1. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
2. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
3. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
4. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
5. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
6. spacer 1.1|70026|27|CP031258|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
7. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
8. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
9. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
10. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
11. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
12. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
13. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
14. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
15. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
16. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
17. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
18. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
19. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatg Protospacer
***************************
20. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
21. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
22. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
23. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
24. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
25. spacer 1.2|70092|36|CP031258|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
26. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
27. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
28. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
29. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
30. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
31. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
32. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
33. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
34. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
35. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
36. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
37. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
38. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
39. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
40. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
41. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
42. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct Protospacer
************************************
43. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
44. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
45. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
46. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
47. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
48. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
49. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
50. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
51. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
52. spacer 1.1|70026|27|CP031258|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
53. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
54. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
55. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
56. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
57. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
58. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
59. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
60. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.963
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaaggtaatt Protospacer
**************************
61. spacer 1.2|70092|36|CP031258|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgccg Protospacer
***********************************
62. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
63. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
64. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
65. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
66. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
67. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
68. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
69. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
70. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
71. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
72. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
73. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct Protospacer
********************** *************
74. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.972
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct Protospacer
**************** *******************
75. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
76. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
77. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
78. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
79. spacer 1.1|70026|27|CP031258|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
80. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
81. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
82. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
83. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
84. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggaaaggttctgaaaggtaatt Protospacer
******** *****************
85. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
86. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
87. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
88. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
89. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
90. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
91. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
92. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
93. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
94. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
95. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
96. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
97. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
98. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
99. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
100. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
101. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
102. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
103. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
104. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
105. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
106. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
107. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
108. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
109. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
110. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
111. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
112. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
113. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
114. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
115. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
116. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
117. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
118. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
119. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
120. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
121. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
122. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
123. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
124. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
125. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
126. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
127. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
128. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
129. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
130. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
131. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
132. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
133. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
134. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
135. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaagataatt Protospacer
*********************.****
136. spacer 1.2|70092|36|CP031258|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgccg Protospacer
********************** ************
137. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
138. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
139. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
140. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
141. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
142. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
143. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
144. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatagccggttatgccc Protospacer
****************.******************.
145. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
146. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
147. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.944
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct Protospacer
****************.***** *************
148. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctggaagataatt Protospacer
*****************.***.****
149. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaacggataggttctgaaagataatt Protospacer
*** *****************.****
150. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggtaaggttctgaaaggtaatt Protospacer
******* *****************
151. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggtaaggttctgaaaggtaatt Protospacer
******* *****************
152. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaacggataggttctgaaagataatt Protospacer
*** *****************.****
153. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtactggataggttctgaaagataatt Protospacer
****.****************.****
154. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggtaaggttctgaaaggtaatt Protospacer
******* *****************
155. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaacggataggttctgaaagataatt Protospacer
*** *****************.****
156. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaacggataggttctgaaagataatt Protospacer
*** *****************.****
157. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtactggataggttctgaaagataatt Protospacer
****.****************.****
158. spacer 1.2|70092|36|CP031258|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
159. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
160. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccg Protospacer
****************.***** ************
161. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccg Protospacer
****************.***** ************
162. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
163. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
164. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
165. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
166. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
167. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
168. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
169. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
170. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
171. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
172. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
173. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
174. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgtcg Protospacer
********************** **********.*
175. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
176. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
177. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
178. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
179. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
180. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
181. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 3, identity: 0.917
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg Protospacer
********************** ******* ****
182. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
183. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
184. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
185. spacer 1.1|70026|27|CP031258|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
186. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
187. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
188. spacer 1.1|70026|27|CP031258|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
189. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
190. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
191. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
192. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
193. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
194. spacer 1.1|70026|27|CP031258|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
195. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
196. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
197. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
198. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
199. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
200. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
201. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
202. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
acaccgggtaggttctgaaaggcaatg Protospacer
..*****.**************.****
203. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
204. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
205. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
206. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
207. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
208. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_AP014639 (Leptolyngbya boryana IAM M-101 plasmid pLBA) position: , mismatch: 4, identity: 0.852
-gtaccggataggttctgaaaggtaatg CRISPR spacer
tgtatt-gataggttctgaaagttaatg Protospacer
***.. *************** *****
209. spacer 1.1|70026|27|CP031258|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 4, identity: 0.852
gtaccggataggttctgaaaggtaatg CRISPR spacer
gtaccggataggttctgaaggtaattg Protospacer
*******************.* * **
210. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca Protospacer
********************** ********* *
211. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca Protospacer
********************** ********* *
212. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca Protospacer
********************** ********* *
213. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
214. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
215. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
216. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
217. spacer 1.2|70092|36|CP031258|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
218. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
219. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
220. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
221. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
222. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
223. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
224. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
225. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
226. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
227. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
228. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
229. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
230. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
231. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
232. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
233. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
234. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
235. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
236. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
237. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
238. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
239. spacer 1.2|70092|36|CP031258|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct Protospacer
*. *****.************* *************
240. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.806
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca Protospacer
*. *****.************* ********* *
241. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca Protospacer
*. *****.************* ********* *
242. spacer 1.2|70092|36|CP031258|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.806
gtgcggttgaatggccaggcatagccggttatgcct CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca Protospacer
*. *****.************* ********* *