Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031686 Haemophilus influenzae strain P642-4396 chromosome, complete genome 2 crisprs DinG,DEDDh,cas3,WYL 1 0 6 0

Results visualization

1. CP031686
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031686_1 1148574-1148722 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031686_2 1177429-1177516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031686_3 3.1|1245918|49|CP031686|CRISPRCasFinder 1245918-1245966 49 CP031686.1 1245882-1245930 1 0.98

1. spacer 3.1|1245918|49|CP031686|CRISPRCasFinder matches to position: 1245882-1245930, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 654350 : 708651 75 Haemophilus_phage(15.22%) holin,tail,plate,tRNA,head,integrase,terminase attL 649242:649258|attR 685325:685341
DBSCAN-SWA_2 752787 : 759230 7 Staphylococcus_phage(16.67%) tRNA,transposase NA
DBSCAN-SWA_3 1272717 : 1323325 52 Mannheimia_phage(57.14%) portal,tail,plate,lysis,tRNA,head,protease,capsid,terminase NA
DBSCAN-SWA_4 1420374 : 1432411 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_5 1441799 : 1471108 40 Haemophilus_phage(23.33%) head,terminase NA
DBSCAN-SWA_6 1710725 : 1719234 9 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage