Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031681 Haemophilus influenzae strain P669-6977 chromosome, complete genome 1 crisprs DinG,DEDDh,cas3,WYL,RT 1 0 8 0

Results visualization

1. CP031681
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031681_2 1219592-1219740 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031681_3 3.1|1318838|49|CP031681|CRISPRCasFinder 1318838-1318886 49 CP031681.1 1318802-1318850 1 0.98

1. spacer 3.1|1318838|49|CP031681|CRISPRCasFinder matches to position: 1318802-1318850, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20096 : 87941 83 Haemophilus_phage(46.81%) transposase,tail,tRNA,plate,head NA
DBSCAN-SWA_2 404141 : 440547 50 Haemophilus_phage(62.16%) transposase,plate,head,tail NA
DBSCAN-SWA_3 700618 : 798715 115 Haemophilus_phage(10.42%) portal,integrase,terminase,tail,tRNA,protease attL 711938:711955|attR 737122:737139
DBSCAN-SWA_4 1345637 : 1435022 83 Mannheimia_phage(41.94%) portal,plate,lysis,terminase,tail,tRNA,protease,capsid,head NA
DBSCAN-SWA_5 1502051 : 1518331 24 Haemophilus_phage(47.37%) terminase,holin,head NA
DBSCAN-SWA_6 1559478 : 1651288 105 Burkholderia_virus(14.29%) transposase,terminase,holin,tail,tRNA,protease,plate,head NA
DBSCAN-SWA_7 1674476 : 1721340 62 Mannheimia_phage(13.51%) terminase,portal,tail,protease NA
DBSCAN-SWA_8 1835579 : 1844089 9 Bacillus_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage