Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031762 Pseudoalteromonas piscicida strain DE2-A chromosome 2, complete sequence 0 crisprs DinG,cas3,csa3,DEDDh 0 0 0 0
CP031761 Pseudoalteromonas piscicida strain DE2-A chromosome 1, complete sequence 3 crisprs DEDDh,cas3,csx1,DinG,WYL,csa3 3 0 2 0

Results visualization

1. CP031761
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031761_1 1670668-1670779 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031761_2 2673433-2673539 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031761_3 3374315-3374771 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031761_2 2.1|2673458|57|CP031761|CRISPRCasFinder 2673458-2673514 57 CP031761.1 2677196-2677252 0 1.0
CP031761_3 3.2|3374449|71|CP031761|PILER-CR 3374449-3374519 71 CP031761.1 3374975-3375045 11 0.845
CP031761_3 3.2|3374449|71|CP031761|PILER-CR 3374449-3374519 71 CP031761.1 3375087-3375157 11 0.845
CP031761_3 3.4|3374660|71|CP031761|PILER-CR 3374660-3374730 71 CP031761.1 3374975-3375045 11 0.845
CP031761_3 3.4|3374660|71|CP031761|PILER-CR 3374660-3374730 71 CP031761.1 3375087-3375157 11 0.845

1. spacer 2.1|2673458|57|CP031761|CRISPRCasFinder matches to position: 2677196-2677252, mismatch: 0, identity: 1.0

gatcgcagggtgaacctgctcctactccgtgttgtaggagacgctttacgcggcgag	CRISPR spacer
gatcgcagggtgaacctgctcctactccgtgttgtaggagacgctttacgcggcgag	Protospacer
*********************************************************

2. spacer 3.2|3374449|71|CP031761|PILER-CR matches to position: 3374975-3375045, mismatch: 11, identity: 0.845

taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	CRISPR spacer
taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	Protospacer
************************************************************

3. spacer 3.2|3374449|71|CP031761|PILER-CR matches to position: 3375087-3375157, mismatch: 11, identity: 0.845

taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	CRISPR spacer
taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	Protospacer
************************************************************

4. spacer 3.4|3374660|71|CP031761|PILER-CR matches to position: 3374975-3375045, mismatch: 11, identity: 0.845

taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	CRISPR spacer
taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	Protospacer
************************************************************

5. spacer 3.4|3374660|71|CP031761|PILER-CR matches to position: 3375087-3375157, mismatch: 11, identity: 0.845

taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	CRISPR spacer
taactctattcaagagtataaattgaaacacaatttgggttgttagctcagttgggagag	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 711995 : 719768 8 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_2 1215422 : 1299233 100 Vibrio_phage(18.75%) plate,transposase,head,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage