Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031751 Rhodobacter sphaeroides strain EBL0706 chromosome 2, complete sequence 0 crisprs cas2,csa3 0 0 2 0
CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 0 crisprs NA 0 0 1 0
CP031753 Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence 0 crisprs NA 0 0 1 0
CP031750 Rhodobacter sphaeroides strain EBL0706 chromosome 1, complete sequence 2 crisprs DEDDh,cas3,csa3,RT 0 0 6 0
CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 1 crisprs cas2,cas1,csb2gr5,cas7,cas8u2,cas3,WYL 0 31 0 0
CP031755 Rhodobacter sphaeroides strain EBL0706 plasmid p.D, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP031752
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34904 : 108411 49 Stx2-converting_phage(18.18%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP031753
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10906 : 83978 54 Morganella_phage(16.67%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP031754
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031754_1 29860-31875 Unclear NA
27 spacers
cas2,cas1,csb2gr5,cas7,cas8u2,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031754_1 1.1|29896|36|CP031754|CRISPRCasFinder,CRT 29896-29931 36 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 29896-29931 0 1.0
CP031754_1 1.2|29968|39|CP031754|CRISPRCasFinder,CRT 29968-30006 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 29968-30006 0 1.0
CP031754_1 1.3|30043|35|CP031754|CRISPRCasFinder,CRT 30043-30077 35 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30043-30077 0 1.0
CP031754_1 1.4|30114|37|CP031754|CRISPRCasFinder,CRT 30114-30150 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30114-30150 0 1.0
CP031754_1 1.5|30187|39|CP031754|CRISPRCasFinder,CRT 30187-30225 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30187-30225 0 1.0
CP031754_1 1.6|30262|37|CP031754|CRISPRCasFinder,CRT 30262-30298 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30262-30298 0 1.0
CP031754_1 1.7|30335|37|CP031754|CRISPRCasFinder,CRT 30335-30371 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30335-30371 0 1.0
CP031754_1 1.8|30408|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 30408-30445 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30408-30445 0 1.0
CP031754_1 1.9|30482|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 30482-30519 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30482-30519 0 1.0
CP031754_1 1.10|30556|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 30556-30590 35 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30556-30590 0 1.0
CP031754_1 1.11|30627|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30627-30663 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30627-30663 0 1.0
CP031754_1 1.12|30700|39|CP031754|CRISPRCasFinder,CRT,PILER-CR 30700-30738 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30700-30738 0 1.0
CP031754_1 1.13|30775|39|CP031754|CRISPRCasFinder,CRT,PILER-CR 30775-30813 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30775-30813 0 1.0
CP031754_1 1.14|30850|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 30850-30884 35 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30850-30884 0 1.0
CP031754_1 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30921-30957 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30921-30957 0 1.0
CP031754_1 1.16|30994|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30994-31030 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30994-31030 0 1.0
CP031754_1 1.17|31067|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 31067-31104 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31067-31104 0 1.0
CP031754_1 1.18|31141|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 31141-31178 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31141-31178 0 1.0
CP031754_1 1.19|31215|36|CP031754|CRISPRCasFinder,CRT,PILER-CR 31215-31250 36 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31215-31250 0 1.0
CP031754_1 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 31287-31321 35 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31287-31321 0 1.0
CP031754_1 1.21|31358|41|CP031754|CRISPRCasFinder,CRT,PILER-CR 31358-31398 41 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31358-31398 0 1.0
CP031754_1 1.22|31435|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 31435-31469 35 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31435-31469 0 1.0
CP031754_1 1.23|31506|39|CP031754|CRISPRCasFinder,CRT,PILER-CR 31506-31544 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31506-31544 0 1.0
CP031754_1 1.24|31581|39|CP031754|CRISPRCasFinder,CRT,PILER-CR 31581-31619 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31581-31619 0 1.0
CP031754_1 1.25|31656|36|CP031754|CRISPRCasFinder,CRT,PILER-CR 31656-31691 36 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31656-31691 0 1.0
CP031754_1 1.26|31728|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 31728-31765 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31728-31765 0 1.0
CP031754_1 1.27|31802|38|CP031754|CRISPRCasFinder,CRT,PILER-CR 31802-31839 38 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 31802-31839 0 1.0
CP031754_1 1.28|29967|41|CP031754|PILER-CR 29967-30007 41 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 29967-30007 0 1.0
CP031754_1 1.29|30042|37|CP031754|PILER-CR 30042-30078 37 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30042-30078 0 1.0
CP031754_1 1.30|30113|39|CP031754|PILER-CR 30113-30151 39 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30113-30151 0 1.0
CP031754_1 1.31|30186|41|CP031754|PILER-CR 30186-30226 41 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 30186-30226 0 1.0
CP031754_1 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 31287-31321 35 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1129295-1129329 5 0.857
CP031754_1 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 31287-31321 35 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 683827-683861 5 0.857
CP031754_1 1.10|30556|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 30556-30590 35 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 174421-174455 9 0.743
CP031754_1 1.19|31215|36|CP031754|CRISPRCasFinder,CRT,PILER-CR 31215-31250 36 NZ_CP049248 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence 116825-116860 9 0.75
CP031754_1 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR 31287-31321 35 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1382510-1382544 9 0.743
CP031754_1 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30921-30957 37 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 547341-547377 10 0.73
CP031754_1 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30921-30957 37 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 70912-70948 10 0.73
CP031754_1 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR 30921-30957 37 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 256756-256792 11 0.703

1. spacer 1.1|29896|36|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

tccgataaaagcctacgacggcacgcctgtcatcat	CRISPR spacer
tccgataaaagcctacgacggcacgcctgtcatcat	Protospacer
************************************

2. spacer 1.2|29968|39|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcggacgcctcaacgccccggcacgggtctcagagct	CRISPR spacer
ccgcggacgcctcaacgccccggcacgggtctcagagct	Protospacer
***************************************

3. spacer 1.3|30043|35|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

caggctcgatcccttgggcgaacttggcagttgtc	CRISPR spacer
caggctcgatcccttgggcgaacttggcagttgtc	Protospacer
***********************************

4. spacer 1.4|30114|37|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gcggcatgaagtcggtagtcctcaaaagcttcgtaag	CRISPR spacer
gcggcatgaagtcggtagtcctcaaaagcttcgtaag	Protospacer
*************************************

5. spacer 1.5|30187|39|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ccggtgcggtggtggatcgtcttccgctcatggtcaatc	CRISPR spacer
ccggtgcggtggtggatcgtcttccgctcatggtcaatc	Protospacer
***************************************

6. spacer 1.6|30262|37|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

tcagcgtcagcttgtccgccttctcgctgttgcgctt	CRISPR spacer
tcagcgtcagcttgtccgccttctcgctgttgcgctt	Protospacer
*************************************

7. spacer 1.7|30335|37|CP031754|CRISPRCasFinder,CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ccgggatcagcaccgaatacaccaagaccggcggcac	CRISPR spacer
ccgggatcagcaccgaatacaccaagaccggcggcac	Protospacer
*************************************

8. spacer 1.8|30408|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cggcaaggggcgctgcaccattagcgctgaacacgcca	CRISPR spacer
cggcaaggggcgctgcaccattagcgctgaacacgcca	Protospacer
**************************************

9. spacer 1.9|30482|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ctgctcccgcttgccgtgggcctcctcggagttgggga	CRISPR spacer
ctgctcccgcttgccgtgggcctcctcggagttgggga	Protospacer
**************************************

10. spacer 1.10|30556|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggcgacaatgccgagtggcgcagcctgtccgg	CRISPR spacer
gcgggcgacaatgccgagtggcgcagcctgtccgg	Protospacer
***********************************

11. spacer 1.11|30627|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

aggatgacctctcggatgcccgttacctgttccgcac	CRISPR spacer
aggatgacctctcggatgcccgttacctgttccgcac	Protospacer
*************************************

12. spacer 1.12|30700|39|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgccacgtcaaggcgaagaccgcggccctctacgc	CRISPR spacer
cgggcgccacgtcaaggcgaagaccgcggccctctacgc	Protospacer
***************************************

13. spacer 1.13|30775|39|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

aatggagaaatcgcggaagaagccatagacggttgtccc	CRISPR spacer
aatggagaaatcgcggaagaagccatagacggttgtccc	Protospacer
***************************************

14. spacer 1.14|30850|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

aggatgccggaaagacggcgcgcgccggatgtggg	CRISPR spacer
aggatgccggaaagacggcgcgcgccggatgtggg	Protospacer
***********************************

15. spacer 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cgccccacatgccgacgatgagatccgcgaagttgcc	CRISPR spacer
cgccccacatgccgacgatgagatccgcgaagttgcc	Protospacer
*************************************

16. spacer 1.16|30994|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gccaggactcgccctcatcagcccacggctcggcagg	CRISPR spacer
gccaggactcgccctcatcagcccacggctcggcagg	Protospacer
*************************************

17. spacer 1.17|31067|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gtggagcaggtgatggccttcgccacgtcgcgagcgaa	CRISPR spacer
gtggagcaggtgatggccttcgccacgtcgcgagcgaa	Protospacer
**************************************

18. spacer 1.18|31141|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

tatatcttccttagcccatggatttgggaagcccggag	CRISPR spacer
tatatcttccttagcccatggatttgggaagcccggag	Protospacer
**************************************

19. spacer 1.19|31215|36|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

tctcgatttcgccagcgtcaatcagctttttgtcgc	CRISPR spacer
tctcgatttcgccagcgtcaatcagctttttgtcgc	Protospacer
************************************

20. spacer 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgcggccgaggcggcagcgccctacggcctcgc	CRISPR spacer
cgcgcggccgaggcggcagcgccctacggcctcgc	Protospacer
***********************************

21. spacer 1.21|31358|41|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gccgaatgggcggaggtcagccagcgcaactatcaggccgc	CRISPR spacer
gccgaatgggcggaggtcagccagcgcaactatcaggccgc	Protospacer
*****************************************

22. spacer 1.22|31435|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cgtgttttgcagctttccgcaccgcggcggatgag	CRISPR spacer
cgtgttttgcagctttccgcaccgcggcggatgag	Protospacer
***********************************

23. spacer 1.23|31506|39|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacgtggtccggtcgggcctctgccaggccattgtc	CRISPR spacer
gccgacgtggtccggtcgggcctctgccaggccattgtc	Protospacer
***************************************

24. spacer 1.24|31581|39|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cttgcggcgcaggtcttccggctgctcggcgtagatctc	CRISPR spacer
cttgcggcgcaggtcttccggctgctcggcgtagatctc	Protospacer
***************************************

25. spacer 1.25|31656|36|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gtggctcttgccccagagggtattgcctcgaggcag	CRISPR spacer
gtggctcttgccccagagggtattgcctcgaggcag	Protospacer
************************************

26. spacer 1.26|31728|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

atccgcacggccatgcgatgctgcgtccgtgtgccagc	CRISPR spacer
atccgcacggccatgcgatgctgcgtccgtgtgccagc	Protospacer
**************************************

27. spacer 1.27|31802|38|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcggcttgctcgcaaagatgcccgcgccgccctcgc	CRISPR spacer
ctgcggcttgctcgcaaagatgcccgcgccgccctcgc	Protospacer
**************************************

28. spacer 1.28|29967|41|CP031754|PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

cccgcggacgcctcaacgccccggcacgggtctcagagctg	CRISPR spacer
cccgcggacgcctcaacgccccggcacgggtctcagagctg	Protospacer
*****************************************

29. spacer 1.29|30042|37|CP031754|PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggctcgatcccttgggcgaacttggcagttgtcg	CRISPR spacer
gcaggctcgatcccttgggcgaacttggcagttgtcg	Protospacer
*************************************

30. spacer 1.30|30113|39|CP031754|PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcatgaagtcggtagtcctcaaaagcttcgtaagg	CRISPR spacer
ggcggcatgaagtcggtagtcctcaaaagcttcgtaagg	Protospacer
***************************************

31. spacer 1.31|30186|41|CP031754|PILER-CR matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 0, identity: 1.0

gccggtgcggtggtggatcgtcttccgctcatggtcaatcg	CRISPR spacer
gccggtgcggtggtggatcgtcttccgctcatggtcaatcg	Protospacer
*****************************************

32. spacer 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.857

cgcgcggccgaggcggcagcgccctacggcctcgc-	CRISPR spacer
cgcgcggccgaggcggcggcggcctac-gccgggct	Protospacer
*****************.*** ***** ***  ** 

33. spacer 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.857

cgcgcggccgaggcggcagcgccctacggcctcgc-	CRISPR spacer
cgcgcggccgaggcggcggcggcctac-gccgggct	Protospacer
*****************.*** ***** ***  ** 

34. spacer 1.10|30556|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 9, identity: 0.743

gcgggcgacaatgccgagtggcgcagcctgtccgg	CRISPR spacer
gatggcgagaatgccgagttgcgcagccggggcca	Protospacer
*  ***** ********** ******** *  * .

35. spacer 1.19|31215|36|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.75

tctcgatttcgccagcgtcaatcagctttttgtcgc	CRISPR spacer
gcataacctcgccatcgtcaatcagcttattgtcgt	Protospacer
 * ..*..****** ************* ******.

36. spacer 1.20|31287|35|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743

cgcgcggccgaggcggcagcgccctacggcctcgc	CRISPR spacer
gccccggccgaggcggcagcgcccgccggcaccag	Protospacer
  * ********************  **** .*. 

37. spacer 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 10, identity: 0.73

cgccccacatgccgacgatgagatccgcgaagttgcc	CRISPR spacer
cattggtcatgacgacgatgagatcggcgaagttgga	Protospacer
*...   **** ************* *********  

38. spacer 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.73

cgccccacatgccgacgatgagatccgcgaagttgcc	CRISPR spacer
cattggtcatgacgacgatgagatcggcgaagttgga	Protospacer
*...   **** ************* *********  

39. spacer 1.15|30921|37|CP031754|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 11, identity: 0.703

cgccccacatgccgacgatgagatccgcgaagttgcc	CRISPR spacer
cattggtcatgacgacgatgagatcggcgaagttcga	Protospacer
*...   **** ************* ********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP031750
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031750_1 1372946-1373065 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031750_2 1495742-1495849 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 704713 : 714512 11 Vibrio_phage(16.67%) tRNA NA
DBSCAN-SWA_2 752617 : 811321 57 uncultured_Mediterranean_phage(20.0%) transposase,tRNA,tail NA
DBSCAN-SWA_3 940360 : 971705 51 Rhodobacter_phage(47.62%) terminase,capsid,head,tail,integrase,portal attL 933239:933255|attR 943640:943656
DBSCAN-SWA_4 992654 : 1004737 15 Paracoccus_phage(50.0%) capsid,head,protease,portal,tail NA
DBSCAN-SWA_5 1852537 : 1901863 47 Acidithiobacillus_phage(31.58%) tRNA,transposase,terminase,capsid,head,tail,portal NA
DBSCAN-SWA_6 2426899 : 2496600 72 Paracoccus_phage(17.24%) tRNA,transposase,terminase,capsid,head,tail,integrase,portal attL 2415723:2415741|attR 2475009:2475027
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP031751
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 345745 : 406150 41 uncultured_Caudovirales_phage(27.27%) transposase NA
DBSCAN-SWA_2 410529 : 462506 39 Liberibacter_phage(22.22%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage