Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 0 crisprs csa3 0 0 2 0
CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 0 crisprs NA 0 0 0 0
CP032052 Streptomyces clavuligerus strain F1D-5 chromosome, complete genome 15 crisprs DEDDh,csa3,DinG,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,WYL,cas2,cas1,cas4,cas6,RT 1 9 1 0

Results visualization

1. CP032054
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 57943 : 133235 50 Micromonas_sp._RCC1109_virus(16.67%) protease,tail,holin,plate NA
DBSCAN-SWA_2 915580 : 951605 30 Synechococcus_phage(50.0%) protease,tail,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032052
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_1 1138034-1138155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_2 1195802-1195899 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_4 1393352-1393440 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_5 2345719-2345839 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_6 2505782-2505883 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_7 2638223-2638370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_11 4068478-4068549 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_12 4387992-4388069 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_14 4699749-4700234 Unclear NA
7 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_15 4709329-4709753 Unclear NA
6 spacers
cas6,cas7,cas5,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_16 4938052-4938134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_17 4940119-4940223 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_18 5691948-5692036 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_19 5737373-5737460 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032052_20 6458539-6458618 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032052_20 20.1|6458564|30|CP032052|CRISPRCasFinder 6458564-6458593 30 CP032052.1 5932339-5932368 1 0.967

1. spacer 20.1|6458564|30|CP032052|CRISPRCasFinder matches to position: 5932339-5932368, mismatch: 1, identity: 0.967 

ggggcgtccgtcggcagacgcttcagcgtc	CRISPR spacer
ggggcgtccgtcggcggacgcttcagcgtc	Protospacer
***************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032052_3 3.3|1235936|24|CP032052|CRT 1235936-1235959 24 MN694304 Marine virus AFVG_250M1043, complete genome 35210-35233 3 0.875
CP032052_3 3.3|1235936|24|CP032052|CRT 1235936-1235959 24 NZ_CP053711 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence 204660-204683 3 0.875
CP032052_3 3.3|1235936|24|CP032052|CRT 1235936-1235959 24 NZ_CP053714 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence 15395-15418 3 0.875
CP032052_3 3.3|1235936|24|CP032052|CRT 1235936-1235959 24 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 449608-449631 3 0.875
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_KY000068 Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence 96786-96815 4 0.867
CP032052_10 10.1|3005579|25|CP032052|CRISPRCasFinder 3005579-3005603 25 MT270409 Phaeobacter phage MD18, complete genome 71939-71963 4 0.84
CP032052_10 10.1|3005579|25|CP032052|CRISPRCasFinder 3005579-3005603 25 MN602268 Bacteriophage DSS3_MAL1, complete genome 109132-109156 4 0.84
CP032052_3 3.3|1235936|24|CP032052|CRT 1235936-1235959 24 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 154458-154481 5 0.792
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 299564-299597 5 0.853
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1191715-1191744 6 0.8
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 554287-554316 6 0.8
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 552994-553023 6 0.8
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NC_023316 Streptomyces sp. 14R-10 plasmid pZL1, complete sequence 99735-99764 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 28543-28572 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 717591-717620 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP050125 Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence 210089-210118 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 330959-330988 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 216903-216932 7 0.767
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP008954 Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence 20364-20397 7 0.794
CP032052_20 20.1|6458564|30|CP032052|CRISPRCasFinder 6458564-6458593 30 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 202628-202657 7 0.767
CP032052_20 20.1|6458564|30|CP032052|CRISPRCasFinder 6458564-6458593 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 653816-653845 7 0.767
CP032052_20 20.1|6458564|30|CP032052|CRISPRCasFinder 6458564-6458593 30 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 202628-202657 7 0.767
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 28219-28248 8 0.733
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP021375 Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence 98212-98241 8 0.733
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 56861-56890 8 0.733
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 4966-4995 8 0.733
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 778582-778611 8 0.733
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NC_018532 Arthrobacter sp. Rue61a plasmid p232, complete sequence 210426-210455 8 0.733
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 271314-271343 8 0.733
CP032052_3 3.5|1236014|30|CP032052|CRT 1236014-1236043 30 NC_019941 Thioflavicoccus mobilis 8321 plasmid pTHIMO01, complete sequence 38006-38035 8 0.733
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 167716-167749 8 0.765
CP032052_14 14.1|4699778|40|CP032052|CRISPRCasFinder,CRT 4699778-4699817 40 NC_004934 Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence 25492-25531 8 0.8
CP032052_3 3.2|1235888|30|CP032052|CRT 1235888-1235917 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1854789-1854818 9 0.7
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NC_023722 Rhodococcus phage ReqiPine5, complete genome 42269-42302 9 0.735
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 MK880124 Microbacterium phage IAmGroot, complete genome 6862-6898 9 0.757
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 352156-352192 9 0.757
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 472590-472626 9 0.757
CP032052_15 15.12|4709688|35|CP032052|PILER-CR 4709688-4709722 35 CP003950 Rhodococcus opacus PD630 plasmid 1, complete sequence 44042-44076 9 0.743
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 23780-23813 10 0.706
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP007792 Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence 80406-80439 10 0.706
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 504747-504780 10 0.706
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 NZ_CP040824 Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence 69161-69197 10 0.73
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 626227-626263 10 0.73
CP032052_15 15.7|4709490|37|CP032052|CRISPRCasFinder 4709490-4709526 37 KT001914 Caulobacter phage Seuss, complete genome 75763-75799 10 0.73
CP032052_9 9.1|2808481|34|CP032052|CRISPRCasFinder 2808481-2808514 34 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 14401-14434 11 0.676

1. spacer 3.3|1235936|24|CP032052|CRT matches to MN694304 (Marine virus AFVG_250M1043, complete genome) position: , mismatch: 3, identity: 0.875 

ttgatccggctgacgctccggctc	CRISPR spacer
gtgatccggctgacgctccggcag	Protospacer
 *********************

2. spacer 3.3|1235936|24|CP032052|CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875 

ttgatccggctgacgctccggctc	CRISPR spacer
acgttccggctgacgctccggctc	Protospacer
 .* ********************

3. spacer 3.3|1235936|24|CP032052|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 3, identity: 0.875 

ttgatccggctgacgctccggctc	CRISPR spacer
gcgctccggctgacgctccggctc	Protospacer
 .* ********************

4. spacer 3.3|1235936|24|CP032052|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 3, identity: 0.875 

ttgatccggctgacgctccggctc	CRISPR spacer
atgatccggctgatgctccggcgc	Protospacer
 ************.******** *

5. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_KY000068 (Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence) position: , mismatch: 4, identity: 0.867 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
atgatccggccgaggttccagctccggcac	Protospacer
 ************ ***** ******** *

6. spacer 10.1|3005579|25|CP032052|CRISPRCasFinder matches to MT270409 (Phaeobacter phage MD18, complete genome) position: , mismatch: 4, identity: 0.84 

ccccgtcaaaccgccccggcggctc	CRISPR spacer
ccccgtcgaaccgccccggcgagtt	Protospacer
*******.*************. *.

7. spacer 10.1|3005579|25|CP032052|CRISPRCasFinder matches to MN602268 (Bacteriophage DSS3_MAL1, complete genome) position: , mismatch: 4, identity: 0.84 

ccccgtcaaaccgccccggcggctc	CRISPR spacer
ccccgtcgaaccgccccggcgagtt	Protospacer
*******.*************. *.

8. spacer 3.3|1235936|24|CP032052|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 5, identity: 0.792 

ttgatccggctgacgctccggctc	CRISPR spacer
ttgatccggctgacgctccccgcg	Protospacer
*******************   .

9. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 5, identity: 0.853 

-gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
ggtgcggc-cgacgtcggtcgccgcgtccttgacc	Protospacer
 ** **** ******* * ***************

10. spacer 3.5|1236014|30|CP032052|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8 

gcgttcccgctccggcgccagccgacgctc	CRISPR spacer
gcggagccgctccggcgccagccgaggccg	Protospacer
***   ******************* **.

11. spacer 3.5|1236014|30|CP032052|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.8 

gcgt-tcccgctccggcgccagccgacgctc	CRISPR spacer
-cgtgtcccgctcctgcgccagccgaaggat	Protospacer
 *** ********* *********** *  .

12. spacer 3.5|1236014|30|CP032052|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.8 

gcgt-tcccgctccggcgccagccgacgctc	CRISPR spacer
-cgtgtcccgctcctgcgccagccgaaggat	Protospacer
 *** ********* *********** *  .

13. spacer 3.2|1235888|30|CP032052|CRT matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
cccaggcggccgacgctcccgctccggccc	Protospacer
.. *  *********.************.*

14. spacer 3.2|1235888|30|CP032052|CRT matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
ttgatgcggccgacgtttccgctgccgtct	Protospacer
***** ***********.***** * *...

15. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc--	CRISPR spacer
gcgatccggccgacgttcctgct--ggtccag	Protospacer
 .*****************.***  **..*

16. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
ttgatgcggccgacgtttccgctgccgtct	Protospacer
***** ***********.***** * *...

17. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc--	CRISPR spacer
gcgatccggccgacgttcctgct--ggtccag	Protospacer
 .*****************.***  **..*

18. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
ttgatgcggccgacgtttccgctgccgtct	Protospacer
***** ***********.***** * *...

19. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP008954 (Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence) position: , mismatch: 7, identity: 0.794 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
ctccggctcgacgtccggcgtcgcggcggcggcg	Protospacer
 *******************.**** *  .*.**

20. spacer 20.1|6458564|30|CP032052|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.767 

ggggcgtccgtcggcagacgcttca-gcgtc	CRISPR spacer
accctgtgcgtcggcagacgcttcaggcgt-	Protospacer
.   .** ***************** ****

21. spacer 20.1|6458564|30|CP032052|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767 

ggggcgtccgtcggcagacgcttcagcgtc	CRISPR spacer
ggcgcgtccggcggcagacgctttgccgcg	Protospacer
** ******* ************.. **.

22. spacer 20.1|6458564|30|CP032052|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.767 

ggggcgtccgtcggcagacgcttca-gcgtc	CRISPR spacer
accctgtgcgtcggcagacgcttcaggcgt-	Protospacer
.   .** ***************** ****

23. spacer 3.2|1235888|30|CP032052|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
ttgatacggccgacgtttccgctgccatcg	Protospacer
***** ***********.***** * ...

24. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
tcataccggccgacgttccagctccgtcgt	Protospacer
*..  ************** ****** * .

25. spacer 3.2|1235888|30|CP032052|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
ccgttccggccgaggtgcccgctccggagg	Protospacer
..* ********* ** **********

26. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
cgcagccggccgcccttcccgctccggccg	Protospacer
.  * ******* * *************.

27. spacer 3.5|1236014|30|CP032052|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgttcccgctccggcgccagccgacgctc	CRISPR spacer
tcgttcccgctacagcgccagccgtcctcg	Protospacer
 ********** *.********** * ..

28. spacer 3.5|1236014|30|CP032052|CRT matches to NC_018532 (Arthrobacter sp. Rue61a plasmid p232, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgttcccgctccggcgccagccgacgctc	CRISPR spacer
ccgttcccgcaccggcgcccgccgttcccg	Protospacer
 ********* ******** **** . *.

29. spacer 3.5|1236014|30|CP032052|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgttcccgctccggcgccagccgacgctc	CRISPR spacer
ccgttccccctccgccgccagccgggagtt	Protospacer
 ******* ***** *********. . *.

30. spacer 3.5|1236014|30|CP032052|CRT matches to NC_019941 (Thioflavicoccus mobilis 8321 plasmid pTHIMO01, complete sequence) position: , mismatch: 8, identity: 0.733 

gcgttcccgctccggcgccagccgacgctc	CRISPR spacer
gcgttcctgctccagcgccagccaggccag	Protospacer
*******.*****.*********..  *

31. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.765 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
gaacggcgcgacgtccggcgcggcgtccccgggg	Protospacer
*  **** ************* ******..*. *

32. spacer 14.1|4699778|40|CP032052|CRISPRCasFinder,CRT matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 8, identity: 0.8 

-gcgcgcactggctcggccagcccctggccgtcgtcggcga	CRISPR spacer
gccgtgc-ctacctcggtcagcccctggccgtcgtcgtcgt	Protospacer
  **.** **. *****.******************* **

33. spacer 3.2|1235888|30|CP032052|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgatccggccgacgttcccgctccggctc	CRISPR spacer
atgatccggccgacggtcccggtcgaataa	Protospacer
 ************** ***** ** ...

34. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NC_023722 (Rhodococcus phage ReqiPine5, complete genome) position: , mismatch: 9, identity: 0.735 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
gatcgcctcgacgtccggcgccgcatcccgcgag	Protospacer
* .** ******************.***.  . *

35. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to MK880124 (Microbacterium phage IAmGroot, complete genome) position: , mismatch: 9, identity: 0.757 

gccccgacgccatggtcgccgccgtccgcatggtcat-	CRISPR spacer
acctcgacgccatcgtcgccgccgtccg-ataaccccc	Protospacer
.**.********* ************** **...* .

36. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.757 

gccccgacgccatggtcgccgccgtccgcatggtcat	CRISPR spacer
ccgccgtcgccatggccgccgccgtccgccgggcgct	Protospacer
 * *** ********.*************  **.  *

37. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.757 

gccccgacgccatggtcgccgccgtccgcatggtcat	CRISPR spacer
ccgccgtcgccatggccgccgccgtccgccgggcgct	Protospacer
 * *** ********.*************  **.  *

38. spacer 15.12|4709688|35|CP032052|PILER-CR matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.743 

gccggtcaagctcgtccgcgatcgggtcggccttg	CRISPR spacer
gccggttcagctcgtccgcgatcggcttgagcagc	Protospacer
******. ***************** *.*. *

39. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
cacacactggaagtccggcgccgcgtccttgcga	Protospacer
  *  .** ** *******************  .

40. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 10, identity: 0.706 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
aaccggctcgacgtcctgcaccgcgtgtgtgtga	Protospacer
. ************** **.****** . **  .

41. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
cgtcggctcgccgcccggcgccgcgtcggtcggg	Protospacer
  .******* **.*************  * . *

42. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 10, identity: 0.73 

gccccgacgccatggtcgccgccgtccgcatggtcat	CRISPR spacer
agcccgacgccacggtcgcggccgtccgggccttcct	Protospacer
. **********.****** ******** ..  ** *

43. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.73 

gccccgacgccatggtcgccgccgtccgcatggtcat	CRISPR spacer
aggccgacgccatcgtcgcggccgtccgctcgcagat	Protospacer
.  ********** ***** ********* .*   **

44. spacer 15.7|4709490|37|CP032052|CRISPRCasFinder matches to KT001914 (Caulobacter phage Seuss, complete genome) position: , mismatch: 10, identity: 0.73 

gccccgacgccatggtcgccgccgtccgca--tggtcat	CRISPR spacer
tcgccgacgccctggccgccgccgtccgcgcccagcc--	Protospacer
 * ******** ***.*************.  ..*.*

45. spacer 9.1|2808481|34|CP032052|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 11, identity: 0.676 

gtccggctcgacgtccggcgccgcgtccttgacg	CRISPR spacer
cagcggctcgaggtccggggccgcgtcgccgcac	Protospacer
   ******** ****** ******** ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6789629 : 6802399 11 Synechococcus_phage(33.33%) plate,tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage