Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028359 Candidatus Sulcia muelleri strain OLIH chromosome, complete genome 1 crisprs NA 0 1 1 0

Results visualization

1. CP028359
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028359_1 53543-53640 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028359_1 1.1|53576|32|CP028359|CRISPRCasFinder 53576-53607 32 MN694223 Marine virus AFVG_250M234, complete genome 5914-5945 8 0.75
CP028359_1 1.1|53576|32|CP028359|CRISPRCasFinder 53576-53607 32 NC_047721 Staphylococcus phage SA5, complete genome 3389-3420 8 0.75
CP028359_1 1.1|53576|32|CP028359|CRISPRCasFinder 53576-53607 32 JN638751 Bacillus phage G, complete genome 148193-148224 10 0.688

1. spacer 1.1|53576|32|CP028359|CRISPRCasFinder matches to MN694223 (Marine virus AFVG_250M234, complete genome) position: , mismatch: 8, identity: 0.75

ttacaaaattaaaaataaactacagatgcagt	CRISPR spacer
taacaagattaaaaataaactagagactaatg	Protospacer
* ****.*************** ***.  *  

2. spacer 1.1|53576|32|CP028359|CRISPRCasFinder matches to NC_047721 (Staphylococcus phage SA5, complete genome) position: , mismatch: 8, identity: 0.75

ttacaaaattaaaaataaactacagatgcagt	CRISPR spacer
tgaagaaattaaaaaataactacagatgatat	Protospacer
* * .**********  ***********  .*

3. spacer 1.1|53576|32|CP028359|CRISPRCasFinder matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 10, identity: 0.688

ttacaaaattaaaaataaactacagatgcagt	CRISPR spacer
ctacaaaattaacaaaaaactacaaagaagaa	Protospacer
.*********** ** ********.* . .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 124739 : 130776 6 uncultured_virus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage