Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 0 crisprs WYL,csa3 0 0 0 0
CP022794 Ralstonia solanacearum strain SL2330 chromosome, complete genome 2 crisprs cas3,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,DinG 0 76 6 0

Results visualization

1. CP022794
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022794_1 1136361-1136633 TypeI-E I-E
4 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022794_2 1146014-1149638 TypeI-E I-E
59 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 35662-35693 0 1.0
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 47107-47138 0 1.0
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 MT740737 Ralstonia phage Firinga, complete genome 3093-3124 0 1.0
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 MT740741 Ralstonia phage Hennie, complete genome 18402-18433 0 1.0
CP022794_2 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146165-1146196 32 AB863625 Ralstonia phage RSK1 DNA, complete genome 16858-16889 0 1.0
CP022794_2 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146165-1146196 32 MT740737 Ralstonia phage Firinga, complete genome 22394-22425 0 1.0
CP022794_2 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146165-1146196 32 MT740741 Ralstonia phage Hennie, complete genome 38165-38196 0 1.0
CP022794_2 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT 1148541-1148572 32 AB981169 Ralstonia phage RSY1 DNA, complete genome 11678-11709 0 1.0
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 45570-45601 0 1.0
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 37199-37230 0 1.0
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 45570-45601 0 1.0
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 37199-37230 0 1.0
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 MT740734 Ralstonia phage Dina, complete genome 30769-30800 0 1.0
CP022794_2 2.90|1148540|33|CP022794|PILER-CR 1148540-1148572 33 AB981169 Ralstonia phage RSY1 DNA, complete genome 11678-11710 0 1.0
CP022794_2 2.96|1148906|33|CP022794|PILER-CR 1148906-1148938 33 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 45570-45602 0 1.0
CP022794_2 2.96|1148906|33|CP022794|PILER-CR 1148906-1148938 33 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 37198-37230 0 1.0
CP022794_2 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT 1146775-1146806 32 AB863625 Ralstonia phage RSK1 DNA, complete genome 35651-35682 1 0.969
CP022794_2 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT 1146775-1146806 32 MT740737 Ralstonia phage Firinga, complete genome 830-861 1 0.969
CP022794_2 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT 1146775-1146806 32 MT740741 Ralstonia phage Hennie, complete genome 20665-20696 1 0.969
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 MT740734 Ralstonia phage Dina, complete genome 15547-15578 1 0.969
CP022794_2 2.61|1146774|33|CP022794|PILER-CR 1146774-1146806 33 MT740741 Ralstonia phage Hennie, complete genome 20664-20696 1 0.97
CP022794_2 2.61|1146774|33|CP022794|PILER-CR 1146774-1146806 33 AB863625 Ralstonia phage RSK1 DNA, complete genome 35651-35683 1 0.97
CP022794_2 2.61|1146774|33|CP022794|PILER-CR 1146774-1146806 33 MT740737 Ralstonia phage Firinga, complete genome 830-862 1 0.97
CP022794_2 2.78|1147812|33|CP022794|PILER-CR 1147812-1147844 33 MT740734 Ralstonia phage Dina, complete genome 15547-15579 1 0.97
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 AB863625 Ralstonia phage RSK1 DNA, complete genome 3457-3488 2 0.938
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 MT740737 Ralstonia phage Firinga, complete genome 8993-9024 2 0.938
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 MT740741 Ralstonia phage Hennie, complete genome 12145-12176 2 0.938
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 AB276040 Ralstonia phage RSA1 DNA, complete genome 13784-13815 2 0.938
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NC_009382 Ralstonia phage phiRSA1, complete genome 13784-13815 2 0.938
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 MT740741 Ralstonia phage Hennie, complete genome 12145-12177 2 0.939
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 AB863625 Ralstonia phage RSK1 DNA, complete genome 3456-3488 2 0.939
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 MT740737 Ralstonia phage Firinga, complete genome 8992-9024 2 0.939
CP022794_2 2.79|1147873|33|CP022794|PILER-CR 1147873-1147905 33 AB276040 Ralstonia phage RSA1 DNA, complete genome 13784-13816 2 0.939
CP022794_2 2.79|1147873|33|CP022794|PILER-CR 1147873-1147905 33 NC_009382 Ralstonia phage phiRSA1, complete genome 13784-13816 2 0.939
CP022794_2 2.12|1146714|32|CP022794|CRISPRCasFinder,CRT 1146714-1146745 32 MT740737 Ralstonia phage Firinga, complete genome 3740-3771 3 0.906
CP022794_2 2.12|1146714|32|CP022794|CRISPRCasFinder,CRT 1146714-1146745 32 MT740741 Ralstonia phage Hennie, complete genome 17755-17786 3 0.906
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 933279-933310 4 0.875
CP022794_2 2.29|1147752|32|CP022794|CRISPRCasFinder,CRT 1147752-1147783 32 NC_047861 Bordetella phage vB_BbrM_PHB04, complete genome 14220-14251 4 0.875
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 AB981169 Ralstonia phage RSY1 DNA, complete genome 19248-19279 4 0.875
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 158247-158278 4 0.875
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 701501-701531 4 0.871
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 181875-181902 4 0.857
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 181875-181902 4 0.857
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 180316-180343 4 0.857
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 184563-184590 4 0.857
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 178681-178708 4 0.857
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 181875-181902 4 0.857
CP022794_2 2.41|1148480|32|CP022794|CRISPRCasFinder,CRT 1148480-1148511 32 MN693733 Marine virus AFVG_250M308, complete genome 6718-6749 4 0.875
CP022794_2 2.74|1147568|33|CP022794|PILER-CR 1147568-1147600 33 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 933279-933311 4 0.879
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 158246-158278 4 0.879
CP022794_2 2.89|1148479|33|CP022794|PILER-CR 1148479-1148511 33 MN693733 Marine virus AFVG_250M308, complete genome 6718-6750 4 0.879
CP022794_2 2.24|1147446|33|CP022794|CRISPRCasFinder,CRT 1147446-1147478 33 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 37691-37723 5 0.848
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 251464-251495 5 0.844
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 248965-248996 5 0.844
CP022794_2 2.77|1147751|33|CP022794|PILER-CR 1147751-1147783 33 NC_047861 Bordetella phage vB_BbrM_PHB04, complete genome 14220-14252 5 0.848
CP022794_2 2.79|1147873|33|CP022794|PILER-CR 1147873-1147905 33 AB981169 Ralstonia phage RSY1 DNA, complete genome 19248-19280 5 0.848
CP022794_2 2.87|1148362|32|CP022794|PILER-CR 1148362-1148393 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 701501-701532 5 0.844
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 239687-239718 6 0.812
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 MT740732 Ralstonia phage Darius, complete genome 49837-49868 6 0.812
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 MT740740 Ralstonia phage Gervaise, complete genome 60486-60517 6 0.812
CP022794_2 2.8|1146470|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146470-1146501 32 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 539734-539765 6 0.812
CP022794_2 2.16|1146958|32|CP022794|CRISPRCasFinder,CRT 1146958-1146989 32 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 139385-139416 6 0.812
CP022794_2 2.18|1147080|32|CP022794|CRISPRCasFinder,CRT 1147080-1147111 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 197524-197555 6 0.812
CP022794_2 2.18|1147080|32|CP022794|CRISPRCasFinder,CRT 1147080-1147111 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 516515-516546 6 0.812
CP022794_2 2.29|1147752|32|CP022794|CRISPRCasFinder,CRT 1147752-1147783 32 KF806588 Erwinia phage Ea9-2, complete genome 37079-37110 6 0.812
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP038638 Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence 17345-17376 6 0.812
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 19579-19610 6 0.812
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP021918 Sagittula sp. P11 plasmid unnamed6, complete sequence 28571-28602 6 0.812
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 574474-574505 6 0.812
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 168007-168038 6 0.812
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 213113-213143 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 130653-130683 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 137330-137360 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_CP014142 Thermus parvatiensis strain RL plasmid pTP143, complete sequence 49532-49562 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 158561-158591 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 74415-74445 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NC_017588 Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence 92889-92919 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_AP019795 Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence 33572-33602 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_LR027520 Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence 348973-349003 6 0.806
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_AP019793 Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence 58759-58789 6 0.806
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP049041 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence 15286-15313 6 0.786
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 128291-128318 6 0.786
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 945316-945343 6 0.786
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 550272-550303 6 0.812
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT498043 Arthrobacter phage Jinkies, complete genome 11561-11592 6 0.812
CP022794_2 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT 1149578-1149609 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 130229-130260 6 0.812
CP022794_2 2.64|1146957|33|CP022794|PILER-CR 1146957-1146989 33 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 139384-139416 6 0.818
CP022794_2 2.66|1147079|33|CP022794|PILER-CR 1147079-1147111 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 197523-197555 6 0.818
CP022794_2 2.66|1147079|33|CP022794|PILER-CR 1147079-1147111 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 516514-516546 6 0.818
CP022794_2 2.72|1147445|34|CP022794|PILER-CR 1147445-1147478 34 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 37691-37724 6 0.824
CP022794_2 2.78|1147812|33|CP022794|PILER-CR 1147812-1147844 33 NZ_CP038638 Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence 17345-17377 6 0.818
CP022794_2 2.79|1147873|33|CP022794|PILER-CR 1147873-1147905 33 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 19578-19610 6 0.818
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP021918 Sagittula sp. P11 plasmid unnamed6, complete sequence 28571-28603 6 0.818
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP049041 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence 15285-15313 6 0.793
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 945315-945343 6 0.793
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 215472-215503 7 0.781
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP023451 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence 69115-69146 7 0.781
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 336856-336887 7 0.781
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP039699 Novosphingobium sp. ABRDHK2 plasmid pABRDHK234, complete sequence 26699-26730 7 0.781
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 724130-724161 7 0.781
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_CP053224 Sphingobium sp. RSMS plasmid pRSMS1, complete sequence 34899-34930 7 0.781
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_CP028920 Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence 44527-44558 7 0.781
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 18667-18698 7 0.781
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 160862-160893 7 0.781
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 NZ_CP018476 Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence 8027-8058 7 0.781
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 NZ_CP022265 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence 22612-22643 7 0.781
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 CP022268 Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence 53457-53488 7 0.781
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 NZ_CP017309 Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence 7129-7160 7 0.781
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 131596-131627 7 0.781
CP022794_2 2.27|1147630|32|CP022794|CRISPRCasFinder,CRT 1147630-1147661 32 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 105571-105602 7 0.781
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NZ_CP020613 Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence 81592-81623 7 0.781
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 266969-267000 7 0.781
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP048424 Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence 187672-187703 7 0.781
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_AF135182 Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence 127804-127835 7 0.781
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP010420 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence 67492-67523 7 0.781
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 12894-12925 7 0.781
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NC_002523 Serratia entomophila plasmid pADAP, complete sequence 127366-127397 7 0.781
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 135022-135053 7 0.781
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 345962-345993 7 0.781
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 79185-79215 7 0.774
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 58262-58292 7 0.774
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 27032-27059 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1894610-1894637 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1845770-1845797 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1987602-1987629 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1793206-1793233 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1845924-1845951 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 60351-60378 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 91914-91941 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 7437-7464 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1863417-1863444 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1792226-1792253 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1890972-1890999 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1890974-1891001 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1845413-1845440 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1793216-1793243 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1792600-1792627 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1793186-1793213 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 80791-80818 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1845357-1845384 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NC_009955 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence 69514-69541 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1894801-1894828 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1894798-1894825 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 80326-80353 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1894763-1894790 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 194246-194273 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 292387-292414 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 176576-176603 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 12507-12534 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 174858-174885 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 86754-86781 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 62652-62679 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 197315-197342 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 164429-164456 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 483533-483560 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 204892-204919 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 189324-189351 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 174595-174622 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 KT997858 Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome 1307-1334 7 0.75
CP022794_2 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT 1148423-1148450 28 KU998247 Gordonia phage Bachita, complete genome 89272-89299 7 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 230835-230866 7 0.781
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 266317-266348 7 0.781
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 16809-16840 7 0.781
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NZ_CP038639 Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence 252803-252834 7 0.781
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 21009-21040 7 0.781
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 49486-49517 7 0.781
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 234663-234694 7 0.781
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 234663-234694 7 0.781
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 AY576273 Bacteriophage Phi JL001, complete genome 37062-37093 7 0.781
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_006938 Phage phiJL001, complete genome 37062-37093 7 0.781
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN585963 Gordonia phage Wocket, complete genome 43041-43072 7 0.781
CP022794_2 2.56|1149395|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149395-1149426 32 NC_022368 Bacillaceae bacterium JMAK1 plasmid pGIAK1, complete sequence 23512-23543 7 0.781
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 MK929790 Caulobacter phage RW, complete genome 58672-58703 7 0.781
CP022794_2 2.65|1147018|33|CP022794|PILER-CR 1147018-1147050 33 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 131596-131628 7 0.788
CP022794_2 2.75|1147629|33|CP022794|PILER-CR 1147629-1147661 33 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 105570-105602 7 0.788
CP022794_2 2.77|1147751|33|CP022794|PILER-CR 1147751-1147783 33 KF806588 Erwinia phage Ea9-2, complete genome 37078-37110 7 0.788
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 27032-27060 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1894610-1894638 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1987602-1987630 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1793206-1793234 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 128291-128319 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 60351-60379 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 7437-7465 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1863417-1863445 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1792226-1792254 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1890972-1891000 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1890974-1891002 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1793216-1793244 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1792600-1792628 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1793186-1793214 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 80791-80819 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1894801-1894829 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1894798-1894826 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 80326-80354 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1894763-1894791 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 194246-194274 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 292386-292414 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 176575-176603 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 12506-12534 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 62651-62679 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 197314-197342 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 164428-164456 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 483532-483560 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 204891-204919 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 189323-189351 7 0.759
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 KU998247 Gordonia phage Bachita, complete genome 89271-89299 7 0.759
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 438478-438509 8 0.75
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 NZ_CP014690 Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence 218073-218104 8 0.75
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 NZ_CP035514 Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence 84050-84081 8 0.75
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5358786-5358817 8 0.75
CP022794_2 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146531-1146562 32 NZ_CP021368 Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence 130106-130137 8 0.75
CP022794_2 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146531-1146562 32 NZ_CP021364 Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence 149179-149210 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 78829-78860 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 144507-144538 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 917642-917673 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 973774-973805 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1516364-1516395 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1707272-1707303 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 532075-532106 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 179672-179703 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 513942-513973 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 34575-34606 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 266445-266476 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 63763-63794 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 67326-67357 8 0.75
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_LR699556 Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII 15074-15105 8 0.75
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 567449-567480 8 0.75
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 368155-368186 8 0.75
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 368154-368185 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 62754-62785 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 124644-124675 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 280946-280977 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 416408-416439 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 175695-175726 8 0.75
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 267467-267498 8 0.75
CP022794_2 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT 1147508-1147539 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 362267-362298 8 0.75
CP022794_2 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT 1147508-1147539 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 372605-372636 8 0.75
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 404169-404200 8 0.75
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 651517-651548 8 0.75
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2163926-2163957 8 0.75
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 119452-119483 8 0.75
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 496874-496905 8 0.75
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 457454-457485 8 0.75
CP022794_2 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT 1147874-1147905 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1445023-1445054 8 0.75
CP022794_2 2.33|1147997|32|CP022794|CRISPRCasFinder,CRT 1147997-1148028 32 NZ_LR594692 Variovorax sp. WDL1 plasmid 4 99109-99140 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 128395-128426 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 89008-89039 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP016593 Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence 35574-35605 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NC_017386 Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence 238756-238787 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NC_014621 Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence 205836-205867 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 35577-35608 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 92288-92319 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 103293-103324 8 0.75
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 842296-842327 8 0.75
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1445444-1445475 8 0.75
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 728245-728276 8 0.75
CP022794_2 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT 1148363-1148393 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 135453-135483 8 0.742
CP022794_2 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT 1148541-1148572 32 JN698995 Mycobacterium phage Dori, complete genome 18516-18547 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 50809-50840 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 MN694285 Marine virus AFVG_250M134, complete genome 32868-32899 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NZ_CP025410 Paracoccus sp. BM15 plasmid pBM152, complete sequence 5122-5153 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NZ_CP025410 Paracoccus sp. BM15 plasmid pBM152, complete sequence 62341-62372 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NZ_AP017657 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence 108437-108468 8 0.75
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 45787-45818 8 0.75
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NC_031122 Gordonia phage Eyre, complete genome 40581-40612 8 0.75
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 220788-220819 8 0.75
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 112178-112209 8 0.75
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 2041-2072 8 0.75
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 112178-112209 8 0.75
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 2041-2072 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN010757 Mycobacterium phage HUHilltop, complete genome 37365-37396 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK524508 Mycobacterium phage Zilizebeth, complete genome 40019-40050 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK820639 Mycobacterium phage Phineas, complete genome 37700-37731 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MF133446 Mycobacterium phage Bogie, complete genome 39108-39139 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK937604 Mycobacterium phage Necropolis, complete genome 36731-36762 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_041969 Mycobacterium phage Jebeks, complete genome 36662-36693 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_026605 Mycobacterium phage Malithi, complete genome 36575-36606 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KU985090 Mycobacterium phage Shipwreck, complete genome 39139-39170 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_031067 Mycobacterium phage Makemake, complete genome 40776-40807 8 0.75
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MH651190 Streptomyces phage Thestral, complete genome 18466-18497 8 0.75
CP022794_2 2.56|1149395|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149395-1149426 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 72795-72826 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 555093-555124 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NZ_CP014142 Thermus parvatiensis strain RL plasmid pTP143, complete sequence 9552-9583 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NZ_LR027520 Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence 134143-134174 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 348838-348869 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 469309-469340 8 0.75
CP022794_2 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149456-1149487 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 84949-84980 8 0.75
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 144507-144539 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 973774-973806 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 78828-78860 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 917641-917673 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1516363-1516395 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1707271-1707303 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 532075-532107 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 179671-179703 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 513941-513973 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 34574-34606 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 266444-266476 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 63762-63794 8 0.758
CP022794_2 2.62|1146835|33|CP022794|PILER-CR 1146835-1146867 33 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 67325-67357 8 0.758
CP022794_2 2.63|1146896|33|CP022794|PILER-CR 1146896-1146928 33 NZ_CP018476 Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence 8027-8059 8 0.758
CP022794_2 2.63|1146896|33|CP022794|PILER-CR 1146896-1146928 33 NZ_CP022265 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence 22611-22643 8 0.758
CP022794_2 2.63|1146896|33|CP022794|PILER-CR 1146896-1146928 33 CP022268 Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence 53456-53488 8 0.758
CP022794_2 2.63|1146896|33|CP022794|PILER-CR 1146896-1146928 33 NZ_CP017309 Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence 7129-7161 8 0.758
CP022794_2 2.74|1147568|33|CP022794|PILER-CR 1147568-1147600 33 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2163926-2163958 8 0.758
CP022794_2 2.81|1147996|33|CP022794|PILER-CR 1147996-1148028 33 MH536818 Gordonia phage Frokostdame, complete genome 9038-9070 8 0.758
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP048424 Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence 187671-187703 8 0.758
CP022794_2 2.86|1148301|33|CP022794|PILER-CR 1148301-1148333 33 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 135021-135053 8 0.758
CP022794_2 2.87|1148362|32|CP022794|PILER-CR 1148362-1148393 32 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 79185-79216 8 0.75
CP022794_2 2.87|1148362|32|CP022794|PILER-CR 1148362-1148393 32 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 58262-58293 8 0.75
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 91913-91941 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1845770-1845798 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1845924-1845952 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1845413-1845441 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1845357-1845385 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NC_009955 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence 69514-69542 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 174857-174885 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 86753-86781 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 174594-174622 8 0.724
CP022794_2 2.88|1148422|29|CP022794|PILER-CR 1148422-1148450 29 KT997858 Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome 1306-1334 8 0.724
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 230835-230867 8 0.758
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 266316-266348 8 0.758
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NC_049851 Burkholderia phage BcepSauron, complete genome 49656-49687 9 0.719
CP022794_1 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1136512-1136543 32 NC_049850 Burkholderia phage BcepSaruman, complete genome 48946-48977 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 170336-170367 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 926441-926472 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 455867-455898 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 608121-608152 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 110040-110071 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 459692-459723 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1452148-1452179 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 686771-686802 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 788725-788756 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 915134-915165 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1137721-1137752 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1324189-1324220 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 457128-457159 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1723673-1723704 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 2361-2392 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 468602-468633 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 351028-351059 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1291585-1291616 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 625999-626030 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 450190-450221 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 457146-457177 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 451975-452006 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1338118-1338149 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 450163-450194 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1234410-1234441 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 451975-452006 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1338118-1338149 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 450166-450197 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1234432-1234463 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 451975-452006 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1338118-1338149 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 451975-452006 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1338118-1338149 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 451975-452006 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1338118-1338149 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1640749-1640780 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 450166-450197 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1234432-1234463 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 2362-2393 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 468583-468614 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 2361-2392 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 468540-468571 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 460747-460778 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 460360-460391 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 450486-450517 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 847042-847073 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 450166-450197 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1234432-1234463 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 471930-471961 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 450166-450197 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1234432-1234463 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 450166-450197 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1234432-1234463 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 451977-452008 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1338121-1338152 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146043-1146074 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 471931-471962 9 0.719
CP022794_2 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146104-1146135 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 345958-345989 9 0.719
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3201609-3201640 9 0.719
CP022794_2 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146287-1146318 32 NZ_CP053023 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence 149719-149750 9 0.719
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_CP006373 Aureimonas sp. AU20 plasmid pAU20f, complete sequence 5405-5436 9 0.719
CP022794_2 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146531-1146562 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 22831-22862 9 0.719
CP022794_2 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT 1146592-1146623 32 NZ_AP018723 Thiomicrorhabdus aquaedulcis strain HaS4 plasmid pTmrp1, complete sequence 76291-76322 9 0.719
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 40459-40490 9 0.719
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_012854 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence 258667-258698 9 0.719
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 791909-791940 9 0.719
CP022794_2 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT 1146897-1146928 32 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 71554-71585 9 0.719
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 181540-181571 9 0.719
CP022794_2 2.20|1147202|32|CP022794|CRISPRCasFinder,CRT 1147202-1147233 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1910901-1910932 9 0.719
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP053575 Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence 15914-15945 9 0.719
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 251204-251235 9 0.719
CP022794_2 2.24|1147446|33|CP022794|CRISPRCasFinder,CRT 1147446-1147478 33 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 74743-74775 9 0.727
CP022794_2 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT 1147508-1147539 32 NZ_CP023066 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence 67468-67499 9 0.719
CP022794_2 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT 1147508-1147539 32 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 303730-303761 9 0.719
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 247910-247941 9 0.719
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NC_007901 Rhodoferax ferrireducens T118 plasmid unnamed1, complete sequence 104106-104137 9 0.719
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2351360-2351391 9 0.719
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1275944-1275975 9 0.719
CP022794_2 2.33|1147997|32|CP022794|CRISPRCasFinder,CRT 1147997-1148028 32 MH536818 Gordonia phage Frokostdame, complete genome 9039-9070 9 0.719
CP022794_2 2.35|1148119|32|CP022794|CRISPRCasFinder,CRT 1148119-1148150 32 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 73466-73497 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 932841-932872 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 350723-350754 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_KR997898 Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence 4438-4469 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1711856-1711887 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1738517-1738548 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 933330-933361 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 125026-125057 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1767326-1767357 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1798820-1798851 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5699656-5699687 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1943037-1943068 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1419644-1419675 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 714806-714837 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1698072-1698103 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 313154-313185 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 696767-696798 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 596331-596362 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1776822-1776853 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 698224-698255 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 54830-54861 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1484446-1484477 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1719102-1719133 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1737988-1738019 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 873550-873581 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 103791-103822 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1713922-1713953 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1782754-1782785 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1656851-1656882 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1713387-1713418 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1788302-1788333 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1782721-1782752 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1692175-1692206 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1767743-1767774 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1781456-1781487 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1798822-1798853 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1678650-1678681 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1692487-1692518 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1767743-1767774 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1781555-1781586 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1692175-1692206 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1679297-1679328 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1691378-1691409 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1767743-1767774 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1767743-1767774 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1767743-1767774 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1781551-1781582 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 188022-188053 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 264466-264497 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1781540-1781571 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1678673-1678704 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1692388-1692419 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1673034-1673065 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1734078-1734109 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1766059-1766090 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1765058-1765089 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1781540-1781571 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1678673-1678704 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1692486-1692517 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1782545-1782576 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1678673-1678704 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1678673-1678704 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1781551-1781582 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1767748-1767779 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 232326-232357 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1781562-1781593 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1781363-1781394 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 232326-232357 9 0.719
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 MF140403 Mycobacterium phage Changeling, complete genome 14371-14402 9 0.719
CP022794_2 2.37|1148241|32|CP022794|CRISPRCasFinder,CRT 1148241-1148272 32 MN694546 Marine virus AFVG_250M837, complete genome 14594-14625 9 0.719
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1234290-1234321 9 0.719
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 543210-543241 9 0.719
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 52821-52852 9 0.719
CP022794_2 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT 1148541-1148572 32 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 291984-292015 9 0.719
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 161390-161421 9 0.719
CP022794_2 2.44|1148663|32|CP022794|CRISPRCasFinder,CRT 1148663-1148694 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1481089-1481120 9 0.719
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 37380-37411 9 0.719
CP022794_2 2.47|1148846|32|CP022794|CRISPRCasFinder,CRT 1148846-1148877 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 536505-536536 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1991516-1991547 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 680331-680362 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1964667-1964698 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 2065053-2065084 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 461807-461838 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 566147-566178 9 0.719
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 2065080-2065111 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1991516-1991547 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 680331-680362 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1964667-1964698 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 2065053-2065084 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 461807-461838 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 566147-566178 9 0.719
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 2065080-2065111 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK967397 Mycobacterium phage Mahavrat, complete genome 42378-42409 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK016499 Mycobacterium phage Mangethe, complete genome 40007-40038 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK919480 Mycobacterium phage Techage, complete genome 38540-38571 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT024866 Mycobacterium phage Willsammy, complete genome 37586-37617 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN892486 Mycobacterium phage KilKor, complete genome 38103-38134 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN234172 Mycobacterium phage ThulaThula, complete genome 41735-41766 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK494122 Mycobacterium phage GreaseLightnin, complete genome 39460-39491 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KX641262 Mycobacterium phage Nazo, complete genome 39393-39424 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT897904 Mycobacterium phage Royals2015, complete genome 43827-43858 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MG920060 Mycobacterium phage Bob3, complete genome 39091-39122 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 EU816588 Mycobacterium phage Porky, complete genome 58283-58314 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_048729 Mycobacterium phage Renaud18, complete genome 45613-45644 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN096356 Mycobacterium phage Bunnies, complete genome 39229-39260 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT771343 Gordonia phage Clown, complete genome 7056-7087 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MK820638 Mycobacterium phage HermioneGrange, complete genome 40328-40359 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KX522649 Mycobacterium phage Bircsak, complete genome 41171-41202 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT310893 Mycobacterium phage DRBy19, complete genome 46327-46358 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MF919492 Mycobacterium phage Arib1, complete genome 38504-38535 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KX522943 Mycobacterium phage Gompeii16, complete genome 41172-41203 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MN807249 Mycobacterium phage Megiddo, complete genome 38097-38128 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 JF412297 EBPR siphovirus 2, partial sequence 26089-26120 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MT639654 Mycobacterium phage Jerm2, complete genome 40583-40614 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KC691256 Mycobacterium phage Fishburne, complete genome 38446-38477 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 JN382248 Mycobacterium phage Lilac, complete genome 59961-59992 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MF472894 Mycobacterium phage Majeke, complete genome 40007-40038 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MH450113 Mycobacterium phage BigMau, complete genome 39834-39865 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NC_023692 Mycobacterium phage BigNuz, complete genome 39193-39224 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MF281061 Mycobacterium phage Ksquared, complete genome 39229-39260 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 KC691255 Mycobacterium phage Dumbo, complete genome 58846-58877 9 0.719
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 MH450130 Mycobacterium phage Rohr, complete genome 40629-40660 9 0.719
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 150853-150884 9 0.719
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 182148-182179 9 0.719
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 273769-273800 9 0.719
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NZ_CP022751 Sphingobium hydrophobicum strain C1 plasmid p5, complete sequence 59811-59842 9 0.719
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1476519-1476550 9 0.719
CP022794_2 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT 1149578-1149609 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 309927-309958 9 0.719
CP022794_2 2.65|1147018|33|CP022794|PILER-CR 1147018-1147050 33 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 567449-567481 9 0.727
CP022794_2 2.71|1147384|33|CP022794|PILER-CR 1147384-1147416 33 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 62753-62785 9 0.727
CP022794_2 2.74|1147568|33|CP022794|PILER-CR 1147568-1147600 33 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 404168-404200 9 0.727
CP022794_2 2.74|1147568|33|CP022794|PILER-CR 1147568-1147600 33 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 651516-651548 9 0.727
CP022794_2 2.78|1147812|33|CP022794|PILER-CR 1147812-1147844 33 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 119451-119483 9 0.727
CP022794_2 2.78|1147812|33|CP022794|PILER-CR 1147812-1147844 33 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1275944-1275976 9 0.727
CP022794_2 2.78|1147812|33|CP022794|PILER-CR 1147812-1147844 33 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2351359-2351391 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP022767 Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence 128394-128426 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP022483 Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence 89008-89040 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP016593 Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence 35574-35606 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NC_017386 Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence 238756-238788 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NC_014621 Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence 205836-205868 9 0.727
CP022794_2 2.84|1148179|33|CP022794|PILER-CR 1148179-1148211 33 NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 35577-35609 9 0.727
CP022794_2 2.86|1148301|33|CP022794|PILER-CR 1148301-1148333 33 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 728245-728277 9 0.727
CP022794_2 2.86|1148301|33|CP022794|PILER-CR 1148301-1148333 33 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1445443-1445475 9 0.727
CP022794_2 2.87|1148362|32|CP022794|PILER-CR 1148362-1148393 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 135453-135484 9 0.719
CP022794_2 2.90|1148540|33|CP022794|PILER-CR 1148540-1148572 33 JN698995 Mycobacterium phage Dori, complete genome 18516-18548 9 0.727
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 50809-50841 9 0.727
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 MN694285 Marine virus AFVG_250M134, complete genome 32867-32899 9 0.727
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 NZ_CP025410 Paracoccus sp. BM15 plasmid pBM152, complete sequence 5122-5154 9 0.727
CP022794_2 2.91|1148601|33|CP022794|PILER-CR 1148601-1148633 33 NZ_CP025410 Paracoccus sp. BM15 plasmid pBM152, complete sequence 62341-62373 9 0.727
CP022794_2 2.92|1148662|33|CP022794|PILER-CR 1148662-1148694 33 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 128044-128076 9 0.727
CP022794_2 2.93|1148723|33|CP022794|PILER-CR 1148723-1148755 33 NC_031122 Gordonia phage Eyre, complete genome 40580-40612 9 0.727
CP022794_2 2.96|1148906|33|CP022794|PILER-CR 1148906-1148938 33 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 112177-112209 9 0.727
CP022794_1 1.4|1136573|32|CP022794|CRISPRCasFinder,CRT 1136573-1136604 32 MK496050 Pseudomonas sp. strain FFUP_PS_41 plasmid pJBCL41, complete sequence 450879-450910 10 0.688
CP022794_1 1.4|1136573|32|CP022794|CRISPRCasFinder,CRT 1136573-1136604 32 MN961670 Pseudomonas putida strain 420352 plasmid p420352-IMP, complete sequence 44274-44305 10 0.688
CP022794_2 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146165-1146196 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 442928-442959 10 0.688
CP022794_2 2.4|1146226|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146226-1146257 32 MN694345 Marine virus AFVG_250M178, complete genome 8719-8750 10 0.688
CP022794_2 2.4|1146226|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146226-1146257 32 MN694528 Marine virus AFVG_250M165, complete genome 9646-9677 10 0.688
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 7176-7207 10 0.688
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 367597-367628 10 0.688
CP022794_2 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT 1146409-1146440 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 679623-679654 10 0.688
CP022794_2 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT 1146592-1146623 32 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1220775-1220806 10 0.688
CP022794_2 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT 1146592-1146623 32 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 1573890-1573921 10 0.688
CP022794_2 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT 1146592-1146623 32 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 1757282-1757313 10 0.688
CP022794_2 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT 1146592-1146623 32 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 2627-2658 10 0.688
CP022794_2 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT 1146775-1146806 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 301423-301454 10 0.688
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_022125 Rhodococcus erythropolis CCM2595 plasmid pRECF1, complete sequence 16653-16684 10 0.688
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP015205 Rhodococcus sp. 008 plasmid pR8C2, complete sequence 59653-59684 10 0.688
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP025960 Rhodococcus qingshengii strain djl-6-2 plasmid pDJL1, complete sequence 37596-37627 10 0.688
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NZ_CP011297 Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence 100711-100742 10 0.688
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 454462-454493 10 0.688
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 303097-303128 10 0.688
CP022794_2 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT 1147385-1147416 32 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 63023-63054 10 0.688
CP022794_2 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT 1147508-1147539 32 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 6569-6600 10 0.688
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 203301-203332 10 0.688
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 210996-211027 10 0.688
CP022794_2 2.28|1147691|32|CP022794|CRISPRCasFinder,CRT 1147691-1147722 32 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 466875-466906 10 0.688
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 674282-674313 10 0.688
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 143233-143264 10 0.688
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP022419 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence 176748-176779 10 0.688
CP022794_2 2.34|1148058|32|CP022794|CRISPRCasFinder,CRT 1148058-1148089 32 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 87991-88022 10 0.688
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55950-55981 10 0.688
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_LN832560 Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence 166985-167016 10 0.688
CP022794_2 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT 1148180-1148211 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 695887-695918 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 297824-297855 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP035419 Leisingera sp. NJS204 plasmid unnamed2, complete sequence 148306-148337 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP038239 Leisingera sp. NJS201 plasmid unnamed5, complete sequence 56540-56571 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2551360-2551391 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1075944-1075975 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 MH834620 Arthrobacter phage Melons, complete genome 28065-28096 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 MH834606 Arthrobacter phage Coral, complete genome 27440-27471 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 MH834616 Arthrobacter phage Kepler, complete genome 28335-28366 10 0.688
CP022794_2 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT 1148302-1148333 32 MH834609 Arthrobacter phage Daob, complete genome 27925-27956 10 0.688
CP022794_2 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT 1148602-1148633 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1925655-1925686 10 0.688
CP022794_2 2.44|1148663|32|CP022794|CRISPRCasFinder,CRT 1148663-1148694 32 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 128044-128075 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1607382-1607413 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279887 Mycobacterium phage Timmi, complete genome 21874-21905 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH651175 Mycobacterium phage Gophee, complete genome 22146-22177 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 GQ303264 Mycobacterium phage Puhltonio, complete genome 22167-22198 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG925339 Mycobacterium phage Chunky, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 GU247134 Mycobacterium phage Scoot17C, complete genome 22157-22188 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX683293 Mycobacterium phage Daffy, complete genome 21883-21914 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279888 Mycobacterium phage TomBombadil, complete genome 22159-22190 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF957056 Mycobacterium phage Thora, complete genome 22165-22196 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT316463 Mycobacterium phage Slatt, complete genome 22171-22202 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX576645 Mycobacterium phage Derpp, complete genome 21722-21753 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH651184 Mycobacterium phage Phareon, complete genome 21867-21898 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN006063 Mycobacterium phage Serendipity, complete genome 22182-22213 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH230875 Mycobacterium phage CheetO, complete genome 22157-22188 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG962365 Mycobacterium phage DoesntMatter, complete genome 22142-22173 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919511 Mycobacterium phage Kailash, complete genome 22214-22245 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279882 Mycobacterium phage Sophia, complete genome 21873-21904 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX670813 Mycobacterium phage MitKao, complete genome 21865-21896 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH576970 Mycobacterium phage DonSanchon, complete genome 21856-21887 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279866 Mycobacterium phage MRabcd, complete genome 21858-21889 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH513973 Mycobacterium phage Kwksand96, complete genome 21726-21757 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK524512 Mycobacterium phage Carthage, complete genome 21070-21101 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN945899 Mycobacterium phage Skippy, complete genome 22146-22177 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279908 Mycobacterium phage Roliet, complete genome 22154-22185 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_023727 Mycobacterium phage Vista, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT897909 Mycobacterium phage Maru, complete genome 21866-21897 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KM347890 Mycobacterium phage Vivaldi, complete genome 22189-22220 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH727555 Mycobacterium phage Mulan, complete genome 21883-21914 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT776813 Mycobacterium phage Magic8, complete genome 22199-22230 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG757164 Mycobacterium phage PhenghisKhan, complete genome 21767-21798 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY006474 Mycobacterium phage Prann, complete genome 21824-21855 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_027985 Mycobacterium phage UncleHowie, complete genome 21862-21893 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN698990 Mycobacterium phage IsaacEli, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY965066 Mycobacterium phage BlackStallion, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN703415 Mycobacterium phage Mcshane, complete genome 21856-21887 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX592589 Mycobacterium phage Iridoclysis, complete genome 22142-22173 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH051251 Mycobacterium phage DuchessDung, complete genome 21013-21044 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX576646 Mycobacterium phage TyrionL, complete genome 21722-21753 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279871 Mycobacterium phage Plmatters, complete genome 22160-22191 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279883 Mycobacterium phage Struggle, complete genome 21714-21745 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG757165 Mycobacterium phage Phergie, complete genome 21758-21789 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH371107 Mycobacterium phage Doddsville, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028942 Mycobacterium phage Phipps, complete sequence 22133-22164 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ567044 Mycobacterium phage EmpTee, complete genome 22156-22187 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279881 Mycobacterium phage Solosis, complete genome 21873-21904 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG944223 Mycobacterium phage Trypo, complete genome 22158-22189 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT897902 Mycobacterium phage Boehler, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279855 Mycobacterium phage Haleema, complete genome 21879-21910 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JX649096 Mycobacterium phage Serpentine, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK494104 Mycobacterium phage HenryJackson, complete genome 21879-21910 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG944225 Mycobacterium phage Xavier, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JX649099 Mycobacterium phage Gyarad, complete genome 22160-22191 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH450116 Mycobacterium phage Buckeye, complete genome 22180-22211 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN638753 Mycobacterium phage Morgushi, complete genome 21866-21897 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG757158 Mycobacterium phage HighStump, complete genome 21862-21893 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112539 Mycobacterium phage Dione, complete genome 21862-21893 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279873 Mycobacterium phage QueenBeane, complete genome 22158-22189 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF668276 Mycobacterium phage Lulumae, complete genome 21858-21889 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT897903 Mycobacterium phage DirtJuice, complete genome 22146-22177 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH513980 Mycobacterium phage Roy17, complete genome 21858-21889 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279879 Mycobacterium phage SassyCat97, complete genome 21864-21895 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN586058 Mycobacterium phage Vaishali24, complete genome 21824-21855 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT316460 Mycobacterium phage Kimbrough, complete genome 21868-21899 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF937097 Mycobacterium phage Hertubise, complete genome 22170-22201 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH230874 Mycobacterium phage Banjo, complete genome 21851-21882 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH651186 Mycobacterium phage Podrick, complete genome 22152-22183 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG962362 Mycobacterium phage AltPhacts, complete genome 22140-22171 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF704103 Mycobacterium phage Vortex, complete sequence 21869-21900 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 FJ174694 Mycobacterium phage Chah, complete genome 22175-22206 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH051264 Mycobacterium phage Cobra, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112536 Mycobacterium phage Cannibal, complete genome 22141-22172 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX578071 Mycobacterium phage Mana, complete genome 21873-21904 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919539 Mycobacterium phage Virapocalypse, complete genome 22149-22180 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KC661274 Mycobacterium phage SDcharge11, complete genome 22132-22163 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ194579 Mycobacterium phage Swish, complete genome 22149-22180 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH371114 Mycobacterium phage Childish, complete genome 21883-21914 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279910 Mycobacterium phage Antonia, complete genome 21714-21745 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279852 Mycobacterium phage Fringe, complete genome 22144-22175 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX576643 Mycobacterium phage FriarPreacher, complete genome 22180-22211 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 21712-21743 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN699010 Mycobacterium phage TallGrassMM, complete genome 21788-21819 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG757159 Mycobacterium phage JangoPhett, complete genome 22149-22180 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279891 Mycobacterium phage Wallhey, complete genome 21726-21757 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919503 Mycobacterium phage Dingo, complete genome 22140-22171 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY676783 Mycobacterium phage Chorkpop, complete genome 21879-21910 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112527 Mycobacterium phage Altwerkus, complete genome 21840-21871 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JX649100 Mycobacterium phage Alex, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028691 Mycobacterium phage Apizium, complete genome 21905-21936 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF937109 Mycobacterium phage Yoshand, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279878 Mycobacterium phage Samaymay, complete genome 22158-22189 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 22151-22182 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112551 Mycobacterium phage Riggan, complete genome 22144-22175 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN945903 Mycobacterium phage Jiminy, complete genome 21716-21747 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KM363597 Mycobacteriophage Zonia, complete genome 22176-22207 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KR816508 Mycobacterium phage Phamished, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF937095 Mycobacterium phage Harvey, complete genome 22174-22205 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KF713485 Mycobacterium phage Suffolk, complete genome 22160-22191 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG770212 Mycobacterium phage Haimas, complete genome 22156-22187 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279861 Mycobacterium phage Legolas, complete genome 21874-21905 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279843 Mycobacterium phage CamL, complete genome 22158-22189 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279890 Mycobacterium phage Veritas, complete genome 21725-21756 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279846 Mycobacterium phage Cosmolli16, complete genome 21877-21908 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KM408320 Mycobacterium phage Lasso, complete genome 22133-22164 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KR029086 Mycobacterium phage PDRPv, complete genome 21740-21771 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY385380 Mycobacterium phage Ashraf, complete genome 21712-21743 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH825705 Mycobacterium phage Mesh1, complete genome 22171-22202 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279864 Mycobacterium phage Mag7, complete genome 21764-21795 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT952849 Mycobacterium phage Windsor, complete genome 21853-21884 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH576954 Mycobacterium phage HSavage, complete genome 22165-22196 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112555 Mycobacterium phage Zelda, complete genome 22153-22184 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028803 Mycobacterium phage OSmaximus, complete genome 22192-22223 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279904 Mycobacterium phage RedMaple, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KR029087 Mycobacterium phage PDRPxv, complete genome 21801-21832 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_005259 Mycobacterium phage PG1, complete genome 22168-22199 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH155874 Mycobacterium phage PhrankReynolds, complete genome 21764-21795 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112552 Mycobacterium phage Spartan300, complete genome 22152-22183 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX702319 Mycobacterium phage Pinkman, complete genome 21720-21751 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919523 Mycobacterium phage Mikota, complete genome 22144-22175 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KU867907 Mycobacterium phage Potter, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH590588 Mycobacterium phage Vaticameos, complete genome 21853-21884 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279885 Mycobacterium phage Surely, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279870 Mycobacterium phage Omniscient, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN638752 Mycobacterium phage Murdoc, complete genome 22158-22189 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KT599441 Mycobacterium phage Squid, complete genome 21864-21895 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG925346 Mycobacterium phage LeeLot, complete genome 22164-22195 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG962375 Mycobacterium phage ProfessorX, complete genome 22147-22178 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH077582 Mycobacterium phage Olive, complete genome 22147-22178 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF155947 Mycobacterium phage LemonSlice, complete genome 21861-21892 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KP027209 Mycobacterium phage Sigman, complete genome 22148-22179 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH450122 Mycobacterium phage KingTut, complete genome 17537-17568 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279859 Mycobacterium phage Kwadwo, complete genome 21858-21889 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112546 Mycobacterium phage LuckyMarjie, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX620786 Mycobacterium phage Lego3393, complete genome 22169-22200 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112544 Mycobacterium phage Keitherie, complete genome 22207-22238 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KP027197 Mycobacterium phage FluffyNinja, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH651177 Mycobacterium phage KlimbOn, complete genome 22154-22185 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279877 Mycobacterium phage Roscoe, complete genome 22392-22423 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH576958 Mycobacterium phage MichaelPhcott, complete genome 21761-21792 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN698989 Mycobacterium phage JacAttac, complete genome 22148-22179 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH479918 Mycobacterium phage Labeouficaum, complete genome 21722-21753 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112553 Mycobacterium Phage Squiggle, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028907 Mycobacterium phage Kikipoo, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279850 Mycobacterium phage Durga, complete genome 22175-22206 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK524526 Mycobacterium phage Robyn, complete genome 21729-21760 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279897 Mycobacterium phage Bishoperium, complete genome 21860-21891 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN585965 Mycobacterium phage Duggie, complete genome 21878-21909 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH316568 Mycobacterium phage Phleuron, complete genome 21764-21795 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT310868 Mycobacterium phage Telesworld, complete genome 21860-21891 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279865 Mycobacterium phage Mecca, complete genome 21859-21890 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KC576784 Mycobacterium phage ShiVal, complete genome 22156-22187 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ595576 Mycobacterium phage Manad, complete genome 21712-21743 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH479916 Mycobacterium phage GeneCoco, complete genome 22170-22201 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN444868 Mycobacterium phage Prickles, complete genome 22152-22183 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KY385383 Mycobacterium phage Maskar, complete genome 21712-21743 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH371117 Mycobacterium phage Kahve, complete genome 21876-21907 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH399773 Mycobacterium phage Craff, complete genome 22161-22192 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 GU247133 Mycobacterium phage Fang, complete genome 22169-22200 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX683292 Mycobacterium phage Held, complete genome 21863-21894 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_008197 Mycobacterium phage Orion, complete genome 22155-22186 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH479921 Mycobacterium phage Placalicious, complete genome 21855-21886 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT897901 Mycobacterium phage Adriana, complete genome 22151-22182 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN369744 Mycobacterium phage Beaglebox, complete genome 21871-21902 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KT364588 Mycobacterium phage Hetaeria, complete genome 22172-22203 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919530 Mycobacterium phage Sheila, complete genome 22152-22183 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG925356 Mycobacterium phage OliverWalter, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JX649098 Mycobacterium phage Nacho, complete genome 22157-22188 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH926060 Mycobacterium phage Schadenfreude, complete genome 21712-21743 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT889369 Mycobacterium phage Inchworm, complete genome 22148-22179 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KP027208 Mycobacterium phage Pipsqueak, complete genome 22162-22193 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919519 Mycobacterium phage Longacauda, complete genome 21866-21897 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF704109 Mycobacterium phage Oosterbaan, complete sequence 22157-22188 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX369585 Mycobacterium phage PhatCats2014, complete genome 22172-22203 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK310139 Mycobacterium phage Emiris, complete genome 22146-22177 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH576967 Mycobacterium phage UAch1, complete genome 22172-22203 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ194580 Mycobacterium phage Badfish, complete genome 22175-22206 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KX576647 Mycobacterium phage CharlieGBrown, complete genome 21732-21763 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN369738 Mycobacterium phage Hocus, complete genome 21871-21902 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279889 Mycobacterium phage Valjean, complete genome 22155-22186 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH399775 Mycobacterium phage Gareth, complete genome 21860-21891 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 22157-22188 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279895 Mycobacterium phage Zaider, complete genome 22387-22418 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MN585967 Mycobacterium phage Kloppinator, complete genome 22177-22208 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 GQ303259 Mycobacterium phage Colbert, complete genome 22216-22247 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK279858 Mycobacterium phage JakeO, complete genome 21878-21909 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028681 Mycobacterium phage Pops, complete genome 22172-22203 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH744417 Mycobacterium phage Grand2040, complete genome 21879-21910 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JX649097 Mycobacterium phage Piglet, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG925350 Mycobacterium phage Mosaic, complete genome 21871-21902 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH479914 Mycobacterium phage FugateOSU, complete genome 21858-21889 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH825702 Mycobacterium phage Hamish, complete genome 22148-22179 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919528 Mycobacterium phage Phunky, complete genome 22164-22195 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_028690 Mycobacterium phage Eremos, complete genome 22155-22186 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MG962363 Mycobacterium phage BatteryCK, complete genome 21770-21801 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 22141-22172 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JN192463 Mycobacterium phage Oline, complete genome 21726-21757 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 NC_021310 Mycobacterium phage Newman, complete genome 22153-22184 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MK112542 Mycobacterium phage Jillium, complete genome 21872-21903 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MT310867 Mycobacterium phage Chaelin, complete genome 21855-21886 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ194583 Mycobacterium phage Numberten, complete genome 22163-22194 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH590594 Mycobacterium phage PinheadLarry, complete genome 21877-21908 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 KJ174157 Mycobacterium phage Soto, complete genome 22166-22197 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH399780 Mycobacterium phage Mutante, complete genome 21865-21896 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 JF704099 Mycobacterium phage KLucky39, complete sequence 22160-22191 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MH779516 Mycobacterium phage Waterdiva, complete genome 22155-22186 10 0.688
CP022794_2 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT 1148907-1148938 32 MF919507 Mycobacterium phage Horchata, complete genome 22150-22181 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1607382-1607413 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279887 Mycobacterium phage Timmi, complete genome 21874-21905 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH651175 Mycobacterium phage Gophee, complete genome 22146-22177 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 GQ303264 Mycobacterium phage Puhltonio, complete genome 22167-22198 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG925339 Mycobacterium phage Chunky, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 GU247134 Mycobacterium phage Scoot17C, complete genome 22157-22188 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX683293 Mycobacterium phage Daffy, complete genome 21883-21914 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279888 Mycobacterium phage TomBombadil, complete genome 22159-22190 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF957056 Mycobacterium phage Thora, complete genome 22165-22196 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT316463 Mycobacterium phage Slatt, complete genome 22171-22202 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX576645 Mycobacterium phage Derpp, complete genome 21722-21753 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH651184 Mycobacterium phage Phareon, complete genome 21867-21898 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN006063 Mycobacterium phage Serendipity, complete genome 22182-22213 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH230875 Mycobacterium phage CheetO, complete genome 22157-22188 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG962365 Mycobacterium phage DoesntMatter, complete genome 22142-22173 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919511 Mycobacterium phage Kailash, complete genome 22214-22245 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279882 Mycobacterium phage Sophia, complete genome 21873-21904 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX670813 Mycobacterium phage MitKao, complete genome 21865-21896 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH576970 Mycobacterium phage DonSanchon, complete genome 21856-21887 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279866 Mycobacterium phage MRabcd, complete genome 21858-21889 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH513973 Mycobacterium phage Kwksand96, complete genome 21726-21757 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK524512 Mycobacterium phage Carthage, complete genome 21070-21101 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN945899 Mycobacterium phage Skippy, complete genome 22146-22177 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279908 Mycobacterium phage Roliet, complete genome 22154-22185 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_023727 Mycobacterium phage Vista, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT897909 Mycobacterium phage Maru, complete genome 21866-21897 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KM347890 Mycobacterium phage Vivaldi, complete genome 22189-22220 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH727555 Mycobacterium phage Mulan, complete genome 21883-21914 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT776813 Mycobacterium phage Magic8, complete genome 22199-22230 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG757164 Mycobacterium phage PhenghisKhan, complete genome 21767-21798 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY006474 Mycobacterium phage Prann, complete genome 21824-21855 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_027985 Mycobacterium phage UncleHowie, complete genome 21862-21893 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN698990 Mycobacterium phage IsaacEli, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY965066 Mycobacterium phage BlackStallion, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN703415 Mycobacterium phage Mcshane, complete genome 21856-21887 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX592589 Mycobacterium phage Iridoclysis, complete genome 22142-22173 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH051251 Mycobacterium phage DuchessDung, complete genome 21013-21044 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX576646 Mycobacterium phage TyrionL, complete genome 21722-21753 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279871 Mycobacterium phage Plmatters, complete genome 22160-22191 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279883 Mycobacterium phage Struggle, complete genome 21714-21745 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG757165 Mycobacterium phage Phergie, complete genome 21758-21789 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH371107 Mycobacterium phage Doddsville, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028942 Mycobacterium phage Phipps, complete sequence 22133-22164 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ567044 Mycobacterium phage EmpTee, complete genome 22156-22187 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279881 Mycobacterium phage Solosis, complete genome 21873-21904 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG944223 Mycobacterium phage Trypo, complete genome 22158-22189 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT897902 Mycobacterium phage Boehler, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279855 Mycobacterium phage Haleema, complete genome 21879-21910 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JX649096 Mycobacterium phage Serpentine, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK494104 Mycobacterium phage HenryJackson, complete genome 21879-21910 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG944225 Mycobacterium phage Xavier, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JX649099 Mycobacterium phage Gyarad, complete genome 22160-22191 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH450116 Mycobacterium phage Buckeye, complete genome 22180-22211 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN638753 Mycobacterium phage Morgushi, complete genome 21866-21897 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG757158 Mycobacterium phage HighStump, complete genome 21862-21893 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112539 Mycobacterium phage Dione, complete genome 21862-21893 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279873 Mycobacterium phage QueenBeane, complete genome 22158-22189 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF668276 Mycobacterium phage Lulumae, complete genome 21858-21889 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT897903 Mycobacterium phage DirtJuice, complete genome 22146-22177 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH513980 Mycobacterium phage Roy17, complete genome 21858-21889 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279879 Mycobacterium phage SassyCat97, complete genome 21864-21895 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN586058 Mycobacterium phage Vaishali24, complete genome 21824-21855 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT316460 Mycobacterium phage Kimbrough, complete genome 21868-21899 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF937097 Mycobacterium phage Hertubise, complete genome 22170-22201 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH230874 Mycobacterium phage Banjo, complete genome 21851-21882 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH651186 Mycobacterium phage Podrick, complete genome 22152-22183 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG962362 Mycobacterium phage AltPhacts, complete genome 22140-22171 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF704103 Mycobacterium phage Vortex, complete sequence 21869-21900 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 FJ174694 Mycobacterium phage Chah, complete genome 22175-22206 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH051264 Mycobacterium phage Cobra, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112536 Mycobacterium phage Cannibal, complete genome 22141-22172 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX578071 Mycobacterium phage Mana, complete genome 21873-21904 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919539 Mycobacterium phage Virapocalypse, complete genome 22149-22180 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KC661274 Mycobacterium phage SDcharge11, complete genome 22132-22163 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ194579 Mycobacterium phage Swish, complete genome 22149-22180 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH371114 Mycobacterium phage Childish, complete genome 21883-21914 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279910 Mycobacterium phage Antonia, complete genome 21714-21745 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279852 Mycobacterium phage Fringe, complete genome 22144-22175 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX576643 Mycobacterium phage FriarPreacher, complete genome 22180-22211 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 21712-21743 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN699010 Mycobacterium phage TallGrassMM, complete genome 21788-21819 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG757159 Mycobacterium phage JangoPhett, complete genome 22149-22180 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279891 Mycobacterium phage Wallhey, complete genome 21726-21757 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919503 Mycobacterium phage Dingo, complete genome 22140-22171 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY676783 Mycobacterium phage Chorkpop, complete genome 21879-21910 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112527 Mycobacterium phage Altwerkus, complete genome 21840-21871 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JX649100 Mycobacterium phage Alex, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028691 Mycobacterium phage Apizium, complete genome 21905-21936 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF937109 Mycobacterium phage Yoshand, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279878 Mycobacterium phage Samaymay, complete genome 22158-22189 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 22151-22182 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112551 Mycobacterium phage Riggan, complete genome 22144-22175 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN945903 Mycobacterium phage Jiminy, complete genome 21716-21747 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KM363597 Mycobacteriophage Zonia, complete genome 22176-22207 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KR816508 Mycobacterium phage Phamished, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF937095 Mycobacterium phage Harvey, complete genome 22174-22205 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KF713485 Mycobacterium phage Suffolk, complete genome 22160-22191 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG770212 Mycobacterium phage Haimas, complete genome 22156-22187 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279861 Mycobacterium phage Legolas, complete genome 21874-21905 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279843 Mycobacterium phage CamL, complete genome 22158-22189 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279890 Mycobacterium phage Veritas, complete genome 21725-21756 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279846 Mycobacterium phage Cosmolli16, complete genome 21877-21908 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KM408320 Mycobacterium phage Lasso, complete genome 22133-22164 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KR029086 Mycobacterium phage PDRPv, complete genome 21740-21771 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY385380 Mycobacterium phage Ashraf, complete genome 21712-21743 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH825705 Mycobacterium phage Mesh1, complete genome 22171-22202 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279864 Mycobacterium phage Mag7, complete genome 21764-21795 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT952849 Mycobacterium phage Windsor, complete genome 21853-21884 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH576954 Mycobacterium phage HSavage, complete genome 22165-22196 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112555 Mycobacterium phage Zelda, complete genome 22153-22184 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028803 Mycobacterium phage OSmaximus, complete genome 22192-22223 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279904 Mycobacterium phage RedMaple, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KR029087 Mycobacterium phage PDRPxv, complete genome 21801-21832 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_005259 Mycobacterium phage PG1, complete genome 22168-22199 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH155874 Mycobacterium phage PhrankReynolds, complete genome 21764-21795 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112552 Mycobacterium phage Spartan300, complete genome 22152-22183 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX702319 Mycobacterium phage Pinkman, complete genome 21720-21751 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919523 Mycobacterium phage Mikota, complete genome 22144-22175 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KU867907 Mycobacterium phage Potter, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH590588 Mycobacterium phage Vaticameos, complete genome 21853-21884 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279885 Mycobacterium phage Surely, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279870 Mycobacterium phage Omniscient, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN638752 Mycobacterium phage Murdoc, complete genome 22158-22189 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KT599441 Mycobacterium phage Squid, complete genome 21864-21895 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG925346 Mycobacterium phage LeeLot, complete genome 22164-22195 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG962375 Mycobacterium phage ProfessorX, complete genome 22147-22178 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH077582 Mycobacterium phage Olive, complete genome 22147-22178 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF155947 Mycobacterium phage LemonSlice, complete genome 21861-21892 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KP027209 Mycobacterium phage Sigman, complete genome 22148-22179 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH450122 Mycobacterium phage KingTut, complete genome 17537-17568 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279859 Mycobacterium phage Kwadwo, complete genome 21858-21889 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112546 Mycobacterium phage LuckyMarjie, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX620786 Mycobacterium phage Lego3393, complete genome 22169-22200 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112544 Mycobacterium phage Keitherie, complete genome 22207-22238 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KP027197 Mycobacterium phage FluffyNinja, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH651177 Mycobacterium phage KlimbOn, complete genome 22154-22185 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279877 Mycobacterium phage Roscoe, complete genome 22392-22423 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH576958 Mycobacterium phage MichaelPhcott, complete genome 21761-21792 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN698989 Mycobacterium phage JacAttac, complete genome 22148-22179 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH479918 Mycobacterium phage Labeouficaum, complete genome 21722-21753 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112553 Mycobacterium Phage Squiggle, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028907 Mycobacterium phage Kikipoo, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279850 Mycobacterium phage Durga, complete genome 22175-22206 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK524526 Mycobacterium phage Robyn, complete genome 21729-21760 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279897 Mycobacterium phage Bishoperium, complete genome 21860-21891 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN585965 Mycobacterium phage Duggie, complete genome 21878-21909 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH316568 Mycobacterium phage Phleuron, complete genome 21764-21795 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT310868 Mycobacterium phage Telesworld, complete genome 21860-21891 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279865 Mycobacterium phage Mecca, complete genome 21859-21890 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KC576784 Mycobacterium phage ShiVal, complete genome 22156-22187 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ595576 Mycobacterium phage Manad, complete genome 21712-21743 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH479916 Mycobacterium phage GeneCoco, complete genome 22170-22201 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN444868 Mycobacterium phage Prickles, complete genome 22152-22183 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KY385383 Mycobacterium phage Maskar, complete genome 21712-21743 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH371117 Mycobacterium phage Kahve, complete genome 21876-21907 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH399773 Mycobacterium phage Craff, complete genome 22161-22192 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 GU247133 Mycobacterium phage Fang, complete genome 22169-22200 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX683292 Mycobacterium phage Held, complete genome 21863-21894 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_008197 Mycobacterium phage Orion, complete genome 22155-22186 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH479921 Mycobacterium phage Placalicious, complete genome 21855-21886 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT897901 Mycobacterium phage Adriana, complete genome 22151-22182 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN369744 Mycobacterium phage Beaglebox, complete genome 21871-21902 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KT364588 Mycobacterium phage Hetaeria, complete genome 22172-22203 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919530 Mycobacterium phage Sheila, complete genome 22152-22183 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG925356 Mycobacterium phage OliverWalter, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JX649098 Mycobacterium phage Nacho, complete genome 22157-22188 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH926060 Mycobacterium phage Schadenfreude, complete genome 21712-21743 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT889369 Mycobacterium phage Inchworm, complete genome 22148-22179 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KP027208 Mycobacterium phage Pipsqueak, complete genome 22162-22193 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919519 Mycobacterium phage Longacauda, complete genome 21866-21897 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF704109 Mycobacterium phage Oosterbaan, complete sequence 22157-22188 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX369585 Mycobacterium phage PhatCats2014, complete genome 22172-22203 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK310139 Mycobacterium phage Emiris, complete genome 22146-22177 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH576967 Mycobacterium phage UAch1, complete genome 22172-22203 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ194580 Mycobacterium phage Badfish, complete genome 22175-22206 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KX576647 Mycobacterium phage CharlieGBrown, complete genome 21732-21763 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN369738 Mycobacterium phage Hocus, complete genome 21871-21902 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279889 Mycobacterium phage Valjean, complete genome 22155-22186 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH399775 Mycobacterium phage Gareth, complete genome 21860-21891 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 22157-22188 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279895 Mycobacterium phage Zaider, complete genome 22387-22418 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MN585967 Mycobacterium phage Kloppinator, complete genome 22177-22208 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 GQ303259 Mycobacterium phage Colbert, complete genome 22216-22247 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK279858 Mycobacterium phage JakeO, complete genome 21878-21909 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028681 Mycobacterium phage Pops, complete genome 22172-22203 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH744417 Mycobacterium phage Grand2040, complete genome 21879-21910 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JX649097 Mycobacterium phage Piglet, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG925350 Mycobacterium phage Mosaic, complete genome 21871-21902 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH479914 Mycobacterium phage FugateOSU, complete genome 21858-21889 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH825702 Mycobacterium phage Hamish, complete genome 22148-22179 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919528 Mycobacterium phage Phunky, complete genome 22164-22195 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_028690 Mycobacterium phage Eremos, complete genome 22155-22186 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MG962363 Mycobacterium phage BatteryCK, complete genome 21770-21801 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 22141-22172 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JN192463 Mycobacterium phage Oline, complete genome 21726-21757 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 NC_021310 Mycobacterium phage Newman, complete genome 22153-22184 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MK112542 Mycobacterium phage Jillium, complete genome 21872-21903 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MT310867 Mycobacterium phage Chaelin, complete genome 21855-21886 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ194583 Mycobacterium phage Numberten, complete genome 22163-22194 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH590594 Mycobacterium phage PinheadLarry, complete genome 21877-21908 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 KJ174157 Mycobacterium phage Soto, complete genome 22166-22197 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH399780 Mycobacterium phage Mutante, complete genome 21865-21896 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 JF704099 Mycobacterium phage KLucky39, complete sequence 22160-22191 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MH779516 Mycobacterium phage Waterdiva, complete genome 22155-22186 10 0.688
CP022794_2 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT 1149090-1149121 32 MF919507 Mycobacterium phage Horchata, complete genome 22150-22181 10 0.688
CP022794_2 2.52|1149151|32|CP022794|CRISPRCasFinder,CRT 1149151-1149182 32 NC_013283 Cronobacter turicensis z3032 plasmid pCTU1, complete sequence 106346-106377 10 0.688
CP022794_2 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149334-1149365 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 392750-392781 10 0.688
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 46740-46771 10 0.688
CP022794_2 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149517-1149548 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 46741-46772 10 0.688
CP022794_2 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT 1149578-1149609 32 MN062720 Microbacterium phage FuzzBuster, complete genome 40020-40051 10 0.688
CP022794_2 2.72|1147445|34|CP022794|PILER-CR 1147445-1147478 34 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 74742-74775 10 0.706
CP022794_2 2.73|1147507|33|CP022794|PILER-CR 1147507-1147539 33 NZ_CP023066 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence 67467-67499 10 0.697
CP022794_2 2.86|1148301|33|CP022794|PILER-CR 1148301-1148333 33 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1234289-1234321 10 0.697
CP022794_2 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT 1146836-1146867 32 NC_048139 Streptomyces phage Hiyaa, complete genome 56492-56523 11 0.656
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP010618 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence 392-423 11 0.656
CP022794_2 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT 1147019-1147050 32 NZ_CP010746 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence 392-423 11 0.656
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP033099 Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence 10102-10133 11 0.656
CP022794_2 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT 1147569-1147600 32 NZ_CP033099 Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence 20035-20066 11 0.656
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 241797-241828 11 0.656
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 3187-3218 11 0.656
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 213431-213462 11 0.656
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NZ_CP048285 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence 148435-148466 11 0.656
CP022794_2 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT 1147813-1147844 32 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 50084-50115 11 0.656
CP022794_2 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT 1148724-1148755 32 NZ_CP048421 Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence 85589-85620 11 0.656
CP022794_2 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149273-1149304 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 804393-804424 11 0.656
CP022794_2 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149273-1149304 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 793133-793164 11 0.656
CP022794_2 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149273-1149304 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 779684-779715 11 0.656
CP022794_2 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR 1149273-1149304 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 804393-804424 11 0.656
CP022794_2 2.61|1146774|33|CP022794|PILER-CR 1146774-1146806 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 301422-301454 11 0.667
CP022794_2 2.65|1147018|33|CP022794|PILER-CR 1147018-1147050 33 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 454461-454493 11 0.667
CP022794_2 2.86|1148301|33|CP022794|PILER-CR 1148301-1148333 33 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 297823-297855 11 0.667

1. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0

ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
ttgaccagggtgttggccaagcgcttggccat	Protospacer
********************************

2. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
ttgaccagggtgttggccaagcgcttggccat	Protospacer
********************************

3. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cctgccctgcacacgatccaccacgatccgcg	Protospacer
********************************

4. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cctgccctgcacacgatccaccacgatccgcg	Protospacer
********************************

5. spacer 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

gcttgggcattgccgacaacctgcaaccggac	CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac	Protospacer
********************************

6. spacer 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0

gcttgggcattgccgacaacctgcaaccggac	CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac	Protospacer
********************************

7. spacer 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0

gcttgggcattgccgacaacctgcaaccggac	CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac	Protospacer
********************************

8. spacer 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

ttgatgcgggtcaggaaatcgctcgactcctg	CRISPR spacer
ttgatgcgggtcaggaaatcgctcgactcctg	Protospacer
********************************

9. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
********************************

10. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
********************************

11. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
********************************

12. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
********************************

13. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
gaaggcgataccctgctgctgaacctgccgga	Protospacer
********************************

14. spacer 2.90|1148540|33|CP022794|PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

gttgatgcgggtcaggaaatcgctcgactcctg	CRISPR spacer
gttgatgcgggtcaggaaatcgctcgactcctg	Protospacer
*********************************

15. spacer 2.96|1148906|33|CP022794|PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gtcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
*********************************

16. spacer 2.96|1148906|33|CP022794|PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gtcgcggcggtcggcgcagttgtcgtgattgtg	Protospacer
*********************************

17. spacer 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.969

gaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc	Protospacer
***.****************************

18. spacer 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.969

gaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc	Protospacer
***.****************************

19. spacer 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.969

gaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc	Protospacer
***.****************************

20. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.969

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
ttctgcggcacctcgaccatcggcagctcttc	Protospacer
**************************.*****

21. spacer 2.61|1146774|33|CP022794|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.97

ggaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
ggaactgggcgcactgagcaacggcctgcacgc	Protospacer
****.****************************

22. spacer 2.61|1146774|33|CP022794|PILER-CR matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.97

ggaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
ggaactgggcgcactgagcaacggcctgcacgc	Protospacer
****.****************************

23. spacer 2.61|1146774|33|CP022794|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.97

ggaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
ggaactgggcgcactgagcaacggcctgcacgc	Protospacer
****.****************************

24. spacer 2.78|1147812|33|CP022794|PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.97

gttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gttctgcggcacctcgaccatcggcagctcttc	Protospacer
***************************.*****

25. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 2, identity: 0.938

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
.****************.**************

26. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 2, identity: 0.938

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
.****************.**************

27. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 2, identity: 0.938

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
.****************.**************

28. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 2, identity: 0.938

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc	Protospacer
********.*****************.*****

29. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 2, identity: 0.938

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc	Protospacer
********.*****************.*****

30. spacer 2.62|1146835|33|CP022794|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 2, identity: 0.939

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
*.****************.**************

31. spacer 2.62|1146835|33|CP022794|PILER-CR matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 2, identity: 0.939

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
*.****************.**************

32. spacer 2.62|1146835|33|CP022794|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 2, identity: 0.939

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gctgatcgagatgctgcgcctcgtccaggaccc	Protospacer
*.****************.**************

33. spacer 2.79|1147873|33|CP022794|PILER-CR matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 2, identity: 0.939

ggtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
ggtggtgtttggcgccttcaccagcacattcgc	Protospacer
*********.*****************.*****

34. spacer 2.79|1147873|33|CP022794|PILER-CR matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 2, identity: 0.939

ggtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
ggtggtgtttggcgccttcaccagcacattcgc	Protospacer
*********.*****************.*****

35. spacer 2.12|1146714|32|CP022794|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 3, identity: 0.906

ctacggttgagttgggccagcgcgacgatcgg	CRISPR spacer
ccacggttgagctgggccagcgcgatgatcgg	Protospacer
*.*********.*************.******

36. spacer 2.12|1146714|32|CP022794|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 3, identity: 0.906

ctacggttgagttgggccagcgcgacgatcgg	CRISPR spacer
ccacggttgagctgggccagcgcgatgatcgg	Protospacer
*.*********.*************.******

37. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.875

attgaccagcaggaagaggtcatcaagcgcgc-	CRISPR spacer
attgccctgcaggaagaggtcat-aggcgcgca	Protospacer
**** ** *************** *.****** 

38. spacer 2.29|1147752|32|CP022794|CRISPRCasFinder,CRT matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 4, identity: 0.875

gggcccgtcatctgcatcgtgatcgatgtggc	CRISPR spacer
gggcccgtcatcttcatcgtgatcgattcgac	Protospacer
************* ************* .*.*

39. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 4, identity: 0.875

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
acggtgtccggcgccttcaccagcacattcgc	Protospacer
..*****.******************.*****

40. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 4, identity: 0.875

cggccatcgagaacgcgctggcga--tgctggca	CRISPR spacer
cggccatccagaacgcgcgggcgaactgctgg--	Protospacer
******** ********* *****  ******  

41. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.871

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gagatggtgaagaccttgccccccgtcgcct	Protospacer
*.********.************** **** 

42. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

43. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

44. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

45. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

46. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

47. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 4, identity: 0.857

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaggacagcacgtcgctcgccagcgcga	Protospacer
* ** *****.**************** 

48. spacer 2.41|1148480|32|CP022794|CRISPRCasFinder,CRT matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 4, identity: 0.875

tcctctgagtatctcgggctgctcaatcagac-	CRISPR spacer
tcctctgagtatctggggctactc-atcatacc	Protospacer
************** *****.*** **** ** 

49. spacer 2.74|1147568|33|CP022794|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.879

gattgaccagcaggaagaggtcatcaagcgcgc-	CRISPR spacer
gattgccctgcaggaagaggtcat-aggcgcgca	Protospacer
***** ** *************** *.****** 

50. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 4, identity: 0.879

gcggccatcgagaacgcgctggcga--tgctggca	CRISPR spacer
gcggccatccagaacgcgcgggcgaactgctgg--	Protospacer
********* ********* *****  ******  

51. spacer 2.89|1148479|33|CP022794|PILER-CR matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 4, identity: 0.879

gtcctctgagtatctcgggctgctcaatcagac-	CRISPR spacer
gtcctctgagtatctggggctactc-atcatacc	Protospacer
*************** *****.*** **** ** 

52. spacer 2.24|1147446|33|CP022794|CRISPRCasFinder,CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 5, identity: 0.848

gacgtgagcgagggcgaggacgtgacctacctg	CRISPR spacer
gacgtgagcgagggcgagggcgtgatctggttg	Protospacer
*******************.*****.**. .**

53. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 5, identity: 0.844

cacgg-gaccggcgcgctgaacatgacccgcca	CRISPR spacer
-gcggtggccggcgcgctgaacgtgaccggcca	Protospacer
 .*** *.**************.***** ****

54. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 5, identity: 0.844

cacgg-gaccggcgcgctgaacatgacccgcca	CRISPR spacer
-gcggtggccggcgcgctgaacgtgaccggcca	Protospacer
 .*** *.**************.***** ****

55. spacer 2.77|1147751|33|CP022794|PILER-CR matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 5, identity: 0.848

ggggcccgtcatctgcatcgtgatcgatgtggc	CRISPR spacer
cgggcccgtcatcttcatcgtgatcgattcgac	Protospacer
 ************* ************* .*.*

56. spacer 2.79|1147873|33|CP022794|PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 5, identity: 0.848

ggtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
aacggtgtccggcgccttcaccagcacattcgc	Protospacer
...*****.******************.*****

57. spacer 2.87|1148362|32|CP022794|PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.844

ggggatggtgaggaccttgccccccggcgcca	CRISPR spacer
cgagatggtgaagaccttgccccccgtcgcct	Protospacer
 *.********.************** **** 

58. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
aattcat--gggcgtcggccaagcgcttggccat	Protospacer
  ** *.  ***.**.******************

59. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 6, identity: 0.812

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
gtcgcccagcagcaggccgagccgggggcgga	Protospacer
.*.*  ** *******.***************

60. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 6, identity: 0.812

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
gtcgcccagcagcaggccgagccgggggcgga	Protospacer
.*.*  ** *******.***************

61. spacer 2.8|1146470|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcg-tcaaatccgagccggtgaaggccagc	CRISPR spacer
-cctcgcttaaatccgagcgggtgatggccagc	Protospacer
  * ** *.********** ***** *******

62. spacer 2.16|1146958|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.812

ttcggtagccttggctgcatcgatctcacgca	CRISPR spacer
ttcagtagccttggctgcatggataccaaaca	Protospacer
***.**************** *** .** .**

63. spacer 2.18|1147080|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

tacctgctcgacggttttttcgg--agccatcat	CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc--	Protospacer
******* ***** *********  ****  *  

64. spacer 2.18|1147080|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tacctgctcgacggttttttcgg--agccatcat	CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc--	Protospacer
******* ***** *********  ****  *  

65. spacer 2.29|1147752|32|CP022794|CRISPRCasFinder,CRT matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 6, identity: 0.812

gggcccg---tcatctgcatcgtgatcgatgtggc	CRISPR spacer
---cccggtttcaactgcatcgtcatcgatgtgga	Protospacer
   ****   *** ********* ********** 

66. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP038638 (Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
ttctgcggcaccgccaccatcggcacgtcatg	Protospacer
************ * **********  ** * 

67. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
gcgccgatcggcgccatcaccagcacggtcgc	Protospacer
*.* .* ******** *********** ****

68. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021918 (Sagittula sp. P11 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.812

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cggccatcgaggacgcgctggggatgaccgcc	Protospacer
***********.********* **** . ** 

69. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

cggccatcgagaacgcgctggcgatgctggca--	CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact	Protospacer
************ ***** ****..*  ****  

70. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

cggccatcgagaacgcgctggcgatgctggca--	CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact	Protospacer
************ ***** ****..*  ****  

71. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

72. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

73. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

74. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

75. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

76. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

77. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

78. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_AP019795 (Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

79. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

80. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_AP019793 (Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence) position: , mismatch: 6, identity: 0.806

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca	Protospacer
* ** *. ********** ***.********

81. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 6, identity: 0.786

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
tgggccagcatgtcgcgcgccggcgcat	Protospacer
  ************** ****.****..

82. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
tcgctcagcatgccgcccgccagcgcgc	Protospacer
 .* .*******.***.***********

83. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
tggatcagcatgtcgggcgccagcgcgc	Protospacer
  *..**********  ***********

84. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
gacacgaccggcgcgccgaacctgacccgcct	Protospacer
 **. ***********.**** ********* 

85. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT498043 (Arthrobacter phage Jinkies, complete genome) position: , mismatch: 6, identity: 0.812

cacgggaccggcgcgctgaacat-gacccgcca	CRISPR spacer
cacggcaccggagcgctgaacatcgacgcaac-	Protospacer
***** ***** *********** *** *. * 

86. spacer 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

-ccgcgcgaggtctgggcggccgagttccgcga	CRISPR spacer
gaagcgc-aggtctgggcggacgagttgcgcca	Protospacer
   **** ************ ****** *** *

87. spacer 2.64|1146957|33|CP022794|PILER-CR matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.818

gttcggtagccttggctgcatcgatctcacgca	CRISPR spacer
gttcagtagccttggctgcatggataccaaaca	Protospacer
****.**************** *** .** .**

88. spacer 2.66|1147079|33|CP022794|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.818

gtacctgctcgacggttttttcgg--agccatcat	CRISPR spacer
gtacctgcacgacgcttttttcggcaagcctgc--	Protospacer
******** ***** *********  ****  *  

89. spacer 2.66|1147079|33|CP022794|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

gtacctgctcgacggttttttcgg--agccatcat	CRISPR spacer
gtacctgcacgacgcttttttcggcaagcctgc--	Protospacer
******** ***** *********  ****  *  

90. spacer 2.72|1147445|34|CP022794|PILER-CR matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 6, identity: 0.824

agacgtgagcgagggcgaggacgtgacctacctg	CRISPR spacer
tgacgtgagcgagggcgagggcgtgatctggttg	Protospacer
 *******************.*****.**. .**

91. spacer 2.78|1147812|33|CP022794|PILER-CR matches to NZ_CP038638 (Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818

gttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gttctgcggcaccgccaccatcggcacgtcatg	Protospacer
************* * **********  ** * 

92. spacer 2.79|1147873|33|CP022794|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

ggtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
ggcgccgatcggcgccatcaccagcacggtcgc	Protospacer
**.* .* ******** *********** ****

93. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP021918 (Sagittula sp. P11 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.818

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
gcggccatcgaggacgcgctggggatgaccgcc	Protospacer
************.********* **** . ** 

94. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 6, identity: 0.793

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gtgggccagcatgtcgcgcgccggcgcat	Protospacer
*  ************** ****.****..

95. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.793

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gtggatcagcatgtcgggcgccagcgcgc	Protospacer
*  *..**********  ***********

96. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.781

-cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
tcggccg-agacggtcaccgcgtccgcgggctc	Protospacer
 ** .*. **** ******.************ 

97. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg	Protospacer
** ***************** ** .**  * *

98. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

-cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
gcgggca-agaccgtcaccgcgtacgcgggcat	Protospacer
 **  ** ***********.*** *******  

99. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039699 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK234, complete sequence) position: , mismatch: 7, identity: 0.781

cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg	Protospacer
** ***************** ** .**  * *

100. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.781

cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg	Protospacer
** ***************** ** .**  * *

101. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053224 (Sphingobium sp. RSMS plasmid pRSMS1, complete sequence) position: , mismatch: 7, identity: 0.781

cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg	Protospacer
** ***************** ** .**  * *

102. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccgttctgcccggtgctcacgatcggcgcggt	CRISPR spacer
tcgttctgcccggtgcccacgatgggcatgac	Protospacer
.***************.****** ***..*..

103. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgttctgcccggtgctcacgatcggcgcggt	CRISPR spacer
gcgttcggcccggtgctcacggtcggtctggg	Protospacer
 ***** **************.****. .** 

104. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgttctg--cccggtgctcacgatcggcgcggt	CRISPR spacer
--gatcaggtgccggtgctcgggatcggcgcggt	Protospacer
  * ** *   *********. ************

105. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 7, identity: 0.781

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt	Protospacer
******* ***********.****  .**.* 

106. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 7, identity: 0.781

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt	Protospacer
******* ***********.****  .**.* 

107. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 7, identity: 0.781

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt	Protospacer
******* ***********.****  .**.* 

108. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt	Protospacer
******* ***********.****  .**.* 

109. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 7, identity: 0.781

tagacgaggcccagcgcgccctg-tcggcgctg	CRISPR spacer
tagacgaggcccagcacgcgctgaacagcgag-	Protospacer
***************.*** ***  *.***   

110. spacer 2.27|1147630|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781

tagttcaggatgtcccactcggaccgctcatc	CRISPR spacer
ccgttcaggatcacccactcggaccgcacccc	Protospacer
. *********  ************** * .*

111. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP020613 (Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
gccgcgatgggcgccatcaccagcacggtcgc	Protospacer
*. *.* * ****** *********** ****

112. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781

gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
gcgccgatgggcgccatcaccagcacggtcgc	Protospacer
*.* .* * ****** *********** ****

113. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cctccatcgaaaacgcgctgtcgatgctcggc	Protospacer
*  *******.********* ******* *  

114. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AF135182 (Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781

cggccat-cgagaacgcgctggcgatgctggca	CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc	Protospacer
 ****..  *******.******* ******* 

115. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 7, identity: 0.781

cggccatcgagaacgcgctggcgatg---ctggca	CRISPR spacer
cggccatcgagaatgcgctcgcgcagggcctg---	Protospacer
*************.***** ***  *   ***   

116. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 7, identity: 0.781

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cggccatcgagaacgcgattgcggaattggcg	Protospacer
***************** * ***. ..****.

117. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NC_002523 (Serratia entomophila plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781

cggccat-cgagaacgcgctggcgatgctggca	CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc	Protospacer
 ****..  *******.******* ******* 

118. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gtgcagatcatcgaagacagcccgctcttcga	Protospacer
 .************.***.********. *.*

119. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

---tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
atctggcgg---atcgaggacggcctgcaccacaa	Protospacer
   * **.*   *************.** ******

120. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca	Protospacer
*  .**  ***** ****** **********

121. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 7, identity: 0.774

gggatggtgaggaccttgccccccggcgcca	CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca	Protospacer
*  .**  ***** ****** **********

122. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

123. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

124. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

125. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

126. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

127. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

128. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

129. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
cagcccagcatgtcgcgcgccagcgaca	Protospacer
  * ************ ********   

130. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

131. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

132. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

133. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

134. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

135. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

136. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

137. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

138. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

139. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

140. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

141. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ctcatgggcgtgtcgctcgccagcgcgc	Protospacer
 * .. .**.******************

142. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

143. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

144. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

145. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

146. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

147. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

148. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

149. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

150. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

151. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

152. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

153. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

154. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

155. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
acaaactgcatgccgctcgccagcgcgc	Protospacer
.... * *****.***************

156. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

157. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg	Protospacer
 .. ******* **** ********** 

158. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
accggcagcatgtcgcacgccagcgccg	Protospacer
.. * *********** *********  

159. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to KT997858 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
aacgccagcttgtcgctcgccagcacaa	Protospacer
.  ****** **************.*. 

160. spacer 2.40|1148423|28|CP022794|CRISPRCasFinder,CRT matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 7, identity: 0.75

gtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
aaggccaccatgtcgcgcgccagcgtct	Protospacer
. ***** ******** ********. .

161. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg	Protospacer
**********.********** ***   * * 

162. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg	Protospacer
**********.********** ***   * * 

163. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
ccgtcgaccgcccgccagctcgtcgccatcgg	Protospacer
***.* .. ***.****** ************

164. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcccg-tggcctgccagcacgtcgccatcgg	CRISPR spacer
-cgcaggctggcccgccagcacggcgccatcca	Protospacer
 ***  * *****.********* ******* .

165. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
ccgtcgaccgcccgccagctcgtcgccatcgg	Protospacer
***.* .. ***.****** ************

166. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 7, identity: 0.781

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
cccggcattgcccgccagcacgtcgccatggg	Protospacer
**   *.* ***.**************** **

167. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
acgagacggtcggcgcagttgtcgacatcgag	Protospacer
 ** *.******************  **.* *

168. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
acgagacggtcggcgcagttgtcgacatcgag	Protospacer
 ** *.******************  **.* *

169. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to AY576273 (Bacteriophage Phi JL001, complete genome) position: , mismatch: 7, identity: 0.781

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
agccggaccggcgcgcgggacatgacccggcc	Protospacer
 .* ************ *.********** * 

170. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_006938 (Phage phiJL001, complete genome) position: , mismatch: 7, identity: 0.781

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
agccggaccggcgcgcgggacatgacccggcc	Protospacer
 .* ************ *.********** * 

171. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN585963 (Gordonia phage Wocket, complete genome) position: , mismatch: 7, identity: 0.781

cacgggaccggcgcgctgaacat-gacccgcca	CRISPR spacer
cacggcaccggggcgctgaacatcgatgcatc-	Protospacer
***** ***** *********** **. *..* 

172. spacer 2.56|1149395|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_022368 (Bacillaceae bacterium JMAK1 plasmid pGIAK1, complete sequence) position: , mismatch: 7, identity: 0.781

gcaagaaggttaaaactggaattgtcattccg	CRISPR spacer
ggacgtactttaaaaccggaattgtcattacg	Protospacer
* * * *  *******.************ **

173. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 7, identity: 0.781

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
cgctgggaggaaggcacgagcatggacgccaa	Protospacer
 . . *********** *.*************

174. spacer 2.65|1147018|33|CP022794|PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 7, identity: 0.788

gtagacgaggcccagcgcgccctg-tcggcgctg	CRISPR spacer
gtagacgaggcccagcacgcgctgaacagcgag-	Protospacer
****************.*** ***  *.***   

175. spacer 2.75|1147629|33|CP022794|PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.788

gtagttcaggatgtcccactcggaccgctcatc	CRISPR spacer
gccgttcaggatcacccactcggaccgcacccc	Protospacer
*. *********  ************** * .*

176. spacer 2.77|1147751|33|CP022794|PILER-CR matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 7, identity: 0.788

ggggcccg---tcatctgcatcgtgatcgatgtggc	CRISPR spacer
---tcccggtttcaactgcatcgtcatcgatgtgga	Protospacer
    ****   *** ********* ********** 

177. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

178. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

179. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

180. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

181. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
atcgctcagcatgccgcccgccagcgcgc	Protospacer
. .* .*******.***.***********

182. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

183. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

184. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

185. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

186. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

187. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

188. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

189. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

190. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

191. spacer 2.88|1148422|29|CP022794|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

192. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

193. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

194. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

195. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaccggcagcatgtcgcacgccagcgccg	Protospacer
*.. * *********** *********  

196. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

197. spacer 2.88|1148422|29|CP022794|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

198. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

199. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

200. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

201. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

202. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

203. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gacaaactgcatgccgctcgccagcgcgc	Protospacer
*.... * *****.***************

204. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

205. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gccacccagcatctcgcgcgccagcgcgg	Protospacer
* .. ******* **** ********** 

206. spacer 2.88|1148422|29|CP022794|PILER-CR matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 7, identity: 0.759

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
gaaggccaccatgtcgcgcgccagcgtct	Protospacer
*. ***** ******** ********. .

207. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
ccgttcaggctgttggccaagcgctggggcgt	Protospacer
..* .**** *************** ** *.*

208. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 8, identity: 0.75

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
cttggccatcagcaggtcgagcggggaaagac	Protospacer
 **** **************** ***.. *. 

209. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 8, identity: 0.75

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
cgcgcggatcagcaggccgagccgggtgcggg	Protospacer
  .* * *********.********* ****.

210. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

ccgttctgcccggtgctcacgatcggcgcggt	CRISPR spacer
gcgatgccgccgatgctcatgatcggcgcggt	Protospacer
 ** * .  ***.******.************

211. spacer 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaagcccccatgccaccagcaacgccctc	CRISPR spacer
agcttcgagccaatgcgaccagcaacgccctc	Protospacer
 **.  *  ** **** ***************

212. spacer 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 8, identity: 0.75

cgccaagcccccatgccaccagcaacgccctc	CRISPR spacer
agcttcgagccaatgcgaccagcaacgccctc	Protospacer
 **.  *  ** **** ***************

213. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

214. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

215. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

216. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

217. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

218. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

219. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

220. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

221. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

222. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

223. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga	Protospacer
  *  ************** *********   

224. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc	Protospacer
 .   *****************.* ***** *

225. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc	Protospacer
 .   *****************.* ***** *

226. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 8, identity: 0.75

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ttcgcggaggcgctgcgtctcgtccaggagac	Protospacer
** .. ***..******************  *

227. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

---tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
gcctgagc---gcgcagcgcgcgctgtcggcgctg	Protospacer
   *...*   ** ******** ************

228. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75

tagacgaggcccagcgcgccctgt-cggcgctg	CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc-	Protospacer
 .****************. **** *  ***. 

229. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75

tagacgaggcccagcgcgccctgt-cggcgctg	CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc-	Protospacer
 .****************. **** *  ***. 

230. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
ttttgtcacttcgggcacggcggcaaactgcc	Protospacer
. .  ******** ************ *** *

231. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag	Protospacer
*** ************** ****..*   ** 

232. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag	Protospacer
*** ************** ****..*   ** 

233. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag	Protospacer
*** ************** ****..*   ** 

234. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag	Protospacer
*** ************** ****..*   ** 

235. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag	Protospacer
*** ************** ****..*   ** 

236. spacer 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75

aagagccaggccgctcctggcgcac-cgaactt	CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca-	Protospacer
. ******* ***** ********* .* **  

237. spacer 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75

aagagccaggccgctcctggcgcac-cgaactt	CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca-	Protospacer
. ******* ***** ********* .* **  

238. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc	Protospacer
  .*.*  ********** **.**********

239. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc	Protospacer
  .*.*  ********** **.**********

240. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
attgacccgcaggaagcggtcatgatggtatc	Protospacer
******* ******** ****** * *    *

241. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.75

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
ttctgcggcaccacgaccagcggcatccccat	Protospacer
************ ****** ***** ..*. .

242. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75

-gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg	Protospacer
 **..*. *************** **.****  

243. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75

-gtggtgttcggcgccttcaccagcacgttcgc	CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg	Protospacer
 **..*. *************** **.****  

244. spacer 2.31|1147874|32|CP022794|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75

gtggtgttcggcgccttcaccagcacgttcgc---	CRISPR spacer
atggtggtcggccccttcaccagc---cttgccca	Protospacer
.***** ***** ***********   .*.**   

245. spacer 2.33|1147997|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LR594692 (Variovorax sp. WDL1 plasmid 4) position: , mismatch: 8, identity: 0.75

ccattgtc--gggcaagcccgacgtgagccatcc	CRISPR spacer
--gctgccgagggcatgcacgacgtgagccatca	Protospacer
  ..**.*  ***** ** ************** 

246. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg	Protospacer
.*  .  **************** *******.

247. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg	Protospacer
.*  .  **************** *******.

248. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg	Protospacer
  *  *.****.************.******.

249. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg	Protospacer
  *  *.****.************.******.

250. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg	Protospacer
  *  *.****.************.******.

251. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg	Protospacer
  *  *.****.************.******.

252. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca-	CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt	Protospacer
****** ***** ********** ...**.*. 

253. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca-	CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt	Protospacer
****** ***** ********** ...**.*. 

254. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cggccatcgaggccgcgctggcgcgcgcggga	Protospacer
***********. **********    .** *

255. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt	Protospacer
**************** ******* . *  . 

256. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt	Protospacer
**************** ******* . *  . 

257. spacer 2.39|1148363|31|CP022794|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.742

gggatggtgaggaccttgccccc----cggcgcca	CRISPR spacer
gggttggtgacgaccttgcccccatagctgt----	Protospacer
*** ****** ************    * *.    

258. spacer 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.75

ttgatgcgggtcaggaaatcgctcgactcctg	CRISPR spacer
gccaggcgcggcaggaaatcgctcgactccga	Protospacer
 . * *** * ******************* .

259. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
accatcaccatggcatcctggtcgagtgaccg	Protospacer
 ************* * *********...*. 

260. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to MN694285 (Marine virus AFVG_250M134, complete genome) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
tctatcgccatggcctgctggtcgaaggcatc	Protospacer
**.***.******************. .  *.

261. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc	Protospacer
*   .*.********** ******* *****.

262. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc	Protospacer
*   .*.********** ******* *****.

263. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg	Protospacer
 **.. * ************ ****** *** 

264. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 8, identity: 0.75

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg	Protospacer
 **.. * ************ ****** *** 

265. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NC_031122 (Gordonia phage Eyre, complete genome) position: , mismatch: 8, identity: 0.75

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
gacctcatgccctgccagcacgtcgtcatcga	Protospacer
   *.*.** ***************.*****.

266. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
gcccgcctgggcggccagcacgtcgccatcct	Protospacer
 * * * *** * *****************  

267. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgccgcagtaccc	Protospacer
*********************.**...*  . 

268. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcggtcggcgcagttgtcgtg-attgtg	CRISPR spacer
gcgcggctgtcggcgctgttgtcgggcaccgc-	Protospacer
 ****** ******** ******* * *..*. 

269. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
tcgcggcggtcggcgcagttgccgcagtaccc	Protospacer
*********************.**...*  . 

270. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.75

tcgcggcggtcggcgcagttgtcgtg-attgtg	CRISPR spacer
gcgcggctgtcggcgctgttgtcgggcaccgc-	Protospacer
 ****** ******** ******* * *..*. 

271. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN010757 (Mycobacterium phage HUHilltop, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

272. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK524508 (Mycobacterium phage Zilizebeth, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

273. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK820639 (Mycobacterium phage Phineas, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

274. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MF133446 (Mycobacterium phage Bogie, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

275. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK937604 (Mycobacterium phage Necropolis, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

276. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_041969 (Mycobacterium phage Jebeks, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

277. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

278. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KU985090 (Mycobacterium phage Shipwreck, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg	Protospacer
***** ***************** . *  *..

279. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 8, identity: 0.75

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgccgcctg	Protospacer
***** *********** ***** .**  *..

280. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 8, identity: 0.75

cacg-ggaccggcgcgctgaacatgacccgcca	CRISPR spacer
-acgctgaccggcccgctgaacatcaccccggc	Protospacer
 ***  ******* ********** ****    

281. spacer 2.56|1149395|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaagaaggttaaaactggaattgtcattccg	CRISPR spacer
tccggaaggttaaaaccggaatggtcatcgcc	Protospacer
 * .************.***** *****. * 

282. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
gtgatcgacgaaggcgagggcatggacgccaa	Protospacer
. . . ** ******.****************

283. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
gaaggcgaggaaggcgagggcatggaagcccg	Protospacer
.**   *********.********** *** .

284. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
gaaggcgaggaaggcgagggcatggaagcccg	Protospacer
.**   *********.********** *** .

285. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
aagccggaggacggcaagggcatcaagggctg	Protospacer
**.******** *********** .* * * .

286. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
aagccggaggacggcaagggcatcaagggctg	Protospacer
**.******** *********** .* * * .

287. spacer 2.57|1149456|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

aaaccggaggaaggcaagggcatggacgccaa	CRISPR spacer
aagccggaggacggcaagggcatcaagggctg	Protospacer
**.******** *********** .* * * .

288. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

289. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

290. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

291. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

292. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

293. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

294. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

295. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

296. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

297. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

298. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gaagtacgagatgctgcgtcacgtccaggagga	Protospacer
*  *  ************** *********   

299. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ggcccgcgagatgctgcgtctcgccgaggacgc	Protospacer
* .   *****************.* ***** *

300. spacer 2.62|1146835|33|CP022794|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.758

gttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
ggcccgcgagatgctgcgtctcgccgaggacgc	Protospacer
* .   *****************.* ***** *

301. spacer 2.63|1146896|33|CP022794|PILER-CR matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 8, identity: 0.758

ggactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
agactacggggccgcgcagaagcgccatcgcgt	Protospacer
.******* ***********.****  .**.* 

302. spacer 2.63|1146896|33|CP022794|PILER-CR matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 8, identity: 0.758

ggactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
agactacggggccgcgcagaagcgccatcgcgt	Protospacer
.******* ***********.****  .**.* 

303. spacer 2.63|1146896|33|CP022794|PILER-CR matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 8, identity: 0.758

ggactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
agactacggggccgcgcagaagcgccatcgcgt	Protospacer
.******* ***********.****  .**.* 

304. spacer 2.63|1146896|33|CP022794|PILER-CR matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ggactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
agactacggggccgcgcagaagcgccatcgcgt	Protospacer
.******* ***********.****  .**.* 

305. spacer 2.74|1147568|33|CP022794|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

gattgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
gattgacccgcaggaagcggtcatgatggtatc	Protospacer
******** ******** ****** * *    *

306. spacer 2.81|1147996|33|CP022794|PILER-CR matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 8, identity: 0.758

--gccattgtcgggcaagcccgacgtgagccatcc	CRISPR spacer
cgacga--gtcgggcaagcccgacgtcacccagca	Protospacer
  .* *  ****************** * *** * 

307. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
acctccatcgaaaacgcgctgtcgatgctcggc	Protospacer
.*  *******.********* ******* *  

308. spacer 2.86|1148301|33|CP022794|PILER-CR matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

atcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
cgtgcagatcatcgaagacagcccgctcttcga	Protospacer
  .************.***.********. *.*

309. spacer 2.87|1148362|32|CP022794|PILER-CR matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

ggggatggtgaggaccttgccccccggcgcca	CRISPR spacer
cgccgtgcagaggagcttgccgcccggcgcca	Protospacer
 *  .**  ***** ****** **********

310. spacer 2.87|1148362|32|CP022794|PILER-CR matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 8, identity: 0.75

ggggatggtgaggaccttgccccccggcgcca	CRISPR spacer
cgccgtgcagaggagcttgccgcccggcgcca	Protospacer
 *  .**  ***** ****** **********

311. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
ccagcccagcatgtcgcgcgccagcgaca	Protospacer
   * ************ ********   

312. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

313. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

314. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

315. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

316. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
cctcatgggcgtgtcgctcgccagcgcgc	Protospacer
  * .. .**.******************

317. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

318. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

319. spacer 2.88|1148422|29|CP022794|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
caccggcagcatgtcgcacgccagcgccg	Protospacer
 .. * *********** *********  

320. spacer 2.88|1148422|29|CP022794|PILER-CR matches to KT997858 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome) position: , mismatch: 8, identity: 0.724

ggtggccagcatgtcgctcgccagcgcgc	CRISPR spacer
aaacgccagcttgtcgctcgccagcacaa	Protospacer
..  ****** **************.*. 

321. spacer 2.91|1148601|33|CP022794|PILER-CR matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.758

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
atccatcaccacggcctgctgggcgacacggtg	Protospacer
.**********.********** ***   * * 

322. spacer 2.91|1148601|33|CP022794|PILER-CR matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.758

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
atccatcaccacggcctgctgggcgacacggtg	Protospacer
.**********.********** ***   * * 

323. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 9, identity: 0.719

ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
ggaaacagggtgttggcccagagcttggtgac	Protospacer
  .* ************* ** ******. *.

324. spacer 1.3|1136512|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 9, identity: 0.719

ttgaccagggtgttggccaagcgcttggccat	CRISPR spacer
ggaaacagggtgttggcccagagcttggtgac	Protospacer
  .* ************* ** ******. *.

325. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

326. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

327. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

328. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

329. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

330. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

331. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

332. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

333. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

334. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

335. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

336. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

337. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

338. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

339. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

340. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

341. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

342. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

343. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

344. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

345. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

346. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

347. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

348. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

349. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

350. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

351. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

352. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

353. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

354. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

355. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

356. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

357. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

358. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

359. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

360. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

361. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

362. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

363. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

364. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

365. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

366. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

367. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

368. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

369. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

370. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

371. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

372. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

373. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

374. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

375. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

376. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

377. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

378. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

379. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

380. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

381. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

382. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

383. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

384. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

385. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

386. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

387. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

388. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

389. spacer 2.1|1146043|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cctgccctgcacacgatccaccacgatccgcg	CRISPR spacer
cgcgccttgcacacgatccagcacgaaatgat	Protospacer
* .***.************* *****  .*  

390. spacer 2.2|1146104|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719

cgttcatagaccgtcaccacgtccgcgggctg	CRISPR spacer
gcatcgaagaccgtcacctcgtcggcgggcgt	Protospacer
   **. *********** **** ******  

391. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
gcgcgcggtcagcaggtcgaccagggggcgga	Protospacer
..  *  .************ * *********

392. spacer 2.5|1146287|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 9, identity: 0.719

attgggcatcagcaggtcgagccgggggcgga	CRISPR spacer
atactgcatcagcatgtcgagccggaggaatc	Protospacer
**   ********* **********.** .  

393. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006373 (Aureimonas sp. AU20 plasmid pAU20f, complete sequence) position: , mismatch: 9, identity: 0.719

ccgttctgcccggtgctcacgatcggcgcggt	CRISPR spacer
agcatcggcccggtgcgcacgatcggcgcccc	Protospacer
    ** ********* ************  .

394. spacer 2.9|1146531|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.719

cgccaagcccccatgccaccagcaacgccctc	CRISPR spacer
gacccttcccgcctgccaccagcaacgcccgg	Protospacer
 .**   *** * *****************  

395. spacer 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP018723 (Thiomicrorhabdus aquaedulcis strain HaS4 plasmid pTmrp1, complete sequence) position: , mismatch: 9, identity: 0.719

tagccatgttcccactgctgggcatgctcgct	CRISPR spacer
gagccatcttcccaatgctgggcaatgttaat	Protospacer
 ****** ****** *********   *.. *

396. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 9, identity: 0.719

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga	Protospacer
 ***  ****************** .*  *  

397. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 9, identity: 0.719

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga	Protospacer
 ***  ****************** .*  *  

398. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
cgaaccgttgccgcgcagaggcggatccgaga	Protospacer
 .   **. ************** ***** **

399. spacer 2.15|1146897|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 9, identity: 0.719

gactacgcggccgcgcagaggcgcatccgtga	CRISPR spacer
cgcgatgcggccccgcagcggcgcatccggct	Protospacer
 .* *.****** ***** **********   

400. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 9, identity: 0.719

tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
tgacttcggcccagcgcgccttctcggcgcgg	Protospacer
*.. .  *************.* ******* *

401. spacer 2.20|1147202|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719

aaccgcagcgaggtgatccttgcgcacacgcc	CRISPR spacer
gagcgcatcgaggtgatcctcgcgcatgagaa	Protospacer
.* **** ************.*****.. *  

402. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
gtggatcagatcgcgcacggcggcaaccggct	Protospacer
   * ***  ****************** * .

403. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
gtgggctacctcgcgaacggcggcaacctggc	Protospacer
   * ..**.***** **************.*

404. spacer 2.24|1147446|33|CP022794|CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.727

gacgtgagcgagggcgaggacgtgacctacctg	CRISPR spacer
gacgtgagcaaggccgaggacgtgaaggcggcg	Protospacer
*********.*** ***********      .*

405. spacer 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023066 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence) position: , mismatch: 9, identity: 0.719

aagagccaggccgctcctggcgcaccgaactt	CRISPR spacer
aagagccaggccgctcacggcgcaaattgcca	Protospacer
**************** .******    .*. 

406. spacer 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719

aagagccaggccgctcctggcgcaccgaactt	CRISPR spacer
atgcaccaggccgctcctggcgccctgatgca	Protospacer
* * .****************** *.**  . 

407. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
ccgggtcggcaggaagagctgatcaagcgcgt	Protospacer
 . *..*.********** * **********.

408. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NC_007901 (Rhodoferax ferrireducens T118 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
ccggaccagcaggacgtggtcatcaaaaacgt	Protospacer
 . *********** * *********. .**.

409. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg	Protospacer
 . . ******* ******.*********.* 

410. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg	Protospacer
 . . ******* ******.*********.* 

411. spacer 2.33|1147997|32|CP022794|CRISPRCasFinder,CRT matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 9, identity: 0.719

ccattgtcgggcaagcccgacgtgagccatcc	CRISPR spacer
gacgagtcgggcaagcccgacgtcacccagca	Protospacer
     ****************** * *** * 

412. spacer 2.35|1148119|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ccaggcggtgcagctgacgggatcggtggtgc	CRISPR spacer
ctgggcggtgcaactgacgcgatcggccgaca	Protospacer
*..*********.****** ******. *   

413. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

414. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

415. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcg	Protospacer
 **    .***.************** ****.

416. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

417. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

418. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

419. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

420. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

421. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

422. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tggcgatcgacaacgcgctggcgacccagtgc	Protospacer
.*** ***** *************. * *   

423. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

424. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

425. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

426. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

427. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

428. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

429. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

430. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

431. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

432. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cggccatcgagatcgcgctcgcggagcccaac	Protospacer
************ ****** ***. **. .  

433. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

434. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

435. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

436. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
cgcggcgcgagaaggcgatggcgatgctggtg	Protospacer
**     ****** *** ************..

437. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
agcgccgcgagaaggcgatggcgatgctggtg	Protospacer
 *  *  ****** *** ************..

438. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

439. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

440. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

441. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

442. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

443. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

444. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

445. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

446. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

447. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

448. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

449. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

450. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

451. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

452. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

453. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

454. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

455. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

456. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

457. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

458. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

459. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcc	Protospacer
 **    .***.************** **** 

460. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

461. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

462. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

463. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

464. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

465. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

466. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

467. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

468. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

469. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

470. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

471. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

472. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

473. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

474. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

475. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

476. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

477. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

478. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

479. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac	Protospacer
* ..*  *************** * *****  

480. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to MF140403 (Mycobacterium phage Changeling, complete genome) position: , mismatch: 9, identity: 0.719

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
aggccatcgcgaacgcggtggcgaccttcgtc	Protospacer
 ******** ******* ******. .* *. 

481. spacer 2.37|1148241|32|CP022794|CRISPRCasFinder,CRT matches to MN694546 (Marine virus AFVG_250M837, complete genome) position: , mismatch: 9, identity: 0.719

cggctttatatgccggccggcagctgctacat	CRISPR spacer
ccgctttatttgccggacggcagctctaccgc	Protospacer
* ******* ****** ******** .  *..

482. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gttctgatcatcgaggacgatccgctccatcg	Protospacer
 . * **************..********. .

483. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
accgagatgatcgaggacggcctgctcgaact	Protospacer
 *  **** *************.**** *   

484. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gagcagatcatcgacgacggaccgccacgccg	Protospacer
  ************ ***** ****. *.* .

485. spacer 2.42|1148541|32|CP022794|CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.719

ttgatgcgggtcaggaaatcgctcgactcctg	CRISPR spacer
aatacgtggttcaggaaatcgctcgacgccgt	Protospacer
   *.*.** ***************** **  

486. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

tccatcaccatggcctgctggtcgagcagctt-------	CRISPR spacer
tccatctccagggcctgctggt-------cttcgcccac	Protospacer
****** *** ***********       ***       

487. spacer 2.44|1148663|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtgcagcgcgccaggcgcggtagatagcatc	CRISPR spacer
actgcatcgcgccaggcgctgtagagacgaga	Protospacer
  **** ************ ***** *  *  

488. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
gggcccgtggccggccagaacgtcgggcgcag	Protospacer
  ********** ***** ******    *.*

489. spacer 2.47|1148846|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

actcggagatcgaacgattcatcgaggcatcc	CRISPR spacer
acgaggagatcgaaggcttcatcgaggaggtg	Protospacer
**  ********** * ********** . . 

490. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

491. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

492. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

493. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

494. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

495. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

496. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

497. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

498. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

499. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

500. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

501. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

502. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

503. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc	Protospacer
 ***************** **.** *.. *  

504. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

505. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK016499 (Mycobacterium phage Mangethe, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

506. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK919480 (Mycobacterium phage Techage, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

507. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT024866 (Mycobacterium phage Willsammy, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

508. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN892486 (Mycobacterium phage KilKor, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

509. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN234172 (Mycobacterium phage ThulaThula, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggaaccggcgcgctcaacatcgacgcctg	Protospacer
*****.*********** ***** . *  *..

510. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK494122 (Mycobacterium phage GreaseLightnin, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

511. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KX641262 (Mycobacterium phage Nazo, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg	Protospacer
**.** ***************** . *  *..

512. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT897904 (Mycobacterium phage Royals2015, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg	Protospacer
***** *********** ***** . * * ..

513. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MG920060 (Mycobacterium phage Bob3, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

514. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

515. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg	Protospacer
***** *********** ***** . * * ..

516. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN096356 (Mycobacterium phage Bunnies, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

517. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT771343 (Gordonia phage Clown, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgtgctgaacatcgacgggtg	Protospacer
***** *******.********* . * * ..

518. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MK820638 (Mycobacterium phage HermioneGrange, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

519. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg	Protospacer
**.** ***************** . *  *..

520. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg	Protospacer
***** *********** ***** . * * ..

521. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MF919492 (Mycobacterium phage Arib1, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

522. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg	Protospacer
**.** ***************** . *  *..

523. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgactg	Protospacer
***** *********** ***** . * .*..

524. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to JF412297 (EBPR siphovirus 2, partial sequence) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacgggaccggcgcgatcaacatcgacgcctg	Protospacer
*************** * ***** . *  *..

525. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MT639654 (Mycobacterium phage Jerm2, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

526. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KC691256 (Mycobacterium phage Fishburne, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

527. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggaaccggcgcgctcaacatcgacgcctg	Protospacer
*****.*********** ***** . *  *..

528. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MF472894 (Mycobacterium phage Majeke, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

529. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MH450113 (Mycobacterium phage BigMau, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

530. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_023692 (Mycobacterium phage BigNuz, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg	Protospacer
**.** ***************** . *  *..

531. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MF281061 (Mycobacterium phage Ksquared, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

532. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

533. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to MH450130 (Mycobacterium phage Rohr, complete genome) position: , mismatch: 9, identity: 0.719

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg	Protospacer
***** *********** ***** . *  *..

534. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
atcggctttaccctgctgctgaacctgatcgg	Protospacer
.  ***  ******************* . *.

535. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
aactgcgagatcctgctgctgaacctggctcc	Protospacer
.*  **** *.**************** *   

536. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
ctggacgataccctgcggctgagcctgctgcc	Protospacer
  .*.*********** *****.*****.*  

537. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022751 (Sphingobium hydrophobicum strain C1 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
ggcgatgataacccgctgctgaacctgccaac	Protospacer
*. *..**** **.***************.. 

538. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
gcgcgcggcaccctgctgctgaacctgtgcaa	Protospacer
* . ***..******************.  .*

539. spacer 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719

ccgcgcgaggtctgggcggccgagttccgcga	CRISPR spacer
gcgcgcgaggtctcggtggccgaggactaccg	Protospacer
 ************ **.*******  *..* .

540. spacer 2.65|1147018|33|CP022794|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gtagacgaggcc--------cagcgcgccctgtcggcgctg	CRISPR spacer
--------ggcctgagcgcgcagcgcgcgctgtcggcgctg	Protospacer
        ****        ******** ************

541. spacer 2.71|1147384|33|CP022794|PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.727

gcgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
attttgtcacttcgggcacggcggcaaactgcc	Protospacer
.. .  ******** ************ *** *

542. spacer 2.74|1147568|33|CP022794|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gattgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
ccgcggcgcgcaggaagagttcgtcaagcgcgc	Protospacer
   .*.*  ********** **.**********

543. spacer 2.74|1147568|33|CP022794|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gattgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
ccgcggcgcgcaggaagagttcgtcaagcgcgc	Protospacer
   .*.*  ********** **.**********

544. spacer 2.78|1147812|33|CP022794|PILER-CR matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 9, identity: 0.727

gttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
cttctgcggcaccacgaccagcggcatccccat	Protospacer
 ************ ****** ***** ..*. .

545. spacer 2.78|1147812|33|CP022794|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.727

gttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
ggcgcccggcaccacgaccaccggcagttcctg	Protospacer
* . . ******* ******.*********.* 

546. spacer 2.78|1147812|33|CP022794|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.727

gttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
ggcgcccggcaccacgaccaccggcagttcctg	Protospacer
* . . ******* ******.*********.* 

547. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ctgcgtcacgagaacgcgctggcgctgctggcg	Protospacer
 .*  .  **************** *******.

548. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
ctgcgtcacgagaacgcgctggcgctgctggcg	Protospacer
 .*  .  **************** *******.

549. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tatgagaccgaggacgcgctggcgacgctggcg	Protospacer
   *  *.****.************.******.

550. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tatgagaccgaggacgcgctggcgacgctggcg	Protospacer
   *  *.****.************.******.

551. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tatgagaccgaggacgcgctggcgacgctggcg	Protospacer
   *  *.****.************.******.

552. spacer 2.84|1148179|33|CP022794|PILER-CR matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

gcggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
tatgagaccgaggacgcgctggcgacgctggcg	Protospacer
   *  *.****.************.******.

553. spacer 2.86|1148301|33|CP022794|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.727

atcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
ttcgcagatcatcgaggccggcccggcgctggt	Protospacer
 **************** ******* . *  . 

554. spacer 2.86|1148301|33|CP022794|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.727

atcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
ttcgcagatcatcgaggccggcccggcgctggt	Protospacer
 **************** ******* . *  . 

555. spacer 2.87|1148362|32|CP022794|PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.719

ggggatggtgaggaccttgccccc----cggcgcca	CRISPR spacer
cgggttggtgacgaccttgcccccatagctgt----	Protospacer
 *** ****** ************    * *.    

556. spacer 2.90|1148540|33|CP022794|PILER-CR matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 9, identity: 0.727

gttgatgcgggtcaggaaatcgctcgactcctg	CRISPR spacer
agccaggcgcggcaggaaatcgctcgactccga	Protospacer
. . * *** * ******************* .

557. spacer 2.91|1148601|33|CP022794|PILER-CR matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 9, identity: 0.727

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
caccatcaccatggcatcctggtcgagtgaccg	Protospacer
  ************* * *********...*. 

558. spacer 2.91|1148601|33|CP022794|PILER-CR matches to MN694285 (Marine virus AFVG_250M134, complete genome) position: , mismatch: 9, identity: 0.727

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
atctatcgccatggcctgctggtcgaaggcatc	Protospacer
.**.***.******************. .  *.

559. spacer 2.91|1148601|33|CP022794|PILER-CR matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 9, identity: 0.727

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
ctggtccgccatggcctgatggtcgatcagctc	Protospacer
 *   .*.********** ******* *****.

560. spacer 2.91|1148601|33|CP022794|PILER-CR matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 9, identity: 0.727

gtccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
ctggtccgccatggcctgatggtcgatcagctc	Protospacer
 *   .*.********** ******* *****.

561. spacer 2.92|1148662|33|CP022794|PILER-CR matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

-gcgtgcagcgcgccaggcgcggtagatagcatc	CRISPR spacer
cacg-gccgcgcgccaggcgcggtcgatatttcg	Protospacer
 .** ** **************** **** . . 

562. spacer 2.93|1148723|33|CP022794|PILER-CR matches to NC_031122 (Gordonia phage Eyre, complete genome) position: , mismatch: 9, identity: 0.727

gccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
agacctcatgccctgccagcacgtcgtcatcga	Protospacer
.   *.*.** ***************.*****.

563. spacer 2.96|1148906|33|CP022794|PILER-CR matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 9, identity: 0.727

gtcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
ttcgcggcggtcggcgcagttgccgcagtaccc	Protospacer
 *********************.**...*  . 

564. spacer 1.4|1136573|32|CP022794|CRISPRCasFinder,CRT matches to MK496050 (Pseudomonas sp. strain FFUP_PS_41 plasmid pJBCL41, complete sequence) position: , mismatch: 10, identity: 0.688

ggatgatgtccaggaggtatttgattcgatta	CRISPR spacer
aagtgatgtcgaggaggcatttgattatgctc	Protospacer
...******* ******.********  ..* 

565. spacer 1.4|1136573|32|CP022794|CRISPRCasFinder,CRT matches to MN961670 (Pseudomonas putida strain 420352 plasmid p420352-IMP, complete sequence) position: , mismatch: 10, identity: 0.688

ggatgatgtccaggaggtatttgattcgatta	CRISPR spacer
aagtgatgtcgaggaggcatttgattatgctc	Protospacer
...******* ******.********  ..* 

566. spacer 2.3|1146165|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688

gcttgggcattgccgacaacctgcaaccggac	CRISPR spacer
ccttgggcattgcctccaacctgctcagtgct	Protospacer
 *************  ********     * .

567. spacer 2.4|1146226|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MN694345 (Marine virus AFVG_250M178, complete genome) position: , mismatch: 10, identity: 0.688

tcgattccgatgggatttgtcgacctggatga	CRISPR spacer
atgcctccgatggaatttgtcgacatggtcat	Protospacer
 .* .********.********** *** .. 

568. spacer 2.4|1146226|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to MN694528 (Marine virus AFVG_250M165, complete genome) position: , mismatch: 10, identity: 0.688

tcgattccgatgggatttgtcgacctggatga	CRISPR spacer
atgcctccgatggaatttgtcgacatggtcat	Protospacer
 .* .********.********** *** .. 

569. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 10, identity: 0.688

ccgttctgcccggtgctcacgatcggcgcggt	CRISPR spacer
ggtgagcgcccggtgctcccggtcggcgcgct	Protospacer
      .*********** **.******** *

570. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ccgttctg-------cccggtgctcacgatcggcgcggt	CRISPR spacer
-------ggtggagccccgatgctcccgatcggcgcggc	Protospacer
       *       ****.***** ************.

571. spacer 2.7|1146409|32|CP022794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688

ccgttctg-------cccggtgctcacgatcggcgcggt	CRISPR spacer
-------ggtggagccccgatgctcccgatcggcgcggc	Protospacer
       *       ****.***** ************.

572. spacer 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 10, identity: 0.688

tagccatgttcccactgctgggcatgctcgct	CRISPR spacer
cggccatcttcccattgctgggcattttttgc	Protospacer
..***** ******.********** .*.  .

573. spacer 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 10, identity: 0.688

tagccatgttcccactgctgggcatgctcgct	CRISPR spacer
cggccatcttcccattgctgggcattttttgc	Protospacer
..***** ******.********** .*.  .

574. spacer 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 10, identity: 0.688

tagccatgttcccactgctgggcatgctcgct	CRISPR spacer
cggccatcttcccattgctgggcattttttgc	Protospacer
..***** ******.********** .*.  .

575. spacer 2.10|1146592|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 10, identity: 0.688

tagccatgttcccactgctgggcatgctcgct	CRISPR spacer
cggccatcttcccattgctgggcattttttgc	Protospacer
..***** ******.********** .*.  .

576. spacer 2.13|1146775|32|CP022794|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688

gaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
atcaccaacgcactgatcaacgacctgcacgc	Protospacer
.   . ..******** *****.*********

577. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_022125 (Rhodococcus erythropolis CCM2595 plasmid pRECF1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg	Protospacer
. ***** *********.*******  *. . 

578. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015205 (Rhodococcus sp. 008 plasmid pR8C2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg	Protospacer
. ***** *********.*******  *. . 

579. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP025960 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg	Protospacer
. ***** *********.*******  *. . 

580. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg	Protospacer
. ***** *********.*******  *. . 

581. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
cttcaaaggcccagtccgccctgtcggcgcct	Protospacer
.    .********. **************. 

582. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
gccgcattgcccagcgcgacctggcggcgctt	Protospacer
   .*.  ********** **** ******* 

583. spacer 2.23|1147385|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgttcacttcgcgcacggcggcaacctgac	CRISPR spacer
cgcgatcacttcgcgcgcggcggtggcgatgg	Protospacer
**** ***********.******...*   . 

584. spacer 2.25|1147508|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.688

aagagccaggccgctcctggcgcaccgaactt	CRISPR spacer
ctgagccagggcgatcctggcgcactgctggc	Protospacer
  ******** ** ***********.*    .

585. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga	Protospacer
 **************** * ****.   ..* 

586. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga	Protospacer
 **************** * ****.   ..* 

587. spacer 2.28|1147691|32|CP022794|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

taatcggaggccgcaatggggctcttcgacta	CRISPR spacer
gtgctggaggccgcaatggcactcttcggcct	Protospacer
  ...************** .*******.*. 

588. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
atcttcggcacctcgaccttcggcgcacggtg	Protospacer
 *** ************* *****.  .  * 

589. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gtggtcggcaactcgaccatcgacagttacat	Protospacer
 *   ***** ***********.***** . .

590. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022419 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence) position: , mismatch: 10, identity: 0.688

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
agatgcggcacctcggccatccgcagcttcat	Protospacer
   ************.***** ****.*.. .

591. spacer 2.34|1148058|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 10, identity: 0.688

tcggcgctccaatccccgcgatccatgccgtc	CRISPR spacer
tgatgtctccaatcctcacgatccatgcctcg	Protospacer
* .   *********.*.*********** . 

592. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 10, identity: 0.688

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
gcagcagcgcgaacgcgctggcgatgccgtgc	Protospacer
  . ** ** *****************.*   

593. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 10, identity: 0.688

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac	Protospacer
  ..******** ******** ***** *.  

594. spacer 2.36|1148180|32|CP022794|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688

cggccatcgagaacgcgctggcgatgctggca	CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac	Protospacer
  ..******** ******** ***** *.  

595. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
ggaaggatcatcgaggacgggccggtccagcc	Protospacer
  . .*************** *** ****   

596. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP035419 (Leisingera sp. NJS204 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt	Protospacer
*   ** ************** *****.  . 

597. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP038239 (Leisingera sp. NJS201 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt	Protospacer
*   ** ************** *****.  . 

598. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct	Protospacer
 ***.**************.****. *..   

599. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct	Protospacer
 ***.**************.****. *..   

600. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to MH834620 (Arthrobacter phage Melons, complete genome) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct	Protospacer
    *** *.***************** *   

601. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to MH834606 (Arthrobacter phage Coral, complete genome) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct	Protospacer
    *** *.***************** *   

602. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to MH834616 (Arthrobacter phage Kepler, complete genome) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct	Protospacer
    *** *.***************** *   

603. spacer 2.38|1148302|32|CP022794|CRISPRCasFinder,CRT matches to MH834609 (Arthrobacter phage Daob, complete genome) position: , mismatch: 10, identity: 0.688

tcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct	Protospacer
    *** *.***************** *   

604. spacer 2.43|1148602|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688

tccatcaccatggcctgctggtcgagcagctt	CRISPR spacer
agtttggccatggcctgccggtcgagcggcgc	Protospacer
  . * .***********.********.** .

605. spacer 2.44|1148663|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgtgcagcgcgccaggcgcggtagatagcatc	CRISPR spacer
acggccgcgcgccaggcgcggtcgatatttcg	Protospacer
   ** **************** **** . . 

606. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gagcggcggccggcgaagttgtcgtagggccg	Protospacer
  *******.***** *********..   .*

607. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

608. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

609. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

610. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

611. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

612. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

613. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

614. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

615. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

616. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

617. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

618. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

619. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

620. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

621. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

622. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

623. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

624. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

625. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

626. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

627. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

628. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

629. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

630. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

631. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

632. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

633. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

634. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT776813 (Mycobacterium phage Magic8, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

635. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

636. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

637. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

638. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

639. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

640. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

641. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

642. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

643. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

644. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

645. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

646. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

647. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

648. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

649. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

650. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

651. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

652. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

653. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

654. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

655. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

656. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

657. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

658. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

659. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

660. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

661. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

662. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

663. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

664. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

665. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

666. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

667. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

668. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

669. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

670. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

671. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

672. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

673. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

674. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

675. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

676. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

677. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

678. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

679. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

680. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

681. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

682. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

683. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

684. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

685. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

686. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

687. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

688. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

689. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

690. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

691. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

692. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

693. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

694. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

695. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

696. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

697. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

698. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

699. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

700. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

701. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

702. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

703. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

704. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

705. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

706. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

707. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

708. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

709. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

710. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

711. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

712. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

713. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

714. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

715. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

716. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

717. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

718. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

719. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

720. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

721. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

722. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

723. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

724. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

725. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

726. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

727. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

728. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

729. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

730. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

731. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

732. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

733. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

734. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

735. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

736. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

737. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

738. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

739. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

740. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

741. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

742. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

743. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

744. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

745. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

746. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

747. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

748. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

749. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

750. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

751. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

752. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

753. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

754. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

755. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

756. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

757. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

758. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

759. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

760. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

761. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

762. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

763. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

764. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

765. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

766. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

767. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

768. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

769. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

770. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

771. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

772. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

773. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

774. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

775. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

776. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

777. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

778. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

779. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

780. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

781. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

782. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

783. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

784. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

785. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

786. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

787. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

788. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

789. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

790. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

791. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

792. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

793. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

794. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

795. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

796. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

797. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

798. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

799. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

800. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

801. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

802. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

803. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

804. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

805. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

806. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

807. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

808. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

809. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

810. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

811. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

812. spacer 2.48|1148907|32|CP022794|CRISPRCasFinder,CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

813. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gagcggcggccggcgaagttgtcgtagggccg	Protospacer
  *******.***** *********..   .*

814. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

815. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

816. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

817. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

818. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

819. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

820. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

821. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

822. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

823. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

824. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

825. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

826. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

827. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

828. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

829. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

830. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

831. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

832. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

833. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

834. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

835. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

836. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

837. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

838. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

839. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

840. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

841. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT776813 (Mycobacterium phage Magic8, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

842. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

843. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

844. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

845. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

846. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

847. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

848. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

849. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

850. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

851. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

852. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

853. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

854. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

855. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

856. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

857. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

858. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

859. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

860. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

861. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

862. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

863. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

864. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

865. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

866. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

867. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

868. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

869. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

870. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

871. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

872. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

873. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

874. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

875. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

876. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

877. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

878. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

879. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

880. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

881. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

882. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

883. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

884. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

885. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

886. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

887. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

888. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

889. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

890. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

891. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

892. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

893. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

894. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

895. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

896. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

897. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

898. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

899. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

900. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

901. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

902. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

903. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

904. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

905. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

906. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

907. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

908. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

909. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

910. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

911. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

912. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

913. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

914. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

915. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

916. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

917. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

918. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

919. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

920. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

921. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

922. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

923. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

924. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

925. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

926. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

927. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

928. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

929. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

930. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

931. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

932. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

933. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

934. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

935. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

936. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

937. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

938. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

939. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

940. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

941. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

942. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

943. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

944. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

945. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

946. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

947. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

948. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

949. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

950. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

951. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

952. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

953. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

954. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

955. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

956. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

957. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

958. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

959. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

960. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

961. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

962. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

963. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

964. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

965. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

966. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

967. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

968. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

969. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

970. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

971. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

972. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

973. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

974. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

975. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

976. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

977. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

978. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

979. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

980. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

981. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

982. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

983. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

984. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

985. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

986. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

987. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

988. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

989. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

990. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

991. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

992. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

993. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

994. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

995. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

996. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

997. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

998. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

999. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1000. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1001. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1002. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1003. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1004. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1005. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1006. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1007. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1008. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1009. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1010. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1011. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1012. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc	Protospacer
 ****** ********** *****  .. *. 

1013. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1014. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1015. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1016. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1017. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1018. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1019. spacer 2.51|1149090|32|CP022794|CRISPRCasFinder,CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 10, identity: 0.688

tcgcggcggtcggcgcagttgtcgtgattgtg	CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc	Protospacer
 ****** ********** *****  .. *. 

1020. spacer 2.52|1149151|32|CP022794|CRISPRCasFinder,CRT matches to NC_013283 (Cronobacter turicensis z3032 plasmid pCTU1, complete sequence) position: , mismatch: 10, identity: 0.688

tcggcaacctttagcgccatcaaatcgtccag	CRISPR spacer
ggcgcaaactttaacgccatcaaatcagaaac	Protospacer
   **** *****.************.   * 

1021. spacer 2.55|1149334|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 10, identity: 0.688

cacgggaccggcgcgctgaacatgacccgcca	CRISPR spacer
gccgggatcggcgcgctgagcatgaagatcgg	Protospacer
  *****.***********.*****    * .

1022. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
ctgcgcgagacgctgctgctgaacctgatcgc	Protospacer
  . **** ** *************** . * 

1023. spacer 2.58|1149517|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgataccctgctgctgaacctgccgga	CRISPR spacer
ctgcgcgagacgctgctgctgaacctgatcgc	Protospacer
  . **** ** *************** . * 

1024. spacer 2.59|1149578|32|CP022794|CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 10, identity: 0.688

ccgcgcgaggtctgggcggccgagttccgcga	CRISPR spacer
gccgatttcgtctgggaggccgagatccgcga	Protospacer
 *  ..   ******* ******* *******

1025. spacer 2.72|1147445|34|CP022794|PILER-CR matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 10, identity: 0.706

agacgtgagcgagggcgaggacgtgacctacctg	CRISPR spacer
cgacgtgagcaaggccgaggacgtgaaggcggcg	Protospacer
 *********.*** ***********      .*

1026. spacer 2.73|1147507|33|CP022794|PILER-CR matches to NZ_CP023066 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence) position: , mismatch: 10, identity: 0.697

gaagagccaggccgctcctggcgcaccgaactt	CRISPR spacer
caagagccaggccgctcacggcgcaaattgcca	Protospacer
 **************** .******    .*. 

1027. spacer 2.86|1148301|33|CP022794|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697

atcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
ggttctgatcatcgaggacgatccgctccatcg	Protospacer
. . * **************..********. .

1028. spacer 2.14|1146836|32|CP022794|CRISPRCasFinder,CRT matches to NC_048139 (Streptomyces phage Hiyaa, complete genome) position: , mismatch: 11, identity: 0.656

ttgatcgagatgctgcgtctcgtccaggaccc	CRISPR spacer
cgcgtcgaggtgctgcgtctcggccagccggt	Protospacer
.  .*****.************ ****    .

1029. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP010618 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence) position: , mismatch: 11, identity: 0.656

tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac	Protospacer
  .*** ***** ************* .    

1030. spacer 2.17|1147019|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP010746 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence) position: , mismatch: 11, identity: 0.656

tagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac	Protospacer
  .*** ***** ************* .    

1031. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
taagacctgcaggaacaggtcatcaattaata	Protospacer
   **** ******* ********** ..   

1032. spacer 2.26|1147569|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

attgaccagcaggaagaggtcatcaagcgcgc	CRISPR spacer
taagacctgcaggaacaggtcatcaattaata	Protospacer
   **** ******* ********** ..   

1033. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca	Protospacer
 ********.*********.****    ... 

1034. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca	Protospacer
 ********.*********.****    ... 

1035. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 11, identity: 0.656

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg	Protospacer
      *******.*** *********** . 

1036. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP048285 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence) position: , mismatch: 11, identity: 0.656

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg	Protospacer
      *******.*** *********** . 

1037. spacer 2.30|1147813|32|CP022794|CRISPRCasFinder,CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 11, identity: 0.656

ttctgcggcacctcgaccatcggcagttcttc	CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca	Protospacer
 ********.*********.****    ... 

1038. spacer 2.45|1148724|32|CP022794|CRISPRCasFinder,CRT matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

ccgcccgtggcctgccagcacgtcgccatcgg	CRISPR spacer
gatgccgtggcgtgccagcaggtcgccgagct	Protospacer
    ******* ******** ******.    

1039. spacer 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 11, identity: 0.656

acgcgccgtgcgtcaagcaaacgggtatcgat	CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc	Protospacer
  ************ *.******** .    .

1040. spacer 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 11, identity: 0.656

acgcgccgtgcgtcaagcaaacgggtatcgat	CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc	Protospacer
  ************ *.******** .    .

1041. spacer 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 11, identity: 0.656

acgcgccgtgcgtcaagcaaacgggtatcgat	CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc	Protospacer
  ************ *.******** .    .

1042. spacer 2.54|1149273|32|CP022794|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 11, identity: 0.656

acgcgccgtgcgtcaagcaaacgggtatcgat	CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc	Protospacer
  ************ *.******** .    .

1043. spacer 2.61|1146774|33|CP022794|PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 11, identity: 0.667

ggaattgggcgcactgagcaacggcctgcacgc	CRISPR spacer
catcaccaacgcactgatcaacgacctgcacgc	Protospacer
 .   . ..******** *****.*********

1044. spacer 2.65|1147018|33|CP022794|PILER-CR matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667

gtagacgaggcccagcgcgccctgtcggcgctg	CRISPR spacer
acttcaaaggcccagtccgccctgtcggcgcct	Protospacer
..    .********. **************. 

1045. spacer 2.86|1148301|33|CP022794|PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 11, identity: 0.667

atcgcagatcatcgaggacggcccgctccacaa	CRISPR spacer
gggaaggatcatcgaggacgggccggtccagcc	Protospacer
.  . .*************** *** ****   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 241612 : 258491 23 Acidithiobacillus_phage(93.33%) NA NA
DBSCAN-SWA_2 262955 : 311224 38 uncultured_Caudovirales_phage(20.0%) transposase,head,capsid,portal,protease,terminase NA
DBSCAN-SWA_3 865702 : 939074 69 Paramecium_bursaria_Chlorella_virus(14.29%) transposase,protease,coat NA
DBSCAN-SWA_4 2045176 : 2051794 11 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_5 2678378 : 2686614 8 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_6 2769656 : 2832210 46 Shigella_phage(66.67%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage