1. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
agacgttgcacagcgcgcgaaccagcttgg Protospacer
******************************
2. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
agacgttgcacagcgcgcgaaccagcttgg Protospacer
******************************
3. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
agacgttgcacagcgcgcgaaccagcttgg Protospacer
******************************
4. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tcaatggcgcctgcacgcagctgggctcgc Protospacer
******************************
5. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tcaatggcgcctgcacgcagctgggctcgc Protospacer
******************************
6. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tcaatggcgcctgcacgcagctgggctcgc Protospacer
******************************
7. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttgacgcgcgcggtgtagaccttggggt Protospacer
******************************
8. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttgacgcgcgcggtgtagaccttggggt Protospacer
******************************
9. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 0, identity: 1.0
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttgacgcgcgcggtgtagaccttggggt Protospacer
******************************
10. spacer 1.34|1177967|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ctggcgaggtcagggctcgatgcacgcacc CRISPR spacer
ctggcgaggtcagggctcgatgcacgcacc Protospacer
******************************
11. spacer 1.34|1177967|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ctggcgaggtcagggctcgatgcacgcacc CRISPR spacer
ctggcgaggtcagggctcgatgcacgcacc Protospacer
******************************
12. spacer 1.15|1176712|30|CP022763|CRISPRCasFinder,CRT matches to MF150911 (Ralstonia phage DU_RP_II, complete genome) position: , mismatch: 1, identity: 0.967
gtccattgcgtacctgtcggcccactggcg CRISPR spacer
gtccattgcgtacctgtcggcccactggca Protospacer
*****************************.
13. spacer 1.15|1176712|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 1, identity: 0.967
gtccattgcgtacctgtcggcccactggcg CRISPR spacer
gtccattgcgtacctgtcggcccactggca Protospacer
*****************************.
14. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 1, identity: 0.967
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttgacgcgtgcggtgtagaccttggggt Protospacer
**********.*******************
15. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MF716957 (Ralstonia virus RSIBR1, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcggcgcacag Protospacer
*************************** **
16. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_008574 (Ralstonia phage RSM1, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcagcgcagag Protospacer
*********************.********
17. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB981170 (Ralstonia phage RSMSuper DNA, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcagcgcagag Protospacer
*********************.********
18. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB259123 (Ralstonia phage RSM1 DNA, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcagcgcagag Protospacer
*********************.********
19. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to KX179905 (Ralstonia phage Rs551, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcggcgcacag Protospacer
*************************** **
20. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_011399 (Ralstonia phage RSM3, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcagcgcagag Protospacer
*********************.********
21. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB434711 (Ralstonia phage RSM3 DNA, complete genome) position: , mismatch: 1, identity: 0.967
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcgatatcgaactcagcgcagag Protospacer
*********************.********
22. spacer 1.30|1177703|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012607 (Ralstonia insidiosa strain FC1138 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.967
accgtcgtcatgctcccggaaatttggtcg CRISPR spacer
accgtcgtcatgctcccggaaatctggtcg Protospacer
***********************.******
23. spacer 1.30|1177703|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016025 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-2, complete sequence) position: , mismatch: 1, identity: 0.967
accgtcgtcatgctcccggaaatttggtcg CRISPR spacer
accgtcgtcatgctcccggaaatctggtcg Protospacer
***********************.******
24. spacer 1.30|1177703|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 1, identity: 0.967
accgtcgtcatgctcccggaaatttggtcg CRISPR spacer
accgtcgtcatgctcccggaaatctggtcg Protospacer
***********************.******
25. spacer 1.30|1177703|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_012851 (Ralstonia pickettii 12D plasmid pRp12D03, complete sequence) position: , mismatch: 1, identity: 0.967
accgtcgtcatgctcccggaaatttggtcg CRISPR spacer
accgtcgtcatgctcccggaaatctggtcg Protospacer
***********************.******
26. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgccgctc Protospacer
*************************** *
27. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtacgcgccgcgc Protospacer
******************* ******* **
28. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgccgctc Protospacer
*************************** *
29. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
30. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
31. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgcgc Protospacer
************************.** **
32. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgccgctc Protospacer
*************************** *
33. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgcgc Protospacer
************************.** **
34. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
35. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
36. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgccgctc Protospacer
*************************** *
37. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
38. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgcgc Protospacer
************************.** **
39. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
40. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgcgc Protospacer
**** ********************** **
41. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 2, identity: 0.933
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgcgc Protospacer
************************.** **
42. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740733 (Ralstonia phage Dimitile, complete genome) position: , mismatch: 2, identity: 0.933
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
gagaaggtgggttgcgcggtgctacggccg Protospacer
******** ********************.
43. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740730 (Ralstonia phage Cimandef, complete genome) position: , mismatch: 2, identity: 0.933
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
gagaaggtgggttgcgcggtgctacggccg Protospacer
******** ********************.
44. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740731 (Ralstonia phage Claudette, complete genome) position: , mismatch: 2, identity: 0.933
gtaaggagccacctcacgcatggcgattga CRISPR spacer
gtaaggagccacctcacgcatggcgactgc Protospacer
**************************.**
45. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740727 (Ralstonia phage Alix, complete genome) position: , mismatch: 2, identity: 0.933
gtaaggagccacctcacgcatggcgattga CRISPR spacer
gtaaggagccacctcacgcatggcgactgc Protospacer
**************************.**
46. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AB937974 (Ralstonia phage RS603 DNA, complete genome) position: , mismatch: 2, identity: 0.933
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
tatgtccgcaatatcgaactcagcgcagag Protospacer
*********.***********.********
47. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
48. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtccgcgccgctc Protospacer
************* ************* *
49. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
50. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtccgcgccgctc Protospacer
************* ************* *
51. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtacgcgccgccc Protospacer
******************* ******* *
52. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
53. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
54. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
55. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
56. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcgcaggtccgcgccgccc Protospacer
*********.***************** *
57. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtccgcgccgctc Protospacer
************* ************* *
58. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
59. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtccgcgccgctc Protospacer
************* ************* *
60. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtacgcgccgccc Protospacer
******************* ******* *
61. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
62. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtccgcgccgctc Protospacer
************* ************* *
63. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtacgcgccgccc Protospacer
******************* ******* *
64. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
65. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcgcaggtccgcgccgccc Protospacer
*********.***************** *
66. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtacgcgccgccc Protospacer
******************* ******* *
67. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcgcaggtccgcgtcgccc Protospacer
************************.** *
68. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcgcaggtccgcgccgccc Protospacer
*********.***************** *
69. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
70. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcacaggtccgcgccgccc Protospacer
*************.************* *
71. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcacaggtccgcgccgccc Protospacer
*************.************* *
72. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 3, identity: 0.9
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtccgcgccgctc Protospacer
**** ********************** *
73. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 3, identity: 0.9
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ccagcgtcgcgaacagcatcgcgcacagcg Protospacer
********** *****.************
74. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtccgctccgctc Protospacer
************* ********* *** *
75. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgccc Protospacer
************* ***** ******* *
76. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
77. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
78. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
79. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
80. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
81. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcgcaggtacgcgccgccc Protospacer
*********.********* ******* *
82. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
83. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
84. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
85. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
86. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
87. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
88. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtccgcgtcgccc Protospacer
************* **********.** *
89. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgccc Protospacer
************* ***** ******* *
90. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
91. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
92. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
93. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740746 (Ralstonia phage Sarlave, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgctc Protospacer
**** ************** ******* *
94. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
95. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
96. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgctc Protospacer
**** ************** ******* *
97. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
98. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
99. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740725 (Ralstonia phage Adzire, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtccgcgtcgccc Protospacer
************* **********.** *
100. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgccc Protospacer
**** ************** ******* *
101. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
102. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
103. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgccc Protospacer
**** ************** ******* *
104. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
105. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
106. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgctcaggtccgcgccgctc Protospacer
**** ******** ************* *
107. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgctc Protospacer
**** ******** ************* *
108. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgctc Protospacer
************* ***** ******* *
109. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgctc Protospacer
**** ************** ******* *
110. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcccaggtccgcgccgccc Protospacer
**** ******** ************* *
111. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtacgcgccgccc Protospacer
************* ***** ******* *
112. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740747 (Ralstonia phage Simangalove, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgcccaggtccgcgtcgccc Protospacer
************* **********.** *
113. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcccaggtccgcgccgcac Protospacer
*********.*** ************* .*
114. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggttcgcgccgcgcaggtccgcgccgctt Protospacer
****.********************** .
115. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggttcgcgccgcgcaggtccgcgccgctt Protospacer
****.********************** .
116. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgtcgcccaggtccgcgccgcac Protospacer
*********.*** ************* .*
117. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggttcgcgccgcgcaggtcggcgccggtc Protospacer
****.*************** ******. *
118. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtgcgcgccgggcaggtccgcgccgccc Protospacer
**** ******* ************** *
119. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agtgccgggccgcccaggtccgcgccgagc Protospacer
** *** ***** ****************
120. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MG652450 (Ralstonia phage RsoP1IDN, complete genome) position: , mismatch: 4, identity: 0.867
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgccccgcgcaggtccgcgtagcgc Protospacer
******** ***************. * **
121. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740735 (Ralstonia phage Elie, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtacgcgccgcgcaggtacgcgccgcct Protospacer
**** ************** ******* .
122. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740729 (Ralstonia phage Bakoly, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgcct Protospacer
************* ***** ******* .
123. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT740744 (Ralstonia phage Jenny, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctcaggtacgcgccgcct Protospacer
************* ***** ******* .
124. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP007157 (Corynebacterium falsenii DSM 44353 strain BL 8171 plasmid phiCFAL8171I, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggctagcgccgcgcaggtcagcgccgtgc Protospacer
***.. ************** ****** **
125. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MF150911 (Ralstonia phage DU_RP_II, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggttcgcgccgcgcaggtccgcgtagctc Protospacer
****.*******************. * *
126. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cggagaccgccgcgcaggtccgcgccgagc Protospacer
** ***********************
127. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtcggcgccggtg Protospacer
***** ************** ******.
128. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtcggcgttgcgc Protospacer
***** ************** ***..* **
129. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtcggcgccggtg Protospacer
***** ************** ******.
130. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtcggcgttgcgc Protospacer
***** ************** ***..* **
131. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgctgcggaggtccgcgccgctg Protospacer
**********.*** ************
132. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
133. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
134. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
135. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgctgcggaggtccgcgccgctg Protospacer
**********.*** ************
136. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
137. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
138. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
139. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgccgctg Protospacer
************* ************
140. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgctgcgg Protospacer
************* **********.* *
141. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgctgcggaggtccgcgctgtgg Protospacer
**********.*** **********.* *
142. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgccgctgaggtccgcgctgcgg Protospacer
************* **********.* *
143. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 5, identity: 0.833
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgaccggcgccgcgcaggtccgcgtcgagc Protospacer
*..* ******************.*****
144. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT498059 (Gordonia phage Doggs, complete genome) position: , mismatch: 5, identity: 0.833
-aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgggtctg-gccgcgcaggtcggcgccgagg Protospacer
.****.* ************ ********
145. spacer 1.11|1176448|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.833
ccatcaggccacacaacagcagggccttgt CRISPR spacer
ccggctggccacagaccagcagggccttgt Protospacer
**. * ******* * **************
146. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MG962364 (Mycobacterium phage Deby, complete genome) position: , mismatch: 5, identity: 0.833
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgcgtcgcgcacagtgtcgtgcacagcg Protospacer
*************.****.********
147. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MF919532 (Mycobacterium phage Sulley, complete genome) position: , mismatch: 5, identity: 0.833
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgcgtcgcgcacagtgtcgtgcacagcg Protospacer
*************.****.********
148. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP029177 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
atcgcgtcgcgaacagcgtcgcgcaccgcc Protospacer
*. ******** ************** **
149. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MH230177 (Aeromonas phage SD04, complete genome) position: , mismatch: 5, identity: 0.833
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgtcgcgcacagct Protospacer
**** *********************
150. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_028831 (Escherichia phage slur01, complete genome) position: , mismatch: 5, identity: 0.833
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgtcgcgcacagct Protospacer
**** *********************
151. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KM236243 (Escherichia phage Seurat, complete genome) position: , mismatch: 5, identity: 0.833
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgtcgcgcacagct Protospacer
**** *********************
152. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KP064094 (Enterobacteria phage CAjan, complete genome) position: , mismatch: 5, identity: 0.833
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgtcgcgcacagct Protospacer
**** *********************
153. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KX534337 (Escherichia phage Greed, partial genome) position: , mismatch: 5, identity: 0.833
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgtcgcgcacagct Protospacer
**** *********************
154. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.833
acagcgtcgcgcacagcgtcgcgca-cagcg CRISPR spacer
acgacgtcgcgcaccgcgtcgcgcagccgc- Protospacer
**..********** ********** * **
155. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740738 (Ralstonia phage Gamede, complete genome) position: , mismatch: 5, identity: 0.833
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
tgagaggtttgttgcgcggtgctacggcca Protospacer
...***** ********************
156. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 5, identity: 0.833
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
tgagaggtttgttgcgcggtgctacggcca Protospacer
...***** ********************
157. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 5, identity: 0.833
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
tgagaggtttgttgcgcggtgctacggcca Protospacer
...***** ********************
158. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MT740742 (Ralstonia phage Heva, complete genome) position: , mismatch: 5, identity: 0.833
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
tgagaggtttgttgcgcggtgctacggcca Protospacer
...***** ********************
159. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to KT361655 (Paenibacillus phage Hayley, complete genome) position: , mismatch: 5, identity: 0.833
gtaaggagccacctcacgcatggcgattga CRISPR spacer
ataaggatctacctcacgcatggcgatcca Protospacer
.****** *.*****************. *
160. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MG727697 (Paenibacillus phage Dragolir, complete genome) position: , mismatch: 5, identity: 0.833
gtaaggagccacctcacgcatggcgattga CRISPR spacer
ataaggatctacctcacgcatggcgatcca Protospacer
.****** *.*****************. *
161. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to KT361656 (Paenibacillus phage Vadim, complete genome) position: , mismatch: 5, identity: 0.833
gtaaggagccacctcacgcatggcgattga CRISPR spacer
ataaggatctacctcacgcatggcgatcca Protospacer
.****** *.*****************. *
162. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_028767 (Paenibacillus phage Vegas, complete genome) position: , mismatch: 5, identity: 0.833
gtaaggagccacctcacgcatggcgattga CRISPR spacer
ataaggatctacctcacgcatggcgatcca Protospacer
.****** *.*****************. *
163. spacer 1.20|1177043|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to KT361657 (Paenibacillus phage Diane, complete genome) position: , mismatch: 5, identity: 0.833
gtaaggagccacctcacgcatggcgattga CRISPR spacer
ataaggatctacctcacgcatggcgatcca Protospacer
.****** *.*****************. *
164. spacer 1.21|1177109|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to AP014887 (Vibrio phage CKB-S1 DNA, complete sequence) position: , mismatch: 5, identity: 0.833
--gtacagttcgatggcagcatggtcgacacg CRISPR spacer
aagtcca--tcgacggcagcacggtcgacacg Protospacer
** ** ****.*******.**********
165. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 6, identity: 0.8
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
agacgatggacagcgcgcgaaccgggctcg Protospacer
***** ** **************.* .* *
166. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 6, identity: 0.8
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
agacgatggacagcgcgcgaaccgggctcg Protospacer
***** ** **************.* .* *
167. spacer 1.5|1176053|30|CP022763|CRISPRCasFinder,CRT matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 6, identity: 0.8
acacgattcggcgcgtggtcgggcggctga-- CRISPR spacer
agacgatgcggcgcgtggtcgagcg--cgatc Protospacer
* ***** *************.*** .**
168. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN996301 (Ralstonia phage RpY1, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgctccgctcaggtccgcttcgctc Protospacer
******** **** ********* .** *
169. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MF150911 (Ralstonia phage DU_RP_II, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtccgcgcagctcaggtccgcgtagctc Protospacer
********** ** **********. * *
170. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgagcgcgccgcgcaggcccgcgccgagg Protospacer
. * *************.**********
171. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agcacccgtccgcgcaggtccgcggcgagc Protospacer
** ** *************** *****
172. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agatccgcgccgcgcaggtccgagccttcg Protospacer
**.******************* ***
173. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtccgagccctcg Protospacer
***** **************** ***
174. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agatccgcgccgcgcaagtccgcctcggcc Protospacer
**.*************.****** .**. *
175. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agcgcgccgccgagcaggtccgcgccgagt Protospacer
** * ***** ****************.
176. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agcgcgccgccgagcaggtccgcgccgagt Protospacer
** * ***** ****************.
177. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_002682 (Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agcgcgccgccgagcaggtccgcgccgagt Protospacer
** * ***** ****************.
178. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtccacgagcagg Protospacer
***** ***************.** **
179. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcgacctggcggcgcaggtccgcgccgagc Protospacer
* ** ** *******************
180. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agcgcgccgccgagcaggtccgcgccgagt Protospacer
** * ***** ****************.
181. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ttgcccgcgccgcgcaggaccgcgccacgc Protospacer
*.************** *******. **
182. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP041044 (Paracoccus sp. AK26 plasmid pAK2, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ttgcccgcgccgcgcaggaccgcgccacgc Protospacer
*.************** *******. **
183. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggctgcgcgccgccgaggtccgcgccgagg Protospacer
.* * ******** **************
184. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggctgcgcgccgccgaggtccgcgccgagg Protospacer
.* * ******** **************
185. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggctgcgcgccgccgaggtccgcgccgagg Protospacer
.* * ******** **************
186. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggctgcgcgccgccgaggtccgcgccgagg Protospacer
.* * ******** **************
187. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggctgcgcgccgccgaggtccgcgccgagg Protospacer
.* * ******** **************
188. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
189. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
190. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
191. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggaggtcgccgcgctggtccgcgccgcgc Protospacer
*** ******** *********** **
192. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccg---cgccgcgcaggtccgcgccgagc CRISPR spacer
---tctggctcgccgagcaggtccgcgccgcgc Protospacer
**.* ***** ************** **
193. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccg-cgccgagc CRISPR spacer
aggtccgcgccgccaaggtccgccgctgca- Protospacer
************* ******* ***.* .
194. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
aggtc---cgcgccgcgcaggtccgcgccgagc CRISPR spacer
---tccagcacgccgcgcagttccgcgccgcgc Protospacer
** *.********** ********* **
195. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
196. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
197. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
198. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
199. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
200. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
agatccgcgccgcccaggtccgccatgagg Protospacer
**.********** ********* .***
201. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggtcggcgccgcgcaggtcggccttgcgc Protospacer
***** ************** ** ..* **
202. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP031600 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence) position: , mismatch: 6, identity: 0.8
aggtc---cgcgccgcgcaggtccgcgccgagc CRISPR spacer
---tccagcacgccgcgcagttccgcgccgcgc Protospacer
** *.********** ********* **
203. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
204. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
205. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
206. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggcaggcgccgcgcaggtcggcgccggac Protospacer
***. ************** ******..*
207. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
acctcgacgccgggcaggtccgcgccgaac Protospacer
* ** .***** ***************.*
208. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 6, identity: 0.8
aggtc---cgcgccgcgcaggtccgcgccgagc CRISPR spacer
---tccagcacgccgcgcagttccgcgccgcgc Protospacer
** *.********** ********* **
209. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
---aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaaagt---cgccgcgcaggtgcgcgcccagc Protospacer
*.** ************ ****** ***
210. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP045373 (Sulfitobacter sp. THAF37 plasmid pTHAF37_a, complete sequence) position: , mismatch: 6, identity: 0.8
aggtc---cgcgccgcgcaggtccgcgccgagc CRISPR spacer
---tccagcacgccgcgcagttccgcgccgcgc Protospacer
** *.********** ********* **
211. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8
aggtc---cgcgccgcgcaggtccgcgccgagc CRISPR spacer
---tccagcacgccgcgcagttccgcgccgcgc Protospacer
** *.********** ********* **
212. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.8
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aggcaggcgccgcgcaggtcggcgccggac Protospacer
***. ************** ******..*
213. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP034151 (Pantoea agglomerans strain L15 plasmid pPagL15_3, complete sequence) position: , mismatch: 6, identity: 0.8
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tgacccgcgcctgcacgcagcggggctggc Protospacer
* * . *************** ***** **
214. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 6, identity: 0.8
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tgaaaagcgcctgcaagcagctcggctcgg Protospacer
* ** .********* ****** ******
215. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 6, identity: 0.8
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tgaaaagcgcctgcaagcagctcggctcgg Protospacer
* ** .********* ****** ******
216. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 6, identity: 0.8
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tgaaaagcgcctgcaagcagctcggctcgg Protospacer
* ** .********* ****** ******
217. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 6, identity: 0.8
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
tgaaaagcgcctgcaagcagctcggctcgg Protospacer
* ** .********* ****** ******
218. spacer 1.11|1176448|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8
ccatcaggccacacaacagcagggccttgt CRISPR spacer
ccagcaggccacagaacagcaggccggtgg Protospacer
*** ********* ********* * **
219. spacer 1.12|1176514|30|CP022763|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 6, identity: 0.8
gttcgaatgttgattacgctgcgatccgga CRISPR spacer
ggcctaatgttgattacgaagcgatccgaa Protospacer
* .* ************* ********.*
220. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KJ567045 (Mycobacterium phage Emerson, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgtgcgtcgcgcaccgtgtcgcgcacagcc Protospacer
*********** *.************
221. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgtgtcgcgcacggtgtcgcgcacagcg Protospacer
*.*********.*.*************
222. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgtgtcgcgcacggtgtcgcgcacagcg Protospacer
*.*********.*.*************
223. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgtgtcgcgcacggtgtcgcgcacagcg Protospacer
*.*********.*.*************
224. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MK310138 (Mycobacterium phage Shaobing, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
gcagcgccgcgcacggcgtcgcgcaccttg Protospacer
.*****.*******.*********** .*
225. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgtgtcgcgcacggtgtcgcgcacagcg Protospacer
*.*********.*.*************
226. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgcgtgtcgcgcacggtgtcgcgcacagcg Protospacer
*.*********.*.*************
227. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
228. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
229. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
gcagcgtcgcgcagagcgacgcgcagaact Protospacer
.************ **** ****** *.*
230. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
231. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
232. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
233. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
234. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
235. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
236. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
237. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
acaaattcgcgcacagcctcgcgcacggcc Protospacer
***. *********** ********.**
238. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
239. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
240. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
241. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
242. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
243. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
244. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
-acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ggccgag-cgcgaacagcgtcgcgcgcagcg Protospacer
.* * * **** ************.*****
245. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to LR025197 (Escherichia phage vB_Eco_SLUR75 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.8
----acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgaaacag----gcgcacagcgttgcgcacagct Protospacer
**** ***********.*********
246. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 6, identity: 0.8
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tcatccccgcgcaccgcgtcgggcacagcg Protospacer
** * .******* ****** ********
247. spacer 1.18|1176911|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032319 (Hymenobacter oligotrophus strain sh-6 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
gagaaggttggttgcgcggtgctacggcca CRISPR spacer
gcgcccgttggtagcacggtgctacggcca Protospacer
* * ****** **.**************
248. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
ggtgtccgcgatatcgatctcgtcgcagcc Protospacer
.*************** **** *****
249. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
250. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
251. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
252. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
253. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
254. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
255. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 6, identity: 0.8
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
gaacgggttacgctcgaagacgaactgctc Protospacer
.* * *********** ****** *****
256. spacer 1.34|1177967|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046101 (Rhodococcus sp. AQ5-07 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
ctggcga--ggtcagggctcgatgcacgcacc CRISPR spacer
--ggagatcagtcacggctcgatgcacgcaca Protospacer
** ** .**** ****************
257. spacer 1.34|1177967|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
ctggcgaggtcagggctcgatgcacgcacc CRISPR spacer
ccggcaaggtcagggctcgatgctctgacg Protospacer
*.***.***************** * **
258. spacer 1.2|1175855|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049039 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_2, complete sequence) position: , mismatch: 7, identity: 0.767
gcttatgccatcaggagcacgcgcaggaat CRISPR spacer
actggcgccagcagcagcacgcgcaggaac Protospacer
.** ..**** *** **************.
259. spacer 1.5|1176053|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
acacgattcggcgcgtggtcgggcggctga CRISPR spacer
agacgatgcggcgcgtggtctggcgcgcgg Protospacer
* ***** ************ **** .*.
260. spacer 1.5|1176053|30|CP022763|CRISPRCasFinder,CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
acacgattcggcgcgtggtcgggcggctga CRISPR spacer
agacgatgcggcgcgtggtctggcgcgcgg Protospacer
* ***** ************ **** .*.
261. spacer 1.5|1176053|30|CP022763|CRISPRCasFinder,CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.767
acacgattcggcgcgtggtcgggcggctga CRISPR spacer
agacgatgcggcgcgtggtctggcgcgcgg Protospacer
* ***** ************ **** .*.
262. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc--- CRISPR spacer
gggtgcgcggcgcgcaggtccg---cgaacgcg Protospacer
.*** **** ************ ***.*
263. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.767
--aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcgaagccgcg--gcgcaggtgcgcgccgagc Protospacer
... ***** ******** **********
264. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcccctacgccgcgcaggtccgcgccgcgc Protospacer
. .*..******************** **
265. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcccctacgccgcgcaggtccgcgccgcgc Protospacer
. .*..******************** **
266. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcccctacgccgcgcaggtccgcgccgcgc Protospacer
. .*..******************** **
267. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ccctcgccgccgcgcaggtccgcgccgacg Protospacer
** *********************
268. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT310860 (Mycobacterium phage Chris, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ccctcgccgccgcgcaggtccgcgccgacg Protospacer
** *********************
269. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
270. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
atttcgacgccgagcaggtccgcgccgacg Protospacer
* ** .***** ***************
271. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
acggaggcgcggcgcaggtccgcgccgacg Protospacer
* * **** *****************
272. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
273. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
274. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcgcccgcgccgcgcagatcctcgccgcgt Protospacer
*.*************.*** ***** *.
275. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgccggcgccgcgcagctccgcaccgaga Protospacer
. *.* *********** *****.*****
276. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
277. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
278. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
acttccgcgccgcgcaggtcgacgccgtcg Protospacer
* ***************** .*****
279. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cggtccgcgccgcgctgttccgcgatgcgg Protospacer
************** * ****** .* *
280. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
atatccgcgccgcgcaggaccacgccggca Protospacer
* .*************** **.*****.
281. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tggcggaagccgcgccggtccgcgccgagc Protospacer
**. . ******* **************
282. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgcgccgcgcagcgcgggtccgcgccgatg Protospacer
* ****** ****.************
283. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aaatcggcgccgcgcaggtcggcgccgctg Protospacer
*..** ************** ******
284. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgcgccgcgcagcgcgggtccgcgccgatg Protospacer
* ****** ****.************
285. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cccgccgcgccgcccaggcccgcgccgacc Protospacer
********* ****.********* *
286. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgcccgcgccgcccagctccgcgccgaag Protospacer
. *.********* *** **********.
287. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgagctggccgcgctggtccgcgccgagc Protospacer
. * * ******* **************
288. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aaatcggcgccgcgcaggtcggcgccgctg Protospacer
*..** ************** ******
289. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcgttgtcgccgcgcaggaccgcgccgaac Protospacer
**. *********** *********.*
290. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP003953 (Rhodococcus opacus PD630 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcacccgcgccgcgcaggtccgccgcgacc Protospacer
. ..******************* *** *
291. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
292. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ccgaactcgccgggcaggtccgcgccgacc Protospacer
* * ***** *************** *
293. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcgatctcgccgcgcagatacgcgccgagc Protospacer
* .* **********.* **********
294. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtggccgcgccgggcaggcccgcgccgctc Protospacer
. * ******** *****.******** *
295. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc-- CRISPR spacer
agttccgcgccgcgcgggtc--cgccaggttg Protospacer
** ************.**** ****..*.
296. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
297. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
298. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
299. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcggccgcgccgcgccggtcagcgccgcgg Protospacer
. * *********** **** ****** *
300. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
301. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
302. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
accaccgcgccgcgcacgtccgccccggcc Protospacer
* ************ ****** ***. *
303. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ttttgctcgccgcgcagttccgcgccgtgc Protospacer
* * ********** ********* **
304. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
305. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
306. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gtgccgtcaccgcgcaggcccgcgccgagc Protospacer
. *.* *.*********.***********
307. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cggatttcaccgcgcaggtgcgcgccgagc Protospacer
** .. *.********** **********
308. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
acgagcgcgccgcgccggtccgcgccagac Protospacer
* * ********** **********...*
309. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ccgaactcgccgggcaggtccgcgccgacc Protospacer
* * ***** *************** *
310. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tcggcaccgccgggcaggtccgcgcccagc Protospacer
* * ***** ************* ***
311. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tagtaggcgccgtgcaggtccgggccgagg Protospacer
.** ******.********* ******
312. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MF919521 (Gordonia phage Lysidious, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tagtaggcgccgtgcaggtccgggccgagg Protospacer
.** ******.********* ******
313. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT310859 (Mycobacterium phage MarkPhew, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgctcgccgccgcgcaggtccgcgctgacg Protospacer
* ** ******************.**
314. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tagtaggcgccgtgcaggtccgggccgagg Protospacer
.** ******.********* ******
315. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
accacaccgccgagcaggcccgcgccgagc Protospacer
* * ***** *****.***********
316. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to KR080195 (Mycobacterium phage Phayonce, complete genome) position: , mismatch: 7, identity: 0.767
aggtcc---gcgccgcgcaggtccgcgccgagc CRISPR spacer
---cccatgacgccgagcaggcccgcgccgagc Protospacer
.** .***** *****.***********
317. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MN585963 (Gordonia phage Wocket, complete genome) position: , mismatch: 7, identity: 0.767
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
tagtaggcgccgtgcaggtccgggccgagg Protospacer
.** ******.********* ******
318. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 7, identity: 0.767
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
gcagcgagacctgcacggagctgggctcgc Protospacer
**..*. .******** ************
319. spacer 1.8|1176251|30|CP022763|CRISPRCasFinder,CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
cccagccaggtaggtgtggctcatgccgcg Protospacer
.** ******.***************
320. spacer 1.8|1176251|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
aagggcgcggtcggcgtggttcagaagccg Protospacer
*********** *******.*** . **
321. spacer 1.8|1176251|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
aagggcgcggtcggcgtggttcagaagccg Protospacer
*********** *******.*** . **
322. spacer 1.9|1176317|30|CP022763|CRISPRCasFinder,CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
cccagccaggtaggtgtggctcatgccgcg Protospacer
.** ******.***************
323. spacer 1.9|1176317|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
aagggcgcggtcggcgtggttcagaagccg Protospacer
*********** *******.*** . **
324. spacer 1.9|1176317|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.767
aagggcgcggtaggcgtggctcatgccgcg CRISPR spacer
aagggcgcggtcggcgtggttcagaagccg Protospacer
*********** *******.*** . **
325. spacer 1.10|1176383|29|CP022763|CRISPRCasFinder,CRT matches to MK814752 (Gordonia phage Lutum, complete genome) position: , mismatch: 7, identity: 0.759
cagctcgcgcacaccaggcggatcttgta CRISPR spacer
ctttcggcgcagaccaggcggatgttgta Protospacer
* .. ***** *********** *****
326. spacer 1.10|1176383|29|CP022763|CRISPRCasFinder,CRT matches to NC_048141 (Gordonia phage Kenna, complete genome) position: , mismatch: 7, identity: 0.759
cagctcgcgcacaccaggcggatcttgta CRISPR spacer
ctttcggcgcagaccaggcggatgttgta Protospacer
* .. ***** *********** *****
327. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 7, identity: 0.767
agacggacgcagcggcgattgctcgcatga CRISPR spacer
cgccattcgaagcggcgatggctcgcatga Protospacer
* *. ** ********* **********
328. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.767
agacggacgcagcggcgattgctcgcatga CRISPR spacer
cgccatccgcagcggcgacggctcgcatga Protospacer
* *. ***********. **********
329. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.767
agacggacgcagcggcgattgctcgcatga CRISPR spacer
cgccattcgcagcggcgacggctcgcatga Protospacer
* *. ***********. **********
330. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 7, identity: 0.767
agacggacgcagcggcgattgctcgcatga CRISPR spacer
cgccattcgaagcggcgatggctcgcatga Protospacer
* *. ** ********* **********
331. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.767
agacggacgcagcggcgattgctcgcatga CRISPR spacer
cgccattcgaagcggcgatggctcgcatga Protospacer
* *. ** ********* **********
332. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgtgcaccgcgcgcagcgtcgcgcacatcg Protospacer
**..*****.************** **
333. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
taataggcgcgcacagcgtcgcgaacatcg Protospacer
* * **************** *** **
334. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015746 (Shinella sp. HZN7 plasmid pShin-10, complete sequence) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
agcacctcgcgcacggcgtcgcggacagct Protospacer
* .* ********.******** *****
335. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
acagcttcgcgcaccgcgtcgcgatcgtct Protospacer
***** ******** ******** *. *
336. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ccagcgtcgtgctcagcgtcgcgccgacct Protospacer
********.** *********** * *
337. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MN234212 (Mycobacterium phage Paphu, complete genome) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ccagcgtcgtgctcagcgtcgcgccgacct Protospacer
********.** *********** * *
338. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NC_028828 (Mycobacterium phage TheloniousMonk, complete genome) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ccagcgtcgtgctcagcgtcgcgccgacct Protospacer
********.** *********** * *
339. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KY224001 (Mycobacterium phage Blue, complete genome) position: , mismatch: 7, identity: 0.767
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ccagcgtcgtgctcagcgtcgcgccgacct Protospacer
********.** *********** * *
340. spacer 1.15|1176712|30|CP022763|CRISPRCasFinder,CRT matches to MN234218 (Gordonia phage Powerball, complete genome) position: , mismatch: 7, identity: 0.767
gtccattgcgtacctgtcggcccactggcg CRISPR spacer
ggtagtcgcgtacctgtcgtgccactggcg Protospacer
* . .*.************ *********
341. spacer 1.15|1176712|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
gtccattgcgtacctgtcggcccactggcg CRISPR spacer
ctgcgacgcggacctgtcggcccactggtg Protospacer
* *. .*** *****************.*
342. spacer 1.21|1177109|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.767
gtacagttcgatggcagcatggtcgacacg CRISPR spacer
gaagctttcgatggcagcattgtcgagaca Protospacer
* * ************** ***** **.
343. spacer 1.21|1177109|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.767
gtacagttcgatggcagcatggtcgacacg CRISPR spacer
gaagctttcgatggcagcattgtcgagaca Protospacer
* * ************** ***** **.
344. spacer 1.21|1177109|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.767
gtacagttcgatggcagcatggtcgacacg CRISPR spacer
gcggcgctcgatggccgcatggtcgccacg Protospacer
*.. *.******** ********* ****
345. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
tgatgacgcgcgcggtgcagacctgcgcgc Protospacer
* **************.****** * *.
346. spacer 1.25|1177373|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to MK448899 (Streptococcus phage Javan288, complete genome) position: , mismatch: 7, identity: 0.767
acaccatcaattgccaagtagctgatggtc CRISPR spacer
acaccatcaattgacaagtaactatgggcg Protospacer
************* ******.**. **.
347. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.767
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
cggcaggcatagccgaacatgatgccctgg Protospacer
*. ******************.***. *
348. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
cggcaggcatagccgaacatgatgccctgg Protospacer
*. ******************.***. *
349. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
cggcaggcatagccgaacatgatgccctgg Protospacer
*. ******************.***. *
350. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 8, identity: 0.733
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
ttgcttcgcacagcgcgcgaaacagcttcc Protospacer
.* *.************** ******
351. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
gcgtggcgcacagcgcgcaaaccagcatgg Protospacer
. ..* .***********.******* ***
352. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ccacccgcgccgagcaggaccgcgccgacg Protospacer
..******** ***** *********
353. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gctgccgcgccgcgccggaccgcgccgccc Protospacer
. *********** ** ******** *
354. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
355. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
356. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
357. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
358. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
359. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
360. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcccgcgcgcggcgcaggtccgcgccgatg Protospacer
. . ***** *****************
361. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
362. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcccgcgcgcggcgcaggtccgcgccgatg Protospacer
. . ***** *****************
363. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
caggccgcgccgcgcaggtcgccgccgtca Protospacer
.* **************** *****
364. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
365. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
366. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
367. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
368. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
369. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
370. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
371. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
372. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
373. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
374. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
375. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
376. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
377. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
378. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
379. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
380. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
381. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
382. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
383. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
384. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
385. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
386. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
387. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
388. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
389. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
390. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
391. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
392. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
393. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
394. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
395. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
396. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
397. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
398. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
399. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
400. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
401. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
402. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
403. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
404. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
405. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggaagcgcgccgcgcaggcccgcgccgcct Protospacer
.*. *************.******** .
406. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggcggatcgccgcgcaggtgcgcgccgacc Protospacer
.* ************ ******** *
407. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ggaaacgcgccgcgcaggcccgcgccgcct Protospacer
.*. *************.******** .
408. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgcccgcgccgcgcaggaccgcgtcggag Protospacer
. *.************** *****.**..
409. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
410. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaactcgacgcgcaggtccgcgccgatg Protospacer
. * * ** ******************
411. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
412. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
aatttcgcgccgcgcagatccgcgcccgag Protospacer
*. *.************.******** ..
413. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_008441 (Streptomyces laurentii plasmid pSLS DNA, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ctcacgacgccgagcaggcccgcgccgagc Protospacer
* .***** *****.***********
414. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
415. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
416. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cgatccgcgccgcgctgatccgcgcccgcg Protospacer
*.************ *.******** .
417. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
418. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gaggccgcgccgcgcgggtccgccccggat Protospacer
..* ***********.******* ***...
419. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cacccccggccccgcaggtccgcgccgaga Protospacer
. .** *** *****************
420. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
421. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
422. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
423. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaactcgacgcgcaggtccgcgccgatg Protospacer
. * * ** ******************
424. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaactcgacgcgcaggtccgcgccgatg Protospacer
. * * ** ******************
425. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP023713 (Rhodococcus ruber strain YC-YT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaactcgacgcgcaggtccgcgccgatg Protospacer
. * * ** ******************
426. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
427. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
428. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
429. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
430. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgaaatcgccgcgcaggtgcgcgcccagc Protospacer
. * ************ ****** ***
431. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcgcggacggcgcgcaggtccgcgcccagc Protospacer
. *. .** **************** ***
432. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cctacgacgccgagcaggcccgcgccgagc Protospacer
* .***** *****.***********
433. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 8, identity: 0.733
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
cctacgacgccgagcaggcccgcgccgagc Protospacer
* .***** *****.***********
434. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
gattcggcgcccgcacgcagcagggctcgg Protospacer
.******.********* *******
435. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
aacatggcgcctgcatgcagctggtcgacc Protospacer
************.******** * *
436. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP053907 (Hymenobacter sp. BRD67 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
gggccgacgcctgcgcgcagctgggcttgc Protospacer
. .*.*******.************.**
437. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP053907 (Hymenobacter sp. BRD67 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
gggccgacgcctgcgcgcagctgggcttgc Protospacer
. .*.*******.************.**
438. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
aacatggcgcctgcatgcagctggtcgacc Protospacer
************.******** * *
439. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
aacatggcgcctgcatgcagctggtcgacc Protospacer
************.******** * *
440. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
cgagcgtcgcgcacagcgccgcgtcgggcc Protospacer
****************.****. .**
441. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 8, identity: 0.733
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
aggtcgtggcgcacagcgtagcgcacaagc Protospacer
* . *** *********** *******.
442. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022318 (Brachybacterium avium strain VR2415 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
gcgccgtcgcgcgcagcgtcgcgcagctcc Protospacer
.*. ********.************ *
443. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NC_017903 (Escherichia coli Xuzhou21 plasmid pO157_Sal, complete sequence) position: , mismatch: 8, identity: 0.733
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
ttaccgtcctgtaattttgaaagcgctttc Protospacer
.. * ******************.* **
444. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttatcgcgcgcggtgtagacccgctgcc Protospacer
****. *****************. * .
445. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.733
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttatcgcgcgcggtgtagacccgctgcc Protospacer
****. *****************. * .
446. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttatcgcgcgcggtgtagacccgctgcc Protospacer
****. *****************. * .
447. spacer 1.23|1177241|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ggttgacgcgcgcggtgtagaccttggggt CRISPR spacer
ggttatcgcgcgcggtgtagacccgctgcc Protospacer
****. *****************. * .
448. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 8, identity: 0.733
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
gcgaaccgcgatatcgagctgggcgcagac Protospacer
. ************.** ********
449. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
gctgtcggcgatctcgaactcggcgatctg Protospacer
**** ***** ************ *
450. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.733
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
gctgtcggcgatctcgaactcggcgatctg Protospacer
**** ***** ************ *
451. spacer 1.32|1177835|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044329 (Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aatggcgttacgctcgatgacgaaatgctc CRISPR spacer
atgggcgttccgctcgatgacgaacgcgcc Protospacer
* ****** ************** .*
452. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.733
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
cgcgccgcgtagccgaacatgacggctgct Protospacer
* . **.*************** ****
453. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
cgcgccgcgtagccgaacatgacggctgct Protospacer
* . **.*************** ****
454. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.7
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
gctcgttgcgcagcgcgcgatccagccgat Protospacer
. ******.********** *****. .
455. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
gctcgttgcgcagcgcgcgatccagccgat Protospacer
. ******.********** *****. .
456. spacer 1.3|1175921|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
agacgttgcacagcgcgcgaaccagcttgg CRISPR spacer
gctcgttgcgcagcgcgcgatccagccgat Protospacer
. ******.********** *****. .
457. spacer 1.5|1176053|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.7
acacgattcggcgcgtggtcgggcggctga CRISPR spacer
cggtcgtgcggcgcgtgggcgggcggctgg Protospacer
.. .* ********** **********.
458. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 9, identity: 0.7
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gcaagcgtgccgcgcaggcccgcgccgaag Protospacer
. . **.**********.*********.
459. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.7
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
gacgtgacgccgcgcagctcctcgccgagc Protospacer
.. . .********** *** ********
460. spacer 1.6|1176119|30|CP022763|CRISPRCasFinder,CRT matches to MK291444 (Paracoccus phage vB_PthS_Pthi1, complete genome) position: , mismatch: 9, identity: 0.7
aggtccgcgccgcgcaggtccgcgccgagc CRISPR spacer
ttcaccgcgcggcgcaggtccgcgacggtg Protospacer
****** ************* **.
461. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 9, identity: 0.7
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
cacgaaccgcctgcaagccgctgggctcgc Protospacer
. . . ******** ** ***********
462. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP034154 (Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
ggctgagcgcctgcacggagctgggcttgt Protospacer
.*********** *********.*.
463. spacer 1.7|1176185|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 9, identity: 0.7
tcaatggcgcctgcacgcagctgggctcgc CRISPR spacer
ggctgagcgcctgcacggagctgggcttgt Protospacer
.*********** *********.*.
464. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 9, identity: 0.7
agacggacgcagcggcgattgctcgcatga CRISPR spacer
tgacggacgcggcggcgcttgctcttgcat Protospacer
*********.****** ****** ....
465. spacer 1.13|1176580|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 9, identity: 0.7
agacggacgcagcggcgattgctcgcatga CRISPR spacer
tgacggacgcggcggcgcttgctcttgcat Protospacer
*********.****** ****** ....
466. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
ctcttgctccgcacagcgtctcgcacagcg Protospacer
. .*.. *********** *********
467. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KY783914 (Mycobacterium phage GardenSalsa, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
468. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MT658802 (Mycobacterium phage Aziz, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
469. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MF319184 (Mycobacterium phage GenevaB15, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
470. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to MT657341 (Mycobacterium phage Estes, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
471. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to KY223999 (Mycobacterium phage MrMagoo, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
472. spacer 1.14|1176646|30|CP022763|CRISPRCasFinder,CRT matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 9, identity: 0.7
acagcgtcgcgcacagcgtcgcgcacagcg CRISPR spacer
tggatctcgcgcacagtgtcgcggacagcc Protospacer
... **********.****** *****
473. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
474. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
475. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
476. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
477. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
478. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
479. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
480. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
481. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
482. spacer 1.16|1176778|30|CP022763|CRISPRCasFinder,CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
acggctacctgtaattttgaaagcgttgtc CRISPR spacer
tgggttacctgtaattttgaaaggaatact Protospacer
**.****************** . *...
483. spacer 1.21|1177109|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.7
gtacagttcgatggcagcatggtcgacacg CRISPR spacer
ccgccattcgatggcggcatggtcgaccgt Protospacer
..* .*********.***********
484. spacer 1.28|1177571|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 9, identity: 0.7
tatgtccgcgatatcgaactcggcgcagag CRISPR spacer
gatgtccgcgatatcaaactcagcatcact Protospacer
**************.*****.**.. .
485. spacer 1.33|1177901|30|CP022763|CRISPRCasFinder,CRT,PILER-CR matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.667
agaaaggcatagccgaacatgacgcctgcg CRISPR spacer
gtggtggcatagccgaacatgatgccctga Protospacer
. .. *****************.***. .
