Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031679 Haemophilus influenzae strain P676-2514 chromosome, complete genome 1 crisprs DinG,DEDDh,cas3,WYL,RT 1 0 5 0

Results visualization

1. CP031679
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031679_1 1140180-1140328 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031679_2 2.1|1239255|49|CP031679|CRISPRCasFinder 1239255-1239303 49 CP031679.1 1239219-1239267 1 0.98

1. spacer 2.1|1239255|49|CP031679|CRISPRCasFinder matches to position: 1239219-1239267, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1266106 : 1355294 82 Mannheimia_phage(39.39%) protease,capsid,tRNA,terminase,head,tail,lysis,plate,portal NA
DBSCAN-SWA_2 1402281 : 1414325 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_3 1423490 : 1439776 24 Haemophilus_phage(42.86%) terminase,head,holin NA
DBSCAN-SWA_4 1681280 : 1689789 9 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_5 1816746 : 1829045 11 Escherichia_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage