Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031760 Pseudoalteromonas piscicida strain DE1-A chromosome 2, complete sequence 0 crisprs csa3,cas3,DinG,DEDDh 0 0 1 0
CP031759 Pseudoalteromonas piscicida strain DE1-A chromosome 1, complete sequence 3 crisprs cas3,DEDDh,WYL,DinG,csx1,RT,csa3 1 0 5 0

Results visualization

1. CP031760
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 560047 : 626753 56 Streptococcus_phage(10.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP031759
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031759_1 230261-230360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031759_2 713552-713890 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031759_3 2483083-2483194 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031759_2 2.2|713686|71|CP031759|PILER-CR 713686-713756 71 CP031759.1 713145-713215 11 0.845
CP031759_2 2.2|713686|71|CP031759|PILER-CR 713686-713756 71 CP031759.1 713257-713327 11 0.845

1. spacer 2.2|713686|71|CP031759|PILER-CR matches to position: 713145-713215, mismatch: 11, identity: 0.845

taagggcgatgctctcccaactgagctaacaacccaaattgtgtttcaatttatactctt	CRISPR spacer
taagggcgatgctctcccaactgagctaacaacccaaattgtgtttcaatttatactctt	Protospacer
************************************************************

2. spacer 2.2|713686|71|CP031759|PILER-CR matches to position: 713257-713327, mismatch: 11, identity: 0.845

taagggcgatgctctcccaactgagctaacaacccaaattgtgtttcaatttatactctt	CRISPR spacer
taagggcgatgctctcccaactgagctaacaacccaaattgtgtttcaatttatactctt	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1946375 : 2014137 47 Leptospira_phage(22.22%) transposase,plate,tRNA NA
DBSCAN-SWA_2 2033460 : 2044314 11 Vibrio_phage(28.57%) head NA
DBSCAN-SWA_3 2062751 : 2121447 52 Pseudomonas_phage(28.57%) capsid,tail,protease,transposase,tRNA NA
DBSCAN-SWA_4 2131647 : 2197683 57 Staphylococcus_phage(15.38%) integrase,transposase,tRNA attL 2154513:2154528|attR 2206082:2206097
DBSCAN-SWA_5 2845994 : 2888185 49 Vibrio_phage(26.67%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage