Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031941 Nostoc sphaeroides strain Kutzing En chromosome, complete genome 26 crisprs NA 5 5 0 0
CP031942 Nostoc sphaeroides strain Kutzing En plasmid p1, complete sequence 0 crisprs NA 0 0 0 0
CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 0 crisprs NA 0 0 0 0
CP031945 Nostoc sphaeroides strain Kutzing En plasmid p4, complete sequence 0 crisprs NA 0 0 0 0
CP031944 Nostoc sphaeroides strain Kutzing En plasmid p3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP031941
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_1 314523-314632 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_2 593586-593688 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_3 990216-990302 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_4 1122565-1122701 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_5 1218175-1218280 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_6 1511965-1512602 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_7 1653451-1653529 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_8 2082627-2082718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_9 2483737-2483822 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_10 2728940-2729037 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_11 2744408-2744509 Orphan I-D,II-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_12 2770236-2770989 Orphan I-D,II-B
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_13 2869076-2869176 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_14 3665873-3665971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_15 3823531-3823672 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_16 4377499-4377701 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_17 4486635-4486744 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_18 5464562-5464776 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_19 5505553-5505657 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_20 5790486-5790641 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_21 6157875-6157970 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_22 6170769-6172671 Orphan I-D,II-B
26 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_23 6199529-6199635 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_24 6202756-6202835 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_25 6431972-6432235 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031941_26 6461154-6461557 Orphan NA:V-U5
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031941_7 7.1|1653474|33|CP031941|CRISPRCasFinder 1653474-1653506 33 CP031941.1 1966097-1966129 0 1.0
CP031941_19 19.1|5505584|43|CP031941|CRISPRCasFinder 5505584-5505626 43 CP031941.1 5505770-5505812 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 551803-551860 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 709946-710003 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 743904-743961 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 2066291-2066348 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 4820023-4820080 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 4820130-4820187 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 4820237-4820294 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 4908300-4908357 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 5138255-5138312 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 5415708-5415765 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 5715621-5715678 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 6012851-6012908 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 6418342-6418399 0 1.0
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 6418449-6418506 0 1.0
CP031941_25 25.1|6432026|51|CP031941|PILER-CR 6432026-6432076 51 CP031941.1 6431921-6431971 0 1.0
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 657211-657263 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 657287-657339 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 1477971-1478023 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 1478047-1478099 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 2097458-2097510 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 3045038-3045090 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 3045114-3045166 1 0.981
CP031941_14 14.1|3665896|53|CP031941|CRISPRCasFinder 3665896-3665948 53 CP031941.1 3665820-3665872 1 0.981
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 11886-11943 1 0.983
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 2806129-2806186 1 0.983
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 3208931-3208988 1 0.983
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 3821780-3821837 1 0.983
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 6254106-6254163 1 0.983
CP031941_20 20.1|5790535|58|CP031941|CRISPRCasFinder 5790535-5790592 58 CP031941.1 4078372-4078429 2 0.966

1. spacer 7.1|1653474|33|CP031941|CRISPRCasFinder matches to position: 1966097-1966129, mismatch: 0, identity: 1.0 

atttttgaatcttggtggtctacaagagcgtgg	CRISPR spacer
atttttgaatcttggtggtctacaagagcgtgg	Protospacer
*********************************

2. spacer 19.1|5505584|43|CP031941|CRISPRCasFinder matches to position: 5505770-5505812, mismatch: 0, identity: 1.0 

gggagtaccagtgattagtcgagatagcaaaattcaactatct	CRISPR spacer
gggagtaccagtgattagtcgagatagcaaaattcaactatct	Protospacer
*******************************************

3. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 551803-551860, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

4. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 709946-710003, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

5. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 743904-743961, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

6. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 2066291-2066348, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

7. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 4820023-4820080, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

8. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 4820130-4820187, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

9. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 4820237-4820294, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

10. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 4908300-4908357, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

11. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 5138255-5138312, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

12. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 5415708-5415765, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

13. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 5715621-5715678, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

14. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 6012851-6012908, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

15. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 6418342-6418399, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

16. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 6418449-6418506, mismatch: 0, identity: 1.0 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**********************************************************

17. spacer 25.1|6432026|51|CP031941|PILER-CR matches to position: 6431921-6431971, mismatch: 0, identity: 1.0 

agcgtcccccagatttcccaatgcatttgctgcactgaaacgaacactttt	CRISPR spacer
agcgtcccccagatttcccaatgcatttgctgcactgaaacgaacactttt	Protospacer
***************************************************

18. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 657211-657263, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

19. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 657287-657339, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

20. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 1477971-1478023, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

21. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 1478047-1478099, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

22. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 2097458-2097510, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

23. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 3045038-3045090, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

24. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 3045114-3045166, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

25. spacer 14.1|3665896|53|CP031941|CRISPRCasFinder matches to position: 3665820-3665872, mismatch: 1, identity: 0.981 

ttgactgaaaactcgtgaaccgtcaagggtcaacagtgaacaatagcaaaagt	CRISPR spacer
ttgactgaaaactcgtgaaccgtcaacggtcaacagtgaacaatagcaaaagt	Protospacer
************************** **************************

26. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 11886-11943, mismatch: 1, identity: 0.983 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctctacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
********.*************************************************

27. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 2806129-2806186, mismatch: 1, identity: 0.983 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctctacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
********.*************************************************

28. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 3208931-3208988, mismatch: 1, identity: 0.983 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctctacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
********.*************************************************

29. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 3821780-3821837, mismatch: 1, identity: 0.983 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaataagacagagc	Protospacer
************************************************.*********

30. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 6254106-6254163, mismatch: 1, identity: 0.983 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcacgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	Protospacer
**.*******************************************************

31. spacer 20.1|5790535|58|CP031941|CRISPRCasFinder matches to position: 4078372-4078429, mismatch: 2, identity: 0.966 

tcgcgtctttacagggttttggtaacaaactaatcaatcagaattaatgagacagagc	CRISPR spacer
tcgcgtctctacagggttttggtaacaaactaatcaatcataattaatgagacagagc	Protospacer
********.******************************* *****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 BK000583 TPA_inf: Enterobacteria phage P22 wild type, complete genome 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MN161573 UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KU927496 Salmonella phage 101962B_sal5, complete genome 30189-30213 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_011802 Salmonella enterica bacteriophage SE1, complete genome 31500-31524 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AY121860 Enterobacteria phage P22 section B, partial genomic sequence 100-124 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AB426868 Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 CP051278 Salmonella phage ST-87, complete genome 544-568 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AY795968 Bacteriophage L head assembly gene cluster, partial sequence 7903-7927 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 CP051288 Salmonella phage ST-29, complete genome 13333-13357 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MW013502 Salmonella virus L cI-40 13-am43, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 CP051285 Salmonella phage ST-32, complete genome 6477-6501 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KU927491 Salmonella phage 146851_sal5, complete genome 30956-30980 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK770415 Salmonella phage SF11, complete genome 24846-24870 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK770414 Salmonella phage SE16, complete genome 28742-28766 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MT774487 Salmonella phage MG40, complete genome 6591-6615 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_002371 Enterobacteria phage P22 virus, complete genome 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KU927495 Salmonella phage 103203_sal4, complete genome 30452-30476 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 M59749 Bacteriophage P22 packaging genes 6614-6638 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MH370387 Salmonella phage S149, complete genome 31354-31378 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KU927498 Salmonella phage 64795_sal4, complete genome 7458-7482 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_004348 Enterobacteria phage ST64T, complete genome 30809-30833 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MW013503 Salmonella virus L cII-101, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KU927492 Salmonella phage 146851_sal4, complete genome 7469-7493 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MG407615 Salmonella phage Bp96115, partial genome 21273-21297 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AF217253 Bacteriophage P22 complete genome 29802-29826 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_030919 Salmonella phage 118970_sal4, complete genome 30481-30505 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_028696 Salmonella phage SEN22, complete genome 7147-7171 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_013059 Salmonella phage c341, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_018275 Salmonella phage vB_SemP_Emek, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_017985 Salmonella phage SPN9CC, complete genome 30185-30209 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972686 Salmonella phage SF3, complete genome 6180-6204 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_042346 Salmonella virus BTP1 genome assembly, chromosome: BTP1 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972685 Salmonella phage SE10, complete genome 7415-7439 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AB362338 Enterobacteria phage P22 DNA, complete sequence, strain: MSU 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972687 Salmonella phage SE1 (in:P22virus), complete genome 39689-39713 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 FJ000341 Salmonella phage g341c, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_014900 Salmonella phage ST160, complete genome 30623-30647 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 GQ422451 Enterobacteria phage Phi75, partial genome 29214-29238 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 GQ422450 Enterobacteria phage UAB_Phi20, complete genome 15687-15711 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 30809-30833 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 AF527608 Bacteriophage P22-pbi, complete sequence 6327-6351 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_005841 Enterobacteria phage ST104 DNA, complete genome 31355-31379 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972688 Salmonella phage SI8, complete genome 12217-12241 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MF188997 Salmonella phage vB_SalP_PM43, complete genome 30704-30728 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 CP051279 Salmonella phage ST-35, complete genome 4626-4650 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 EU570103 Salmonella phage epsilon34, complete genome 6944-6968 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_031946 Salmonella Phage 103203_sal5, complete genome 7471-7495 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 NC_047875 Salmonella phage UPF_BP1, complete genome 19831-19855 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MT932212 Salmonella phage VSe13, complete genome 6605-6629 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972689 Salmonella phage SF6, complete genome 38885-38909 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 CP051272 Salmonella phage SW-70, complete genome 18759-18783 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972693 Salmonella phage SI23, complete genome 38775-38799 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MG969415 UNVERIFIED: Salmonella phage GE_vB_TR, complete genome 35825-35849 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KR296686 Salmonella phage 22, complete genome 41301-41325 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972694 Salmonella phage SE22, complete genome 17847-17871 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972697 Salmonella phage SF10, complete genome 23368-23392 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KR296688 Salmonella phage 34, complete genome 9802-9826 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972696 Salmonella phage Si3 KFo-2019, complete genome 23233-23257 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 KR296687 Salmonella phage 25, complete genome 9816-9840 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972695 Salmonella phage SI5, complete genome 27899-27923 4 0.84
CP031941_2 2.1|593625|25|CP031941|CRISPRCasFinder 593625-593649 25 MK972692 Salmonella phage SE21, complete genome 16983-17007 4 0.84
CP031941_22 22.13|6171669|32|CP031941|PILER-CR,CRISPRCasFinder,CRT 6171669-6171700 32 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 165628-165659 8 0.75
CP031941_12 12.8|2770780|34|CP031941|PILER-CR,CRISPRCasFinder,CRT 2770780-2770813 34 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 435751-435784 9 0.735
CP031941_12 12.8|2770780|34|CP031941|PILER-CR,CRISPRCasFinder,CRT 2770780-2770813 34 NZ_CP009363 Yersinia frederiksenii Y225 plasmid unnsmrf, complete sequence 4517-4550 9 0.735
CP031941_24 24.1|6202779|34|CP031941|CRISPRCasFinder 6202779-6202812 34 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 54154-54187 9 0.735
CP031941_24 24.1|6202779|34|CP031941|CRISPRCasFinder 6202779-6202812 34 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 291124-291157 9 0.735
CP031941_4 4.1|1122607|53|CP031941|CRISPRCasFinder 1122607-1122659 53 NZ_CP024791 Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence 68101-68153 11 0.792

1. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

2. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

3. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KU927496 (Salmonella phage 101962B_sal5, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

4. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_011802 (Salmonella enterica bacteriophage SE1, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

5. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AY121860 (Enterobacteria phage P22 section B, partial genomic sequence) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

6. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

7. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to CP051278 (Salmonella phage ST-87, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

8. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AY795968 (Bacteriophage L head assembly gene cluster, partial sequence) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

9. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

10. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

11. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to CP051285 (Salmonella phage ST-32, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

12. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KU927491 (Salmonella phage 146851_sal5, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

13. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK770415 (Salmonella phage SF11, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

14. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK770414 (Salmonella phage SE16, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

15. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

16. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

17. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KU927495 (Salmonella phage 103203_sal4, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

18. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to M59749 (Bacteriophage P22 packaging genes) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

19. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MH370387 (Salmonella phage S149, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

20. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KU927498 (Salmonella phage 64795_sal4, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

21. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

22. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

23. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KU927492 (Salmonella phage 146851_sal4, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

24. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MG407615 (Salmonella phage Bp96115, partial genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

25. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

26. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_030919 (Salmonella phage 118970_sal4, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

27. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

28. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_013059 (Salmonella phage c341, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

29. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

30. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_017985 (Salmonella phage SPN9CC, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

31. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972686 (Salmonella phage SF3, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

32. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

33. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972685 (Salmonella phage SE10, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

34. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

35. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972687 (Salmonella phage SE1 (in:P22virus), complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

36. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to FJ000341 (Salmonella phage g341c, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

37. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_014900 (Salmonella phage ST160, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

38. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to GQ422451 (Enterobacteria phage Phi75, partial genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

39. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to GQ422450 (Enterobacteria phage UAB_Phi20, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

40. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

41. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

42. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_005841 (Enterobacteria phage ST104 DNA, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

43. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972688 (Salmonella phage SI8, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

44. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

45. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to CP051279 (Salmonella phage ST-35, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

46. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

47. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_031946 (Salmonella Phage 103203_sal5, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

48. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

49. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

50. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972689 (Salmonella phage SF6, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

51. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to CP051272 (Salmonella phage SW-70, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

52. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972693 (Salmonella phage SI23, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

53. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MG969415 (UNVERIFIED: Salmonella phage GE_vB_TR, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

54. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

55. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972694 (Salmonella phage SE22, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

56. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972697 (Salmonella phage SF10, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

57. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

58. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972696 (Salmonella phage Si3 KFo-2019, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

59. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

60. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972695 (Salmonella phage SI5, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

61. spacer 2.1|593625|25|CP031941|CRISPRCasFinder matches to MK972692 (Salmonella phage SE21, complete genome) position: , mismatch: 4, identity: 0.84 

gtcgtctttagtctttatcttcatt	CRISPR spacer
atcgcctttagtctttatctgcatc	Protospacer
.***.*************** ***.

62. spacer 22.13|6171669|32|CP031941|PILER-CR,CRISPRCasFinder,CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ctatctgcaaatgactacgtata-----tccatctga	CRISPR spacer
ctatttgcaaatgaatacgtataggatgacca-----	Protospacer
****.********* ********      ***

63. spacer 12.8|2770780|34|CP031941|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 9, identity: 0.735 

ttgatgaagctggtattttattaaattctcgtga------	CRISPR spacer
ttgatgaagctagaattttattaa------gtaaaaaatt	Protospacer
***********.* **********      **.*

64. spacer 12.8|2770780|34|CP031941|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009363 (Yersinia frederiksenii Y225 plasmid unnsmrf, complete sequence) position: , mismatch: 9, identity: 0.735 

ttgatgaagctggtattttattaaattctcgtga	CRISPR spacer
aagatgaagctgttatttttttaaatgagctaga	Protospacer
  ********** ****** ******   *  **

65. spacer 24.1|6202779|34|CP031941|CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.735 

ctacaccaaccccatcaccaaaagtgcgatcgct	CRISPR spacer
ctacaccaacaccatcaccgaaagggaacaccca	Protospacer
********** ********.**** * .  * *

66. spacer 24.1|6202779|34|CP031941|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 9, identity: 0.735 

ctacaccaaccccatcaccaaaagtgcgatcgct	CRISPR spacer
ctacaccaacaccatcaccgaaagggaacaccca	Protospacer
********** ********.**** * .  * *

67. spacer 4.1|1122607|53|CP031941|CRISPRCasFinder matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 11, identity: 0.792 

tgcgaattgcgaattggtttaagtcccctgcttctatcaagcagcgcgtgaaa	CRISPR spacer
tgaacgtagttcaggggttaaagtcccctgcttctatcaagcagcgcgtgaaa	Protospacer
** . .* *.  *  **** *********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage