Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031779 Staphylococcus aureus strain CFBR-105 chromosome, complete genome 8 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 8 3 8 0

Results visualization

1. CP031779
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_1 425156-425257 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_2 820668-820746 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_3 826123-826392 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_4 869387-869468 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_5 1662146-1662230 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_6 1696577-1696724 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_7 2181333-2181413 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031779_9 2301695-2301775 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 187044-187065 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 310120-310141 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 652786-652807 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 778817-778838 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 869460-869481 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1390572-1390593 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1479122-1479143 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1662222-1662243 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1676756-1676777 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1993864-1993885 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 187044-187065 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 310120-310141 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 652786-652807 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 778817-778838 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 869460-869481 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1390572-1390593 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1479122-1479143 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1662222-1662243 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1676756-1676777 0 1.0
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1993864-1993885 0 1.0
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 939691-939712 1 0.955
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1696484-1696505 1 0.955
CP031779_3 3.1|826159|22|CP031779|CRT 826159-826180 22 CP031779.1 1696717-1696738 1 0.955
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 779990-780012 1 0.957
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 1390688-1390710 1 0.957
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 1993922-1993944 1 0.957
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 2290866-2290888 1 0.957
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 939691-939712 1 0.955
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1696484-1696505 1 0.955
CP031779_3 3.3|826276|22|CP031779|CRT 826276-826297 22 CP031779.1 1696717-1696738 1 0.955
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 779990-780012 1 0.957
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 1390688-1390710 1 0.957
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 1993922-1993944 1 0.957
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 2290866-2290888 1 0.957
CP031779_4 4.1|869411|34|CP031779|CRISPRCasFinder 869411-869444 34 CP031779.1 1390668-1390701 1 0.971
CP031779_5 5.1|1662172|33|CP031779|CRISPRCasFinder 1662172-1662204 33 CP031779.1 1390669-1390701 1 0.97
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 833411-833441 1 0.968
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 833467-833497 1 0.968
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 1479005-1479027 2 0.913
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 CP031779.1 2052159-2052181 2 0.913
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 1479005-1479027 2 0.913
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 CP031779.1 2052159-2052181 2 0.913
CP031779_6 6.2|1696684|22|CP031779|PILER-CR 1696684-1696705 22 CP031779.1 1179055-1179076 2 0.909
CP031779_6 6.2|1696684|22|CP031779|PILER-CR 1696684-1696705 22 CP031779.1 2052105-2052126 2 0.909
CP031779_6 6.2|1696684|22|CP031779|PILER-CR 1696684-1696705 22 CP031779.1 2052164-2052185 2 0.909
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 88402-88432 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 386418-386448 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 652841-652871 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 833523-833553 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 869722-869752 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1037209-1037239 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1184534-1184564 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1390627-1390657 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1479058-1479088 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1479174-1479204 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 1676810-1676840 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 2290919-2290949 2 0.935
CP031779_9 9.1|2301720|31|CP031779|CRISPRCasFinder 2301720-2301750 31 CP031779.1 2468085-2468115 2 0.935

1. spacer 3.1|826159|22|CP031779|CRT matches to position: 187044-187065, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

2. spacer 3.1|826159|22|CP031779|CRT matches to position: 310120-310141, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 3.1|826159|22|CP031779|CRT matches to position: 652786-652807, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 3.1|826159|22|CP031779|CRT matches to position: 778817-778838, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 3.1|826159|22|CP031779|CRT matches to position: 869460-869481, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 3.1|826159|22|CP031779|CRT matches to position: 1390572-1390593, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 3.1|826159|22|CP031779|CRT matches to position: 1479122-1479143, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 3.1|826159|22|CP031779|CRT matches to position: 1662222-1662243, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 3.1|826159|22|CP031779|CRT matches to position: 1676756-1676777, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 3.1|826159|22|CP031779|CRT matches to position: 1993864-1993885, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 3.3|826276|22|CP031779|CRT matches to position: 187044-187065, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 3.3|826276|22|CP031779|CRT matches to position: 310120-310141, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 3.3|826276|22|CP031779|CRT matches to position: 652786-652807, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 3.3|826276|22|CP031779|CRT matches to position: 778817-778838, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 3.3|826276|22|CP031779|CRT matches to position: 869460-869481, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 3.3|826276|22|CP031779|CRT matches to position: 1390572-1390593, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 3.3|826276|22|CP031779|CRT matches to position: 1479122-1479143, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 3.3|826276|22|CP031779|CRT matches to position: 1662222-1662243, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 3.3|826276|22|CP031779|CRT matches to position: 1676756-1676777, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 3.3|826276|22|CP031779|CRT matches to position: 1993864-1993885, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 3.1|826159|22|CP031779|CRT matches to position: 939691-939712, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

22. spacer 3.1|826159|22|CP031779|CRT matches to position: 1696484-1696505, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

23. spacer 3.1|826159|22|CP031779|CRT matches to position: 1696717-1696738, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

24. spacer 3.2|826217|23|CP031779|CRT matches to position: 779990-780012, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

25. spacer 3.2|826217|23|CP031779|CRT matches to position: 1390688-1390710, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

26. spacer 3.2|826217|23|CP031779|CRT matches to position: 1993922-1993944, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

27. spacer 3.2|826217|23|CP031779|CRT matches to position: 2290866-2290888, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

28. spacer 3.3|826276|22|CP031779|CRT matches to position: 939691-939712, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

29. spacer 3.3|826276|22|CP031779|CRT matches to position: 1696484-1696505, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

30. spacer 3.3|826276|22|CP031779|CRT matches to position: 1696717-1696738, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

31. spacer 3.4|826334|23|CP031779|CRT matches to position: 779990-780012, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 3.4|826334|23|CP031779|CRT matches to position: 1390688-1390710, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

33. spacer 3.4|826334|23|CP031779|CRT matches to position: 1993922-1993944, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

34. spacer 3.4|826334|23|CP031779|CRT matches to position: 2290866-2290888, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

35. spacer 4.1|869411|34|CP031779|CRISPRCasFinder matches to position: 1390668-1390701, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

36. spacer 5.1|1662172|33|CP031779|CRISPRCasFinder matches to position: 1390669-1390701, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

37. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 833411-833441, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

38. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 833467-833497, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

39. spacer 3.2|826217|23|CP031779|CRT matches to position: 1479005-1479027, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

40. spacer 3.2|826217|23|CP031779|CRT matches to position: 2052159-2052181, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

41. spacer 3.4|826334|23|CP031779|CRT matches to position: 1479005-1479027, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

42. spacer 3.4|826334|23|CP031779|CRT matches to position: 2052159-2052181, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

43. spacer 6.2|1696684|22|CP031779|PILER-CR matches to position: 1179055-1179076, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattggtgatccaatttct	Protospacer
********* * **********

44. spacer 6.2|1696684|22|CP031779|PILER-CR matches to position: 2052105-2052126, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattgggaatccaatttct	Protospacer
**********. **********

45. spacer 6.2|1696684|22|CP031779|PILER-CR matches to position: 2052164-2052185, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattgggaatccaatttct	Protospacer
**********. **********

46. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 88402-88432, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

47. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 386418-386448, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

48. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 652841-652871, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

49. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 833523-833553, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

50. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 869722-869752, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

51. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1037209-1037239, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

52. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1184534-1184564, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

53. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1390627-1390657, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

54. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1479058-1479088, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

55. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1479174-1479204, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 1676810-1676840, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

57. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 2290919-2290949, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

58. spacer 9.1|2301720|31|CP031779|CRISPRCasFinder matches to position: 2468085-2468115, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP031779_3 3.2|826217|23|CP031779|CRT 826217-826239 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP031779_3 3.4|826334|23|CP031779|CRT 826334-826356 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP031779_8 8.1|2193680|34|CP031779|CRISPRCasFinder 2193680-2193713 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP031779_8 8.1|2193680|34|CP031779|CRISPRCasFinder 2193680-2193713 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 3.2|826217|23|CP031779|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 3.2|826217|23|CP031779|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 3.4|826334|23|CP031779|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 3.4|826334|23|CP031779|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 8.1|2193680|34|CP031779|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 8.1|2193680|34|CP031779|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 757895 : 765716 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 777687 : 792273 17 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 965147 : 1019791 55 Streptococcus_phage(28.57%) tRNA,protease,transposase,bacteriocin NA
DBSCAN-SWA_4 1038719 : 1047192 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1087934 : 1159622 90 Staphylococcus_phage(81.25%) transposase,capsid,tRNA,plate,holin,tail,head,terminase,portal NA
DBSCAN-SWA_6 1711816 : 1720859 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1841575 : 1913073 67 Staphylococcus_phage(95.65%) tRNA,protease NA
DBSCAN-SWA_8 1919274 : 1923521 6 Staphylococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage