Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031969 Streptomyces sp. CC0208 chromosome, complete genome 10 crisprs NA 1 1 0 0

Results visualization

1. CP031969
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_1 1393644-1393735 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_4 1592072-1592158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_2 1591710-1591814 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_3 1591877-1591981 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_6 1682280-1682428 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_5 1681902-1682051 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_7 2959311-2959397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_8 3443599-3443811 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_9 4639799-4639998 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031969_10 8463548-8463717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 588912-588928 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 752975-752991 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 2805860-2805876 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 2990441-2990457 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 4253345-4253361 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 5955151-5955167 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 7979395-7979411 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 8546585-8546601 1 0.941
CP031969_2 2.2|1591774|17|CP031969|CRISPRCasFinder 1591774-1591790 17 CP031969.1 8833861-8833877 1 0.941

1. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 588912-588928, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggccgaccgcg	Protospacer
************** **

2. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 752975-752991, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccacggccgaccccg	Protospacer
****.************

3. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 2805860-2805876, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggccgagcccg	Protospacer
************ ****

4. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 2990441-2990457, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggtcgaccccg	Protospacer
********.********

5. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 4253345-4253361, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggccgagcccg	Protospacer
************ ****

6. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 5955151-5955167, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggccgacgccg	Protospacer
************* ***

7. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 7979395-7979411, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgcggccgaccacg	Protospacer
************** **

8. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 8546585-8546601, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
ccccgaggccgaccccg	Protospacer
***** ***********

9. spacer 2.2|1591774|17|CP031969|CRISPRCasFinder matches to position: 8833861-8833877, mismatch: 1, identity: 0.941 

ccccgcggccgaccccg	CRISPR spacer
cctcgcggccgaccccg	Protospacer
**.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031969_8 8.2|3443689|36|CP031969|CRT 3443689-3443724 36 MG655267 Erwinia phage vB_EamM_Bosolaphorus, complete genome 202512-202547 9 0.75
CP031969_8 8.2|3443689|36|CP031969|CRT 3443689-3443724 36 KU886225 Erwinia phage vB_EamM_Deimos-Minion, complete genome 203639-203674 9 0.75
CP031969_8 8.2|3443689|36|CP031969|CRT 3443689-3443724 36 MG655270 Erwinia phage vB_EamM_Mortimer, complete genome 204196-204231 9 0.75

1. spacer 8.2|3443689|36|CP031969|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 9, identity: 0.75 

gtgccgccgcagcagggctacccccagcagcaggga	CRISPR spacer
atgtatcctcagcagggctacccacagcagcagatg	Protospacer
.**.  ** ************** *********. .

2. spacer 8.2|3443689|36|CP031969|CRT matches to KU886225 (Erwinia phage vB_EamM_Deimos-Minion, complete genome) position: , mismatch: 9, identity: 0.75 

gtgccgccgcagcagggctacccccagcagcaggga	CRISPR spacer
atgtatcctcagcagggctacccacagcagcagatg	Protospacer
.**.  ** ************** *********. .

3. spacer 8.2|3443689|36|CP031969|CRT matches to MG655270 (Erwinia phage vB_EamM_Mortimer, complete genome) position: , mismatch: 9, identity: 0.75 

gtgccgccgcagcagggctacccccagcagcaggga	CRISPR spacer
atgtatcctcagcagggctacccacagcagcagatg	Protospacer
.**.  ** ************** *********. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage