
*..  **********.********** **  *

216. spacer 1.7|1277488|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75 

cccttcgcgttggcgggtgagacggcgcgcgg	CRISPR spacer
cctccaggattggcggaagagacggcgcgcgg	Protospacer
**... * .*******. **************

217. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
cggccgggcgcagcgccgcctccgcctcctgc	Protospacer
******.************** ** * ... *

218. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
aggtcgaccgcagcgccgcctacgcgatgcgc	Protospacer
 **.*** ****************  .* * *

219. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
aggccgagcgcaccgccgccgacgcccgtacg	Protospacer
 *********** ******* *** *  * *

220. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_007801 (Jannaschia sp. CCS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tgtccgagcgcagctccgactacgacatcacg	Protospacer
.* *********** *** *******.*. *

221. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
tggagctcgcggagccgctcggcccgctcacc	Protospacer
.********. **************  . .**

222. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
agcacgcggtcgagccgctcggcaccgcagcc	Protospacer
 * *  . **.************ ********

223. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015745 (Shinella sp. HZN7 plasmid pShin-09, complete sequence) position: , mismatch: 8, identity: 0.75 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
cggagcgcgttgaaccgctcggcgatggggca	Protospacer
****** ******.*********  .* .**

224. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
tcgcgctcgtcgagcggctcggccccgaggtc	Protospacer
. * ******.**** *********** .*.*

225. spacer 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 8, identity: 0.75 

ggcaaaggggcgacggacctcctggcgaaaat	CRISPR spacer
ggcaacggggcgaccgacctcctcgtggagga	Protospacer
***** ******** ******** *.*.*..

226. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cccagcccgagcttgacgcccttgtcgatgcc	Protospacer
 * ..* *********** **** ******.*

227. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

228. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

229. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

230. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

231. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

232. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

233. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016621 (Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cggtattcgcgcttgtcggccttctcgatggc	Protospacer
  * *. ** ***** ************** *

234. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

acggacg-cgagcttgacggccttctcgatgtc	CRISPR spacer
-tgcgcgttgatcttgacgcccttctcgatgtt	Protospacer
 .* .** .** ******* ************.

235. spacer 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtaggcggtccacgcgcagatgcgggcggc	CRISPR spacer
gaggaggcggtcgacgcgcagctgcgggagca	Protospacer
  * ******** ******** ****** *

236. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MN693196 (Marine virus AFVG_25M118, complete genome) position: , mismatch: 8, identity: 0.75 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
catgccgtgctgccgctcaatccggtgccgct	Protospacer
  . *********.** ***********. **

237. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
ttgctcgcgttgctgcgcaatccggtgcagct	Protospacer
 * ..**.*.******************  **

238. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
ccccgcgcgctgctgcgcaatccggtgatct	Protospacer
 .*. **.******************* *..

239. spacer 2.1|1281406|31|CP031455|CRT matches to MN693196 (Marine virus AFVG_25M118, complete genome) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
catgccgtgctgccgctcaatccggtgccgc	Protospacer
  . *********.** ***********. *

240. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgc	Protospacer
*  .  ****** *********.****** *

241. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
ttgctcgcgttgctgcgcaatccggtgcagc	Protospacer
 * ..**.*.******************  *

242. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgc	Protospacer
*  .  ****** *********.****** *

243. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.742 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgc	Protospacer
*  .  ****** *********.****** *

244. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 8, identity: 0.742 

-----gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
tggtggt-----tgctgctgggcgatccggtgctta	Protospacer
     **     ******** **.***********

245. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
cgggcgagcacggcgttgagcgcggcgctcg	Protospacer
.****** ***** ********** * *

246. spacer 2.2|1281467|31|CP031455|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 8, identity: 0.742 

tgggcgatcacggggttgagcgcgccccagt	CRISPR spacer
acggcgatcacgatgttgagcgcgcttgagg	Protospacer
  **********. ***********.. **

247. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to MN693196 (Marine virus AFVG_25M118, complete genome) position: , mismatch: 8, identity: 0.75 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
catgccgtgctgccgctcaatccggtgccgct	Protospacer
  . *********.** ***********. **

248. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
ttgctcgcgttgctgcgcaatccggtgcagct	Protospacer
 * ..**.*.******************  **

249. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
tgggcgatcacgaggttgatcgcgaggtagat	Protospacer
************.****** ****   .** .

250. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
ggggcgatcacggcgttgatcgcgctgcacga	Protospacer
 ************ ***** *****. **

251. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccctt	Protospacer
.******* *******.*******.* *  *.

252. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccctt	Protospacer
.******* *******.*******.* *  *.

253. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccctt	Protospacer
.******* *******.*******.* *  *.

254. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccctt	Protospacer
.******* *******.*******.* *  *.

255. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 8, identity: 0.75 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgatgacggggtcgagcgcgtcaccctt	Protospacer
.******* *******.*******.* *  *.

256. spacer 3.3|1291320|33|CP031455|PILER-CR,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.758 

ggtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
ggtgaacgtgaagccggccagcgggttcgattc	Protospacer
***** ****** *********** . **  *

257. spacer 3.4|1291381|33|CP031455|PILER-CR,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758 

cccgcctcttccagcatggccgccatctggatc	CRISPR spacer
cccgcttcatccagcatggccgccaggtaatcc	Protospacer
*****.** ****************  *.. .*

258. spacer 3.4|1291381|33|CP031455|PILER-CR,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.758 

cccgcctcttccagcatggccgccatctggatc	CRISPR spacer
cccgcttcatccagcatggccgccaggtactcc	Protospacer
*****.** ****************  *.  .*

259. spacer 3.4|1291381|33|CP031455|PILER-CR,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.758 

cccgcctcttccagcatggccgccatctggatc	CRISPR spacer
cccgcttcatccagcatggccgccaggtactcc	Protospacer
*****.** ****************  *.  .*

260. spacer 3.4|1291381|33|CP031455|PILER-CR,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

cccgcctcttccagcatggccgccatctggatc	CRISPR spacer
cccgcttcgtccagcatggccgccaggtaatcc	Protospacer
*****.** ****************  *.. .*

261. spacer 3.9|1291686|33|CP031455|PILER-CR,CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 8, identity: 0.758 

-gctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
agccggc-cagcagcgcctcaggcgtggcgaaga	Protospacer
 **.* . ******* ****** *********

262. spacer 3.9|1291686|33|CP031455|PILER-CR,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.758 

gctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
gctgctgcggccgctcctcagccggatccatcg	Protospacer
********.** ************ . * * *

263. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 8, identity: 0.75 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ttactggcccacgccgccagctcgtcgacgct	Protospacer
 . * **** ************** ***.* *

264. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 8, identity: 0.75 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ttactggcccacgccgccagctcgtcgacgct	Protospacer
 . * **** ************** ***.* *

265. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 8, identity: 0.75 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ttactggcccacgccgccagctcgtcgacgct	Protospacer
 . * **** ************** ***.* *

266. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 8, identity: 0.75 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
ttactggcccacgccgccagctcgtcgacgct	Protospacer
 . * **** ************** ***.* *

267. spacer 3.13|1291321|32|CP031455|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
gtgaacgtgaagccggccagcgggttcgattc	Protospacer
**** ****** *********** . **  *

268. spacer 3.13|1291321|32|CP031455|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
ctgaccgtgatcccggccagcggcagcgcgcc	Protospacer
 ***.***** ************* .**.*.

269. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcttcatccagcatggccgccaggtaatcc	Protospacer
****.** ****************  *.. .*

270. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcttcatccagcatggccgccaggtactcc	Protospacer
****.** ****************  *.  .*

271. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcttcatccagcatggccgccaggtactcc	Protospacer
****.** ****************  *.  .*

272. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcttcgtccagcatggccgccaggtaatcc	Protospacer
****.** ****************  *.. .*

273. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP021360 (Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
caccgtggtccagcgtggccgccacctggatg	Protospacer
*  * *  ******.*********.******

274. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
caccgtggtccagcgtggccgccacctggatg	Protospacer
*  * *  ******.*********.******

275. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
caccgtggtccagcgtggccgccacctggatg	Protospacer
*  * *  ******.*********.******

276. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
atgatcagggcgacgcggtgcgcgacgccgcc	Protospacer
*.********** .*************

277. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP010417 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50b, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
acgatcagcccgctgcggtgcgcgatcatcgt	Protospacer
********  ***************. . *.

278. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
acgatcagcccgctgcggtgcgcgatcatcgt	Protospacer
********  ***************. . *.

279. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

280. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

281. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

282. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

283. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

284. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

285. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

286. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

287. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

288. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

289. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

290. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

291. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

292. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

293. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

294. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

295. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

296. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

297. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

298. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

299. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

300. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

301. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

302. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

303. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

304. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

305. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

306. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

307. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

308. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

309. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

310. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

311. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

312. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

313. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

314. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

315. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

316. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

317. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

318. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

319. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

320. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

321. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

322. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

323. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

324. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

325. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

326. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

327. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

328. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

329. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

330. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

331. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

332. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

333. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

334. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

335. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

336. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

337. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

338. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

339. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

340. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

341. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

342. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

343. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

344. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

345. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

346. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

347. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

348. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

349. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

350. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

351. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

352. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

353. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
ccgatcaggccgctgtggtgcgcgcccaccgg	Protospacer
 ******** *****.******** * . *.*

354. spacer 3.17|1291565|32|CP031455|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggatcgtgttgggtacggccacgccttcgaca	CRISPR spacer
acgacgtgtggggtacgaccacgccttcacca	Protospacer
. . ***** *******.**********. **

355. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to CP000665 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA04, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
ctgcggcagcagctcctcggccgggattaata	Protospacer
**** *************.**** *.. **.

356. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75 

ctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
ctgctgcggccgctcctcagccggatccatcg	Protospacer
*******.** ************ . * * *

357. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 8, identity: 0.75 

--tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
ggatatcga--ccgcccgcccgccgagttccgcc	Protospacer
   ..***.  ************** ***** **

358. spacer 4.4|1392138|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014677 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_3, complete sequence) position: , mismatch: 8, identity: 0.75 

tccgcccgtcaggacttcctgtcgg-accccat	CRISPR spacer
atcgaccgtcaggatttcctgtcggcggctca-	Protospacer
 .** *********.********** . *.**

359. spacer 4.11|1392565|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

agtgccg-actggcggaccagcgccacagcgga	CRISPR spacer
-acgccattctcgcggacctgcgccacagcggt	Protospacer
 ..***.  ** ******* ************

360. spacer 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to KC139640 (Salmonella phage FSL SP-107 putative tail fiber protein gene, partial cds; hypothetical proteins, putative baseplate component, hypothetical protein, putative baseplate assembly protein, hypothetical proteins, structural protein, hypothetical proteins, major capsid protein, structural protein, putative prohead protease, hypothetical proteins, terminase large subunit, and hypothetical protein genes, complete cds; tRNA-Cys, tRNA-OTHER, and tRNA-Phe genes, complete sequence; hypothetical protein gene, complete cds; tRNA-Gln, tRNA-Leu, tRNA-Gln, tRNA-Leu, tRNA-Val, tRNA-Thr, tRNA-Gly, tRNA-Ala, tRNA-Lys, and tRNA-Leu genes, complete sequence; hypothetical protein genes, complete cds; tRNA-Ile, tRNA-Met, tRNA-Lys, tRNA-Asp, tRNA-OTHER, tRNA-Asn, and tRNA-Met genes, complete sequence; hypothetical protein gene, complete cds; tRNA-Glu and tRNA-Pro genes, complete sequence; hypothetical proteins, putative tail protein, lysin, and hypothetical proteins genes, complete cds; and hypothetical protein gene, partial cds) position: , mismatch: 8, identity: 0.75 

aggccgttcgaagtgacctgctgagtgatgtg	CRISPR spacer
aggccgtttgaagtgaccttctgacctttgac	Protospacer
********.********** **** .  **

361. spacer 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MN850610 (Escherichia phage andreotti, complete genome) position: , mismatch: 8, identity: 0.75 

aggccgttcgaagtgacctgctgagtgatgtg	CRISPR spacer
aggccgtttgaagtgaccttctgacctttgac	Protospacer
********.********** **** .  **

362. spacer 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MN908690 (Microbacterium phage Hubbs, complete genome) position: , mismatch: 8, identity: 0.75 

aggccgt--tcgaagtgacctgctgagtgatgtg	CRISPR spacer
--tctgtcgccgacgtgacctgccgagtgatgtt	Protospacer
   *.**  .*** *********.*********

363. spacer 4.12|1392626|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MK937596 (Microbacterium phage PhillyPhilly, complete genome) position: , mismatch: 8, identity: 0.75 

aggccgt--tcgaagtgacctgctgagtgatgtg	CRISPR spacer
--tctgtcgccgacgtgacctgccgagtgatgtt	Protospacer
   *.**  .*** *********.*********

364. spacer 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggttgcctgtgagggcgcgttcggtgaggc	CRISPR spacer
cgggttgccggtgagcgcgcgttctatatagg	Protospacer
********* ***** ******** .*. .*

365. spacer 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75 

cgggttgcctgtgagggcgcgttcggtgaggc	CRISPR spacer
cgggttgccggtgagcgcgcgttctatatagg	Protospacer
********* ***** ******** .*. .*

366. spacer 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.75 

cgggttgcctgtgagggcgcgttcggtgaggc	CRISPR spacer
ctgaatgcctgtgcgggcgcgttccgtgcgcg	Protospacer
* *. ******** ********** *** *

367. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
tccgcgagccggtcggccccgtcgccgccttc	Protospacer
 *********** ***********.**

368. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
agaatcggccggacgccgccgtcgtcgaggag	Protospacer
*  .. .******** * **************

369. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
tggtggaggcggacggcaccgtcgtcgaggcg	Protospacer
     *** ******** ************ *

370. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
agcgtgagccggacggccccgtcggcgctctc	Protospacer
* **.******************* **

371. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ccggcaagccggacggcctcgtcgtcggcggc	Protospacer
 * **.************.********. *.

372. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
acaccgagccggacgcccccgccgtcgtctgg	Protospacer
**  *********** *****.*****   .*

373. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
accgcgaagcggacggccccgtcagcctcgac	Protospacer
*******. **************. *   **

374. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
cccgcgagcccgacggccccggcggggacccg	Protospacer
 ********* ********** **  **   *

375. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
tcgaggcggcgggcggcaccgtcgtcgaggag	Protospacer
 * . * * ***.**** **************

376. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP045421 (Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
aaagcctgccggacggccctgtcgtcgcggcc	Protospacer
*  **  ************.******* **

377. spacer 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tgtccggcgtggtctcgtacacca-ggtacacg	CRISPR spacer
ggtccggcgtggcctcgaacaccactgtgagc-	Protospacer
 ***********.**** ******  **. .*

378. spacer 4.19|1393055|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gcggcaaacgccgtggcccgcgggttcgcggt	CRISPR spacer
ccgtccgccgccgaggcgcgcgggttcgcggc	Protospacer
 ** * . ***** *** *************.

379. spacer 16.4|8316528|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KY092484 (Streptomyces phage Raleigh, complete genome) position: , mismatch: 8, identity: 0.75 

tcgtacgcctcgaccagtgagccgcgttggcc	CRISPR spacer
acgaacgcctcgaccagtgggccgacctgctc	Protospacer
 ** ***************.****  .** .*

380. spacer 16.5|8316589|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

gacatggaggtcgagagcgtcaccgtgcctga	CRISPR spacer
ggcgtcgaggtcgagagcgtcaccctcccgct	Protospacer
*.*.* ****************** * **

381. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gtcgccgcggtcgtcttcgcggtgtaccagct	Protospacer
. *  *****.***********.*******

382. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gtcgccgcggtcgtcttcgcggtgtaccagct	Protospacer
. *  *****.***********.*******

383. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gtcgccgcggtcgtcttcgcggtgtaccagct	Protospacer
. *  *****.***********.*******

384. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gtctgcgcggccgtctgcgcggcgtggcggag	Protospacer
. ************** ********. *.*..

385. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
ggctgcgcggccggctgcgcggcgtggcggag	Protospacer
.************ ** ********. *.*..

386. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
agctgcgcggccggctgcgcggcgcggtcggc	Protospacer
************* ** *******.. . **

387. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
cgcgaccgggccgtcgtcgccgcgtaccaggc	Protospacer
 ** .*  ******* **** **********

388. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gcctgcgcggccggctgcgcggcgtggcgggg	Protospacer
. *********** ** ********. *.**.

389. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75 

-cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
gcccgcg-cccgtcatgatgatcgcggcgacat	Protospacer
 * *..* ** ************.*******.

390. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
accgtgttcgtcgatccgcccatcgccatgtc	Protospacer
 ************  **********.*  *

391. spacer 16.16|8317260|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtcctgcggctggatcagtgtcggcgaaggg---	CRISPR spacer
cgtcctgcggctggagcagt---ggcgcacgaccc	Protospacer
 ************** ****   **** * *.

392. spacer 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75 

tcgggcaagggcgcggaggtgcgtgaggtgac	CRISPR spacer
gcgtcgacggccgcggaggtgcgtgcggtgag	Protospacer
 **   * ** ************** *****

393. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_021295 (Burkholderia insecticola plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
ctcaccgcctcggcgagcacgacgtgcgcatt	Protospacer
.. *********************. ***  .

394. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgaccacctcggcgagcaggacgcttcggcc	Protospacer
******.************ *****..    *

395. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
acgaccgccgcggcgagcacgatgccggtggt	Protospacer
 ******** ************.*** *. ..

396. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
ggtaccgcctcagcgaccacgacgccgcgcac	Protospacer
   ********.**** *********   ***

397. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aaaatcgcctcgaccagcacgacgcccgcgat	Protospacer
  .*.*******.* ************** *.

398. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aaaatcgcctcgaccagcacgacgcccgcgat	Protospacer
  .*.*******.* ************** *.

399. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgaccgcctcggggaggacgacctagccgac	Protospacer
************* *** ***** .   * **

400. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.75 

--tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
ctccggt--tctcggcgagcacgacggccgcgac	Protospacer
  .**..  .**************** **** **

401. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aaaatcgcctcgaccagcacgacgcccgcgat	Protospacer
  .*.*******.* ************** *.

402. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MN369759 (Mycobacterium phage Mithril, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttgtc	Protospacer
 * **********.**** ******** .  *

403. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttgtc	Protospacer
 * **********.**** ******** .  *

404. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttgtc	Protospacer
 * **********.**** ******** .  *

405. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgaccgcctcggcgagctcggcgatatcggc	Protospacer
****************** **.** .  * .*

406. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttgtc	Protospacer
 * **********.**** ******** .  *

407. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KT221033 (Streptomyces phage SF1, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcgaccgcctcggcgagctcggcgatatcggc	Protospacer
****************** **.** .  * .*

408. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_028968 (Mycobacterium phage BrownCNA, complete genome) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gccaccgcctcggtgagcccgacgcccttgtc	Protospacer
 * **********.**** ******** .  *

409. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
ccgatctcctcggcgagcacgacgacatcgat	Protospacer
.***.* ***************** *  * *.

410. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gagaccgcctcggtgaccacgacgcacccggc	Protospacer
  ***********.** ******** * * .*

411. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gcgacggcctcggcgagcacgtcgtcgggcca	Protospacer
 **** *************** **.* * *

412. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gcgccggcctcggcgagcacgacgaaccgctc	Protospacer
 ** * ******************  *  * *

413. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
acttgcgcgtcggcgagcaggacgcccggaac	Protospacer
 *   *** ********** ********  **

414. spacer 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75 

aacgcctcctgggcgttcttcgccatgccggt	CRISPR spacer
acccgggccagggcgttcatcgccatgccgct	Protospacer
* *    ** ******** *********** *

415. spacer 17.6|8322874|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MT498057 (Microbacterium phage Cicada, complete genome) position: , mismatch: 8, identity: 0.75 

gggccgggcgtgatggtgactgtgccccatga	CRISPR spacer
tggccgggcgtgatggtgccggtggtgcaggt	Protospacer
 ***************** * *** . ** *

416. spacer 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75 

gtgttcaggctgtgcggtcacggcgcctcctc	CRISPR spacer
gttcgcaggcggggcggtcacggcgcctacaa	Protospacer
** . ***** * *************** *

417. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.75 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
ggcgtggacgagaagggcaaggaaggcgacgg	Protospacer
*. .*  .******************* ***

418. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 8, identity: 0.75 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
ggcctggacgagaagggcaaggaaggcgacgg	Protospacer
*.  *  .******************* ***

419. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgcgcggggcactccgcccagctcgccgcct	CRISPR spacer
gcagcagccgcacagcgcccagctcgccgcct	Protospacer
**.   *  ****  *****************

420. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgcgcggggcactccgcccagctcgccgcct	CRISPR spacer
cctcgaccggcacgccgcccagcttgccgccg	Protospacer
 * **   ***** **********.******

421. spacer 17.13|8323301|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.75 

cggtcgagattgggggccacgattccgccggc	CRISPR spacer
gtgtcgagattggcggccgcgattccacgatc	Protospacer
  *********** ****.*******.* . *

422. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
acagatccgctgatggagcgcgtcggcagggc	Protospacer
.   *. *****.* *****************

423. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
acagatccgctgatggagcgcgtcggcagggc	Protospacer
.   *. *****.* *****************

424. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
acagatccgctgatggagcgcgtcggcagggc	Protospacer
.   *. *****.* *****************

425. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
acagatccgctgatggagcgcgtcggcagggc	Protospacer
.   *. *****.* *****************

426. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
aaaaccgcgctggtcgagcgcggcggcacgct	Protospacer
.*   ***************** ***** * .

427. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
acagatccgctgatggagcgcgtcggcagggc	Protospacer
.   *. *****.* *****************

428. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ttgcaggcgatggtcgagcgcgacggcaggcc	Protospacer
   .* *** ************ ******* *

429. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
cattatgcgctggacgagcgcgtcggacggtg	Protospacer
 *.**.******* ************  **

430. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggcgacgcgctggtcgacctcgtcggccgctg	Protospacer
*.* ************* * ******* *

431. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtcgacacgctggtcgagcgcgtgggcgtgtg	Protospacer
* * **.**************** ***. *

432. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gccgccgcgctggtcgagcgcgaccgcatcga	Protospacer
* *  ***************** * ***  *

433. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022339 (Mameliella alba strain KU6B plasmid pKUB112, complete sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtcacctcgctggtcgagcgcgtcagccggtt	Protospacer
* *  * *****************.** ** .

434. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to DQ115852 (Cyanobacteria phage AS-1 contig_45 genomic sequence) position: , mismatch: 8, identity: 0.75 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggccccgagctggtcgagcgcatcggcatccc	Protospacer
*.*. ** *************.******   *

435. spacer 1.6|1277427|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MF919491 (Propionibacterium phage Aquarius, complete genome) position: , mismatch: 9, identity: 0.719 

cggtggcggatctacggccccacccggcaggc	CRISPR spacer
tggtggatgatctacggccccacctttgtgga	Protospacer
.*****  ****************.    **

436. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tggccgagatcagcgccgcctacgattaccag	Protospacer
.*******  ***************.  .*

437. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
cggccggccgcagcgccgcctacacgatcctg	Protospacer
******. ***************.  .*.*.

438. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tcgcccagcgcagcgccgccttcgagggagcg	Protospacer
. *** *************** *** *   *

439. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tcgcccagcgcagcgccgccttcgagggagcg	Protospacer
. *** *************** *** *   *

440. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
cggccggccgcagcgccgcctacacgatcctg	Protospacer
******. ***************.  .*.*.

441. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tggccgggcgcagcgccgcctccggggccgcg	Protospacer
.*****.************** **. *.. *

442. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to CP016643 (Mycobacterium sp. djl-10 plasmid djl-10_3, complete sequence) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
acgccgagcgccgcggcgcctacgaggacttc	Protospacer
  ********* *** ********* * ...*

443. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 9, identity: 0.719 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
tcgccgagcgcagcgccgccgaggatatggcg	Protospacer
. ****************** * **..*  *

444. spacer 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgctcgtgggcaacaccctgcatcccgaccc	CRISPR spacer
aaatgcaacggcatcacgctgcatcccgaccc	Protospacer
* .. *.  **** *** **************

445. spacer 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgctcgtgggcaacaccctgcatcccgaccc	CRISPR spacer
aaatgcaacggcatcacgctgcatcccgaccc	Protospacer
* .. *.  **** *** **************

446. spacer 1.9|1277610|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_019713 (Vibrio phage vB_VpaS_MAR10, complete genome) position: , mismatch: 9, identity: 0.719 

acgctcgtgggcaacaccctgcatcccgaccc	CRISPR spacer
cagctcgtcggcaagaccctgcatcgagttca	Protospacer
  ****** ***** **********  * .*

447. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.719 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
atcagctcgtcgagccgctcggcctcgacccg	Protospacer
   *******.*************.**   *

448. spacer 1.11|1277732|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719 

atccgcgctccatgccaccatggcaaaagcgc	CRISPR spacer
cgacgcgctccatgccaccccggcaaccgtgg	Protospacer
   **************** .*****  *.*

449. spacer 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaaaggggcgacggacctcctggcgaaaat	CRISPR spacer
caccgcgggccgacggacctcccggcgaagac	Protospacer
 .* . *** ************.******.*.

450. spacer 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaaaggggcgacggacctcctggcgaaaat	CRISPR spacer
caccgcgggccgacggacctcccggcgaagac	Protospacer
 .* . *** ************.******.*.

451. spacer 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaaaggggcgacggacctcctggcgaaaat	CRISPR spacer
caccgcgggccgacggacctcccggcgaagac	Protospacer
 .* . *** ************.******.*.

452. spacer 1.14|1277915|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaaaggggcgacggacctcctggcgaaaat	CRISPR spacer
caccgcgggccgacggacctcccggcgaagac	Protospacer
 .* . *** ************.******.*.

453. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gcgttcgcgagcttcacggccatctcgaacgg	Protospacer
.**  ********* ****** ******

454. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to AJ550940 (Bacteriophage phi-BT1 complete genome) position: , mismatch: 9, identity: 0.719 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gccttcgcgcgcttgccggccttctcgactgc	Protospacer
.*   **** ***** ************.  *

455. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_004664 (Streptomyces phage phiBT1, complete genome) position: , mismatch: 9, identity: 0.719 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gccttcgcgcgcttgccggccttctcgactgc	Protospacer
.*   **** ***** ************.  *

456. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

-----gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
tggtggt-----tgctgctgggcgatccggtgcttaa	Protospacer
     **     ******** **.***********

457. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

458. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

459. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

460. spacer 2.1|1281406|31|CP031455|CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.71 

gtctccgtgctgctgcgcaatccggtgcttc	CRISPR spacer
ctgaccgtgctgctgggcactccggtggcgt	Protospacer
 *  *********** *** ******* . .

461. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

-----gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
tggtggt-----tgctgctgggcgatccggtgcttaa	Protospacer
     **     ******** **.***********

462. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

463. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

464. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
gggcaggtgctggtgcgcaatctggtgctgcg	Protospacer
*  .  ****** *********.****** *

465. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
cgggcgagcacggcgttgagcgcggcgctcgt	Protospacer
.****** ***** ********** * *   .

466. spacer 2.5|1281467|32|CP031455|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.719 

tgggcgatcacggggttgagcgcgccccagtc	CRISPR spacer
acggcgatcacgatgttgagcgcgcttgaggt	Protospacer
  **********. ***********.. ** .

467. spacer 3.3|1291320|33|CP031455|PILER-CR,CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 9, identity: 0.727 

-----ggtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
ccacagg-----gtgaacccggccagcggcccggtggt	Protospacer
     **     *******************  ***

468. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.727 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
tatgatcagggcgacgcggtgcgcgacgccgcc	Protospacer
 *.********** .*************

469. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP010417 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50b, complete sequence) position: , mismatch: 9, identity: 0.727 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cacgatcagcccgctgcggtgcgcgatcatcgt	Protospacer
 ********  ***************. . *.

470. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 9, identity: 0.727 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cacgatcagcccgctgcggtgcgcgatcatcgt	Protospacer
 ********  ***************. . *.

471. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
gtcgatcagggcgatgcggtccgcgagagtgtc	Protospacer
* *********** ****** ***** .*

472. spacer 3.7|1291564|33|CP031455|PILER-CR,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

aggatcgtgttgggtacggccacgccttcgaca	CRISPR spacer
tacgacgtgtggggtacgaccacgccttcacca	Protospacer
 . . ***** *******.**********. **

473. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
acggcggccagcgccgccagcccgacgacgcg	Protospacer
.*   *****.**********.******.*

474. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gcttcggccaccgccgccggctcgacgagttc	Protospacer
**.. ***** *******.*********   .

475. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gcttcggccaccgccgccggctcgacgagctc	Protospacer
**.. ***** *******.*********   .

476. spacer 3.13|1291321|32|CP031455|CRISPRCasFinder matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
cacagggtgaacccggccagcggcccggtggt	Protospacer
   *  *******************  ***

477. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcctcttccagcatcggcgcctcgggaaag	Protospacer
**************** * **** .  *.*

478. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcctcttccagcatggccgccat---ctggatc	CRISPR spacer
ccgcctcttccaacatgtccgccgcaagccga---	Protospacer
************.**** *****..   *.*.

479. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ccgcctctgcccgcatggccgcctatcgccgc	Protospacer
******** ** ***********  ..*   *

480. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
acgatcagcgcgctgcgctgcgcgtctaaggt	Protospacer
******** ******** ****** * .. .

481. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
tcgatcagggcgatgcggtccgcgagagtgtc	Protospacer
 *********** ****** ***** .*

482. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
agcgccagtgcgctgcggcgcgcgacggccgc	Protospacer
*  ..*** *********.********* *.

483. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
agcgccagtgcgctgcggcgcgcgacggccgc	Protospacer
*  ..*** *********.********* *.

484. spacer 3.15|1291443|32|CP031455|CRISPRCasFinder matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 9, identity: 0.719 

acgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
agcgccagtgcgctgcggcgcgcgacggccgc	Protospacer
*  ..*** *********.********* *.

485. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 9, identity: 0.719 

ctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
gagttcgcgcagatcgtcagccgtggcgaacg	Protospacer
  *.*   **** ** ***************

486. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
ggtctaaccccgcccgcccgccgcgttcctca	Protospacer
   ....****************.*******

487. spacer 4.3|1392077|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MN694416 (Marine virus AFVG_250M895, complete genome) position: , mismatch: 9, identity: 0.719 

tcatgggacccaaaccaacccatgcccattca	CRISPR spacer
gggttaaacccagaccaacccctgcccattga	Protospacer
  .* ..*****.******** ******** *

488. spacer 4.13|1392687|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgggttgcctgtgagggcgcgttcggtgaggc	CRISPR spacer
ctttcgtcctgtgtgggcgctttcggtgaggt	Protospacer
*   .  ****** ****** **********.

489. spacer 4.14|1392748|34|CP031455|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 9, identity: 0.735 

cggcgtagacgcccccccccaggtggccgtagcg	CRISPR spacer
cggcgtagacgccccccgtcaggtaagcgttctc	Protospacer
***************** .*****.. ***  .

490. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ttctgcagccgggcggccacgtcgtcgagggt	Protospacer
 .*   ******.***** ***********.

491. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ccgatcagccggacggcctcgccgtcgaggcc	Protospacer
 * .. ************.**.********

492. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
catgcgggccggtcggccccgtcgtcgtaaac	Protospacer
  .***.***** ************** ..*

493. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggagggagcagggcggccccgtcgtcgaagct	Protospacer
.  * **** **.***************.*

494. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ccgtcctgccggacggcaccgtcgccgaggca	Protospacer
 *  *  ********** ******.***** .

495. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
cccgcgagccggccggcccggtcgagccgcac	Protospacer
 *********** ****** ****    * *

496. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggagggagcagggcggccccgtcgtcgaagct	Protospacer
.  * **** **.***************.*

497. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
gccgcgagccgggcggccgcgtcgcgggcccg	Protospacer
.***********.***** *****. *.   *

498. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
tcaccccgccggccggccccgtcgccgaggga	Protospacer
 *  *  ***** ***********.*****..

499. spacer 4.19|1393055|32|CP031455|CRISPRCasFinder,CRT matches to NC_019933 (Xanthomonas phage CP1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

gcggcaaacgccgtggcccgcgggttcgcggt	CRISPR spacer
gcggcaaacgccgtggcctgcggcaggaggcc	Protospacer
******************.****    . * .

500. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
gggcgcgcggccgtccgcgcggcgtacgtgct	Protospacer
.* .***********. **********  *

501. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
tgctggtcggccgtcttcgcggcggcatgggg	Protospacer
 ****  *****************   ..**.

502. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 9, identity: 0.719 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
aatgatgcggccatcttcgcgacgtaccacta	Protospacer
*.. ..******.********.*******  *

503. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP011277 (Planctomyces sp. SH-PL62 plasmid pPL62-4, complete sequence) position: , mismatch: 9, identity: 0.719 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
tcggacgcggccgtcctcgcggcctaccgcga	Protospacer
    .**********.******* ****. **

504. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to MK759884 (Salmonella phage vB_SenM_SB18, complete genome) position: , mismatch: 9, identity: 0.719 

cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
aatgatgctggtaatgatgatgacggcgacga	Protospacer
 *..  .*.*** ******** **********

505. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to MH426725 (Erwinia phage SunLIRen, complete genome) position: , mismatch: 9, identity: 0.719 

cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
aatgatgctggtaatgatgatgacggcgacga	Protospacer
 *..  .*.*** ******** **********

506. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to NC_011811 (Erwinia phage phiEa21-4, complete genome) position: , mismatch: 9, identity: 0.719 

cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
aatgatgctggtaatgatgatgacggcgacga	Protospacer
 *..  .*.*** ******** **********

507. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MN304824 (Catenulispora phage 69_17, complete genome) position: , mismatch: 9, identity: 0.719 

ccggcctccgaccagctcacctacaccgccga	CRISPR spacer
gcacggctcgaccagctcaccgccaccgccga	Protospacer
 *.   ..*************  *********

508. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccggcctccgaccagctcacctacaccgccga	CRISPR spacer
ccccagcccaaccagctcgcctacaccgccac	Protospacer
**    .**.********.***********.

509. spacer 16.12|8317016|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcttcactggctcccccaccttctccaccgg	CRISPR spacer
atgtccactggttcccgcaccttctccacttc	Protospacer
.  *.******.**** ************.

510. spacer 16.12|8317016|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcttcactggctcccccaccttctccaccgg	CRISPR spacer
cgggcggctggcacccccaccttccccacctg	Protospacer
 *  . .***** ***********.***** *

511. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
accgtgttcgtcgagccgcccatcgcgacgtc	Protospacer
 ************ .**********.   *

512. spacer 16.15|8317199|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

cccgtgttcgtcgtaccgcccatcgtccgggg	CRISPR spacer
accgtgttcgtcgagccgcccatcgcgacgtc	Protospacer
 ************ .**********.   *

513. spacer 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgggcaagggcgcggaggtgcgtgaggtgac	CRISPR spacer
gtcggcaagggcggggtggtgcgtgagccgga	Protospacer
 . ********** ** ********** .*.

514. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gcacgtacctcgccgagcacgacgcccgccgg	Protospacer
 *.  ..***** *****************.

515. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tcggccgcctcggcgggcacgacgtcgaggtg	Protospacer
***.***********.********.* .

516. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
atggtgctctcggcgaggacgacgcccaccac	Protospacer
 .*..  .********* *********.****

517. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 9, identity: 0.719 

--tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
acccggt--actcggcgagcgcgtcgcccgccag	Protospacer
  .**..   **********.** *********

518. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aagcccgccccggcgagcaggacgcccaggcc	Protospacer
  * *****.********* *******.   *

519. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
accaccgccccggcgatcacgacgccgaaggc	Protospacer
 * ******.****** ********* .  .*

520. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
tgtaccgcctcgccgagctcgacgccgactcg	Protospacer
*  ********* ***** ******* .*.

521. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aacaccgcctcgaccagcacgacgccggtgat	Protospacer
   *********.* *********** *. *.

522. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
aacaccgcctcgaccagcacgacgccggtgat	Protospacer
   *********.* *********** *. *.

523. spacer 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT matches to NC_021209 (Sinorhizobium sp. M14 plasmid pSinA, complete sequence) position: , mismatch: 9, identity: 0.719 

aacgcctcctgggcgttcttcgccatgccggt	CRISPR spacer
ccagcctcctcggcgatcttcgccatcgcgag	Protospacer
   ******* **** **********  **.

524. spacer 17.3|8322691|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719 

aacgcctcctgggcgttcttcgccatgccggt	CRISPR spacer
accgcctcctgcgcgatcttcgccacggaata	Protospacer
* ********* *** *********.*  .

525. spacer 17.5|8322813|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719 

tgacggcaccacatcacggacgcagcagtccg	CRISPR spacer
agacggcaccacaacacggccgcagggaactc	Protospacer
 ************ ***** ***** .. *.

526. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024587 (Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
aggtggtggtgctggggcaggacgacggcgaa	Protospacer
.  **    *********** *** *******

527. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
tgatcgacctgctggcgcagctcgccggcgac	Protospacer
   *  *.******* ***** *********

528. spacer 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027324 (Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgttcaggctgtgcggtcacggcgcctcctc	CRISPR spacer
agatgcaggctttgcggtcacagcgcctgcgg	Protospacer
. .* ****** *********.****** *

529. spacer 17.10|8323118|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025805 (Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgttcaggctgtgcggtcacggcgcctcctc	CRISPR spacer
ttgttcaggctgtgcggtttcggctttggttc	Protospacer
 *****************. **** ..  .**

530. spacer 17.12|8323240|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgcgcggggcactccgcccagctcgccgcct	CRISPR spacer
actcgcggggcacttcggccagctcgatcacg	Protospacer
.* ***********.** ******** .  *

531. spacer 17.16|8323484|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 9, identity: 0.719 

aacccgtcgtggccggccgagtggcagcgtca	CRISPR spacer
aggcggtcgtcgccggccgagtagcagccatg	Protospacer
*. * ***** ***********.*****  ..

532. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtgaacgcgctggttgagcgcgtcggccatct	Protospacer
*   **********.************ .  .

533. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtgaacgcgctggttgagcgcgtcggccatct	Protospacer
*   **********.************ .  .

534. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtggacgcgctggttgagcgcgtcggccatct	Protospacer
*   **********.************ .  .

535. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtgaacgcgctggttgagcgcgtcggccatct	Protospacer
*   **********.************ .  .

536. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
atggacgagctcgtcgagcgcgtcggcacgct	Protospacer
.   *** *** **************** * .

537. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
atggacgagctcgtcgagcgcgtcggcacgct	Protospacer
.   *** *** **************** * .

538. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
tcggacgcgctggacgagcgcgccggcgatgc	Protospacer
    ********* ********.****.. **

539. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gccttcgcgcaggtcgagcgcgtcgagcagtt	Protospacer
* ** ***** **************.  .* .

540. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ggggacgggctggtcgagcgcctcggcgagcg	Protospacer
*.  *** ************* *****..*

541. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
cgctcgccgctggccgaccgcgtcggcaggat	Protospacer
 .**   ******.*** ************..

542. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
tcggacgcgctggacgagcgcgccggcgatgc	Protospacer
    ********* ********.****.. **

543. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
tcggacgcgctggacgagcgcgccggcgatgc	Protospacer
    ********* ********.****.. **

544. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
tcggacgcgctggacgagcgcgccggcgatgc	Protospacer
    ********* ********.****.. **

545. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
tcggacgcgctggacgagcgcgccggcgatgc	Protospacer
    ********* ********.****.. **

546. spacer 1.3|1277244|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtgacccgcctgaccccgggcgaagcgcgc	CRISPR spacer
accgcttccgcctgaacccgggcgaagagccg	Protospacer
 *    .******** *********** **

547. spacer 1.7|1277488|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cccttcgcgttggcgggtgagacggcgcgcgg	CRISPR spacer
gaggtgctgtcggcgggtgagacggcgggcgc	Protospacer
    *  .**.**************** ***

548. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
accccgagcgccgcgccgcctatgaccagctg	Protospacer
   ******** **********.***   *.

549. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 10, identity: 0.688 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
atctggagcgcagcgccaccgacgacgtgctg	Protospacer
   . ************.** ******* *.

550. spacer 1.10|1277671|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MG214783 (Sinorhizobium phage HMSP1-Susan, complete genome) position: , mismatch: 10, identity: 0.688 

cggagctcgttgagccgctcggccccgcagcc	CRISPR spacer
gaagaaccgttgagccgcgcggcgccgcagca	Protospacer
 .... .*********** **** *******

551. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

552. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcgctgctcatcggctttgcggtctctatc	Protospacer
*  . ************* ** ******.  .

553. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

554. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccggcctgctcatcggctggcaggtcttgaag	Protospacer
*   ***************  ******.  .

555. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

556. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

557. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

558. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
ccgcactgctcatcggctttgcggtctcgatc	Protospacer
*  . ************* ** ******   .

559. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

560. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

561. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

562. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

563. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

564. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

565. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

566. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

567. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

568. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

569. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
cgctgcgcaagcttgacagccttctcgacgcg	Protospacer
    .***.********.**********.*.

570. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
gcttcgacgcgcttgacggccttctccatgaa	Protospacer
.*    .** **************** ***

571. spacer 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtaggcggtccacgcgcagatgcgggcggc	CRISPR spacer
caaggcgcgatccacgcgcagctgcgggctga	Protospacer
. . . ***.*********** ******* *

572. spacer 1.17|1278098|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtaggcggtccacgcgcagatgcgggcggc	CRISPR spacer
aatgcgatgggccaggcgcagatgcgggcggt	Protospacer
     *..** *** ****************.

573. spacer 1.19|1278220|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 10, identity: 0.688 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
ctgaccgtgctgctgggcactccggtggcgtg	Protospacer
 *  *********** *** ******* . .

574. spacer 2.3|1281528|31|CP031455|CRT matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 10, identity: 0.677 

cggcacaggcactgatccccgtggactaccg	CRISPR spacer
tactaccggcagtgatccccgtggacttttc	Protospacer
.. .** **** *************** ..

575. spacer 2.4|1281406|32|CP031455|CRISPRCasFinder matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 10, identity: 0.688 

gtctccgtgctgctgcgcaatccggtgcttct	CRISPR spacer
ctgaccgtgctgctgggcactccggtggcgtg	Protospacer
 *  *********** *** ******* . .

576. spacer 2.6|1281528|32|CP031455|CRISPRCasFinder matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 10, identity: 0.688 

cggcacaggcactgatccccgtggactaccgc	CRISPR spacer
tactaccggcagtgatccccgtggacttttcc	Protospacer
.. .** **** *************** .. *

577. spacer 3.5|1291442|33|CP031455|PILER-CR,CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 10, identity: 0.697 

gacgatcagggcgctgcggtgcgcgacgggcag	CRISPR spacer
cacgatcagcgcgctgcgctgcgcgtctaaggt	Protospacer
 ******** ******** ****** * .. .

578. spacer 3.11|1291199|32|CP031455|CRISPRCasFinder matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 10, identity: 0.688 

gcccaggccaacgccgccagctcgacgatggt	CRISPR spacer
gcctacgccaacgccgccagctccgaaaacac	Protospacer
***.* ***************** . .*  ..

579. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
taatctcttccagcatgcccgccaccttcggc	Protospacer
. ..************* ******.**  . *

580. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
taatctcttccagcatgcccgccaccttcggc	Protospacer
. ..************* ******.**  . *

581. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ggcgctcttcgcgcatggccgccatctcatgc	Protospacer
    ******  *************** .  *

582. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
agccggcttcctgcatggccgccacctgggcg	Protospacer
   *  ***** ************.****..

583. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

584. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

585. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

586. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

587. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

588. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

589. spacer 3.20|1291748|32|CP031455|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
acgccggccccgcccggccgccgtgccggatg	Protospacer
 **.************ ********..   .

590. spacer 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688 

cagcgggtcatcaccccgctgatcagtgattc	CRISPR spacer
aagcgggtcaccgccccgctgatctcgcacag	Protospacer
 *********.*.***********    *.

591. spacer 4.5|1392199|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MN234206 (Arthrobacter phage Racecar, complete genome) position: , mismatch: 10, identity: 0.688 

gtttctcgaagctgtgggaagaggagggagac	CRISPR spacer
aattctcgaagcagtgggatgaggacactaag	Protospacer
. ********** ****** ***** .  .*

592. spacer 4.6|1392260|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to MH622937 (Myoviridae sp. isolate ctcg_2, complete genome) position: , mismatch: 10, identity: 0.688 

gggtcgggccgcagtcccggcaaggagggaaa	CRISPR spacer
tttctgggccgcaatcccggcaagcaggttat	Protospacer
   ..********.********** ***  *

593. spacer 4.8|1392382|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040989 (Vibrio furnissii strain FDAARGOS_777 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tggatgttggggtacgggctcttggcgggggt	CRISPR spacer
aagatgttggggtacggtctcttcgccacaac	Protospacer
 .*************** ***** ** . ...

594. spacer 4.10|1392504|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_015409 (Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence) position: , mismatch: 10, identity: 0.688 

tatgccacaccgaagagcggaatgcaatgggg	CRISPR spacer
agtgccgcaccgaagaggggaatgcggagcca	Protospacer
 .****.********** *******.. *  .

595. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
gcaagatgccggacggccgcgtggtcgagggc	Protospacer
.* . . *********** *** *******.

596. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_LT900339 (Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggcgcgggccggacggccccgccgtttttcgg	Protospacer
. ****.**************.***.    .*

597. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggagggagcagggcggccccgtcgtcgaatgc	Protospacer
.  * **** **.***************. .

598. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_006672 (Gluconobacter oxydans 621H plasmid pGOX1, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggcgcgggccggacggccccgccgtttttcgg	Protospacer
. ****.**************.***.    .*

599. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NC_006673 (Gluconobacter oxydans 621H plasmid pGOX2, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggcgcgggccggacggccccgccgtttttcgg	Protospacer
. ****.**************.***.    .*

600. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP016288 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggagggagcagggcggccccgtcgtcgaatgc	Protospacer
.  * **** **.***************. .

601. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ttgtcgagcgtgacggccccgtcgtcgtcgcc	Protospacer
 .  *****  ****************  *

602. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggcgcgagccggacggccgcgacgtttctcgg	Protospacer
. **************** ** ***.    .*

603. spacer 4.15|1392811|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP022669 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcgagccggacggccccgtcgtcgaggag	CRISPR spacer
ggagggagcagggcggccccgtcgtcgaatgc	Protospacer
.  * **** **.***************. .

604. spacer 4.17|1392933|32|CP031455|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688 

tacgttgcgcagtacggcagttccgttgacct	CRISPR spacer
tacggtgcgcagtacggcggttcgaccacctc	Protospacer
**** *************.**** .... *..

605. spacer 4.18|1392994|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 10, identity: 0.688 

tgtccggcgtggtctcgtacaccaggtacacg	CRISPR spacer
ggtccggcgtcgtctcgtccaccaccaggatc	Protospacer
 ********* ******* *****   . *.

606. spacer 16.2|8316406|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 10, identity: 0.688 

aaggacaagcagtgcctcgcggctgtcggggt	CRISPR spacer
cgcagccgccagggcctcggggctgtcggggt	Protospacer
 . ..* . *** ****** ************

607. spacer 16.7|8316711|32|CP031455|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

agctgcgcggccgtcttcgcggcgtaccagga	CRISPR spacer
ctctgcgcgggcttcttcgcggcgtcggcgag	Protospacer
  ******** * ************    *..

608. spacer 16.8|8316772|32|CP031455|CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 10, identity: 0.688 

cacatgaccggtcatgatgatcacggcgacga	CRISPR spacer
gtcgacgtcggtcgtgatgatcacggagacgt	Protospacer
  *.  ..*****.************ ****

609. spacer 16.9|8316833|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccggcctccgaccagctcacctacaccgccga	CRISPR spacer
agtacctccgaccagctcgccttcacctgctc	Protospacer
   .**************.*** ****  *

610. spacer 16.11|8316955|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688 

gccccggtgatgcatctgaggcccggccgtca	CRISPR spacer
gtggtggtgatgcttctgtggcccggcctggt	Protospacer
*.  .******** **** *********

611. spacer 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to AY320035 (Bacteriophage VWB, complete genome) position: , mismatch: 10, identity: 0.688 

gcccggcgaagcgcggcagtccggtacaacca	CRISPR spacer
cgccggcgaagcgctgcagtgcggtgccgtgg	Protospacer
  ************ ***** ****.* .. .

612. spacer 16.13|8317077|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_005345 (Streptomyces phage VWB, complete genome) position: , mismatch: 10, identity: 0.688 

gcccggcgaagcgcggcagtccggtacaacca	CRISPR spacer
cgccggcgaagcgctgcagtgcggtgccgtgg	Protospacer
  ************ ***** ****.* .. .

613. spacer 16.18|8317382|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgggcaagggcgcggaggtgcgtgaggtgac	CRISPR spacer
ggtgaacagggcgcggaggtgcgtgcgatggg	Protospacer
   *.  ****************** *.**.

614. spacer 16.19|8317443|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgaccgcctcggcgagcacgacgcccgccac	CRISPR spacer
gcgtcggcctcggcgagcacgacgttgatgcc	Protospacer
 ** * ******************.. ..  *

615. spacer 17.2|8322630|32|CP031455|CRISPRCasFinder,CRT matches to MT316461 (Streptomyces phage Galactica, complete genome) position: , mismatch: 10, identity: 0.688 

gtcccgggcgtgtcctcccaccccgtaaccga	CRISPR spacer
atccccggcgtgtcctcccagccctccatgtc	Protospacer
.**** ************** *** . *.

616. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 10, identity: 0.688 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
tcacgcatctgctggcgcagcacggcgatctt	Protospacer
 * .*********** ******** **..

617. spacer 17.7|8322935|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013267 (Sphingobium baderi strain DE-13 plasmid pDE3, complete sequence) position: , mismatch: 10, identity: 0.688 

gcctgcatctgctggggcagcacgccggcgaa	CRISPR spacer
gtgctgtggtgctggcgcagcacgtcggcgaa	Protospacer
*. .     ****** ********.*******

618. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MH926056 (Corynebacterium phage Cruella, complete genome) position: , mismatch: 10, identity: 0.688 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
aaagctaccgagaagggcacggaaggctacgc	Protospacer
.*....  *********** *******.***.

619. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to MG198776 (Corynebacterium phage C3PO, complete genome) position: , mismatch: 10, identity: 0.688 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
aaagctaccgagaagggcacggaaggctacgc	Protospacer
.*....  *********** *******.***.

620. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_042086 (Corynebacterium phage Darwin, complete genome) position: , mismatch: 10, identity: 0.688 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
aaagctaccgagaagggcacggaaggctacgc	Protospacer
.*....  *********** *******.***.

621. spacer 17.13|8323301|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cggtcgagattgggggccacgattccgccggc	CRISPR spacer
cggtcgagattggacgccacgatatgacatca	Protospacer
*************. ******** . .*

622. spacer 17.16|8323484|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 10, identity: 0.688 

aacccgtcgtggccggccgagtggcagcgtca	CRISPR spacer
tttcagtggtggccggccgagcggcagcaagg	Protospacer
  .* ** *************.******.  .

623. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023440 (Thauera sp. K11 plasmid pTX1, complete sequence) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
cttggggcgctgctcgagcccgtcggcaggag	Protospacer
  . . ****** ****** **********.

624. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ctgcacgcgctgatcgaacgcgtcggcaacca	Protospacer
   .********.****.**********.

625. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KU204984 (Pseudomonas phage AAT-1, complete genome) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
gtggccgcgctggccgagcgcgacggcatcaa	Protospacer
*    ********.******** *****  .

626. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_005887 (Burkholderia phage BcepC6B, complete genome) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ttgaacgcgctggtcgatcacgtcggcggcat	Protospacer
    ************* *.*******.* ..

627. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to AY605181 (Burkholderia cepacia complex phage BcepC6B, complete genome) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ttgaacgcgctggtcgatcacgtcggcggcat	Protospacer
    ************* *.*******.* ..

628. spacer 17.17|8323545|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to KR011061 (Skermania phage SPI1, complete genome) position: , mismatch: 10, identity: 0.688 

gactacgcgctggtcgagcgcgtcggcagggc	CRISPR spacer
ccggacgcgctcgtcgagcgcgtccgcgtcga	Protospacer
    ******* ************ **.  *

629. spacer 1.8|1277549|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 11, identity: 0.656 

cggccgagcgcagcgccgcctacgacgttccc	CRISPR spacer
gcaccgcgcgcagcgccgccgacgacagcggg	Protospacer
  .*** ************* *****. .

630. spacer 1.13|1277854|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044103 (Streptococcus dysgalactiae strain FDAARGOS_654 plasmid unnamed1) position: , mismatch: 11, identity: 0.656 

cgttcctgctcatcggctgtgaggtctcctgt	CRISPR spacer
aacaattgctcatcggcattgaggtctccaaa	Protospacer
 ..  .***********  ********** .

631. spacer 1.16|1278037|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 11, identity: 0.656 

acggacgcgagcttgacggccttctcgatgtc	CRISPR spacer
tgatccgcgagctttacggccatctcgacaat	Protospacer
  .  ********* ****** ******.. .

632. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

633. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

634. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

635. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

636. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

637. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

638. spacer 3.10|1291747|33|CP031455|PILER-CR,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.667 

atcgtcggccccgcccgcccgccgtgttcctcc	CRISPR spacer
tacgccggccccgcccggccgccgtgccggatg	Protospacer
  **.************ ********..   .

639. spacer 3.13|1291321|32|CP031455|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 11, identity: 0.656 

gtgatcgtgaacccggccagcggccacgtgtg	CRISPR spacer
tcgatcctgaacccggccagccgcccatcccc	Protospacer
 .**** ************** ***   . .

640. spacer 3.14|1291382|32|CP031455|CRISPRCasFinder matches to KU708004 (Pseudomonas phage phiAH14a, complete genome) position: , mismatch: 11, identity: 0.656 

ccgcctcttccagcatggccgccatctggatc	CRISPR spacer
ttttgctgtccagcgtggccaccatctggatt	Protospacer
.. . .. ******.*****.**********.

641. spacer 3.19|1291687|32|CP031455|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 11, identity: 0.656 

ctgctgcagcagctcctcagccgtggcgaacc	CRISPR spacer
ggcgagcagcagcgcctcagccgtgccgtgga	Protospacer
     ******** *********** ** .

642. spacer 17.11|8323179|32|CP031455|CRISPRCasFinder,CRT,PILER-CR matches to NC_013698 (Clavibacter phage CMP1, complete genome) position: , mismatch: 11, identity: 0.656 

gagatccgcgagaagggcaaggaaggccacgt	CRISPR spacer
cagatccgtgagaaggtcaaggaaatatggaa	Protospacer
 *******.******* *******.  .. .

643. spacer 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010589 (Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence) position: , mismatch: 14, identity: 0.562 

cagcgggtcatcaccccgctgatca-gtgattc	CRISPR spacer
aaatcagtgatcagcgtggtgatggcgtgatg-	Protospacer
 *.. .** **** * .* **** . *****

644. spacer 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010674 (Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence) position: , mismatch: 14, identity: 0.562 

cagcgggtcatcaccccgctgatca-gtgattc	CRISPR spacer
aaatcagtgatcagcgtggtgatggcgtgatg-	Protospacer
 *.. .** **** * .* **** . *****

645. spacer 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NC_023138 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence) position: , mismatch: 14, identity: 0.562 

cagcgggtcatcaccccgctgatca-gtgattc	CRISPR spacer
aaatcagtgatcagcgtggtgatggcgtgatg-	Protospacer
 *.. .** **** * .* **** . *****

646. spacer 4.2|1392016|32|CP031455|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010637 (Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence) position: , mismatch: 14, identity: 0.562 

cagcgggtcatcaccccgctgatca-gtgattc	CRISPR spacer
aaatcagtgatcagcgtggtgatggcgtgatg-	Protospacer
 *.. .** **** * .* **** . *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage