Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031687 Haemophilus influenzae strain P641-4342 chromosome, complete genome 2 crisprs DinG,DEDDh,cas3,WYL 1 0 5 0

Results visualization

1. CP031687
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031687_1 1100742-1100890 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031687_2 1129597-1129684 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031687_3 3.1|1198093|49|CP031687|CRISPRCasFinder 1198093-1198141 49 CP031687.1 1198057-1198105 1 0.98

1. spacer 3.1|1198093|49|CP031687|CRISPRCasFinder matches to position: 1198057-1198105, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 704951 : 711394 7 Staphylococcus_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_2 1224892 : 1275500 52 Mannheimia_phage(57.14%) plate,tail,lysis,terminase,capsid,protease,head,tRNA,portal NA
DBSCAN-SWA_3 1372549 : 1384586 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_4 1393974 : 1423283 40 Haemophilus_phage(23.33%) terminase,head NA
DBSCAN-SWA_5 1662897 : 1671406 9 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage