Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022780 Ralstonia solanacearum strain SL3822 chromosome, complete genome 1 crisprs WYL,cas3,csa3,DEDDh,DinG 2 2 6 0
CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1 crisprs WYL 0 1 5 0

Results visualization

1. CP022780
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022780_2 3719953-3720265 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022780_2 2.1|3719972|35|CP022780|CRT 3719972-3720006 35 CP022780.1 3716618-3716652 2 0.943
CP022780_2 2.1|3719972|35|CP022780|CRT 3719972-3720006 35 CP022780.1 3717290-3717324 2 0.943
CP022780_2 2.2|3720026|38|CP022780|CRT 3720026-3720063 38 CP022780.1 3716672-3716709 2 0.947
CP022780_2 2.2|3720026|38|CP022780|CRT 3720026-3720063 38 CP022780.1 3717344-3717381 2 0.947
CP022780_2 2.2|3720026|38|CP022780|CRT 3720026-3720063 38 CP022780.1 3718016-3718053 2 0.947
CP022780_2 2.2|3720026|38|CP022780|CRT 3720026-3720063 38 CP022780.1 3718685-3718722 2 0.947
CP022780_2 2.2|3720026|38|CP022780|CRT 3720026-3720063 38 CP022780.1 3719354-3719391 2 0.947

1. spacer 2.1|3719972|35|CP022780|CRT matches to position: 3716618-3716652, mismatch: 2, identity: 0.943

accctagtcgccaatggcggtaacgaccaacttta	CRISPR spacer
accctagtcgctaatggcggtaacgaccagcttta	Protospacer
***********.*****************.*****

2. spacer 2.1|3719972|35|CP022780|CRT matches to position: 3717290-3717324, mismatch: 2, identity: 0.943

accctagtcgccaatggcggtaacgaccaacttta	CRISPR spacer
accctagtcgctaatggcggtaacgaccagcttta	Protospacer
***********.*****************.*****

3. spacer 2.2|3720026|38|CP022780|CRT matches to position: 3716672-3716709, mismatch: 2, identity: 0.947

tccctgcgcatcaacgacaacgccaccgcctctgtcga	CRISPR spacer
tccctgcgtgtcaacgacaacgccaccgcctctgtcga	Protospacer
********..****************************

4. spacer 2.2|3720026|38|CP022780|CRT matches to position: 3717344-3717381, mismatch: 2, identity: 0.947

tccctgcgcatcaacgacaacgccaccgcctctgtcga	CRISPR spacer
tccctgcgtgtcaacgacaacgccaccgcctctgtcga	Protospacer
********..****************************

5. spacer 2.2|3720026|38|CP022780|CRT matches to position: 3718016-3718053, mismatch: 2, identity: 0.947

tccctgcgcatcaacgacaacgccaccgcctctgtcga	CRISPR spacer
tccctgcgcatcaacaacaacgccaccgcctctgccga	Protospacer
***************.******************.***

6. spacer 2.2|3720026|38|CP022780|CRT matches to position: 3718685-3718722, mismatch: 2, identity: 0.947

tccctgcgcatcaacgacaacgccaccgcctctgtcga	CRISPR spacer
tccctgcgcatcaacaacaacgccaccgcctctgccga	Protospacer
***************.******************.***

7. spacer 2.2|3720026|38|CP022780|CRT matches to position: 3719354-3719391, mismatch: 2, identity: 0.947

tccctgcgcatcaacgacaacgccaccgcctctgtcga	CRISPR spacer
tccctgcgcatcaacaacaacgccaccgcctctgccga	Protospacer
***************.******************.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022780_1 1.1|2258546|57|CP022780|CRISPRCasFinder 2258546-2258602 57 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1200220-1200276 0 1.0
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 171477-171508 5 0.844
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 2016115-2016146 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 294232-294263 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 347010-347041 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 628735-628766 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 263925-263956 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 270844-270875 7 0.781
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 382989-383020 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 118315-118346 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 JX042579 Mycobacterium virus MacnCheese, complete genome 1170-1201 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 120464-120495 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 186257-186288 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 158787-158818 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 179268-179299 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 152399-152430 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 64724-64755 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 149614-149645 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 25590-25621 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 638322-638353 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 128680-128711 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 48060-48091 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 40793-40824 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 255316-255347 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 14472-14503 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 124635-124666 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 58171-58202 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 68892-68923 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 259691-259722 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 170248-170279 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 179386-179417 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 95222-95253 8 0.75
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 MK524488 Mycobacterium phage Patt, complete genome 25089-25120 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 340918-340949 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 528488-528519 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 518076-518107 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_012523 Rhodococcus opacus B4 plasmid pKNR, complete sequence 24899-24930 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4233193-4233224 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 483407-483438 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP024936 Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence 419996-420027 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 528525-528556 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 528525-528556 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 528517-528548 9 0.719
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 419523-419554 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 705655-705686 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1234106-1234137 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 898267-898298 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 KY783914 Mycobacterium phage GardenSalsa, complete genome 17575-17606 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 MT658802 Mycobacterium phage Aziz, complete genome 17602-17633 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 MF319184 Mycobacterium phage GenevaB15, complete genome 17602-17633 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 KY223999 Mycobacterium phage MrMagoo, complete genome 17575-17606 10 0.688
CP022780_2 2.3|3720083|32|CP022780|CRT 3720083-3720114 32 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 277342-277373 10 0.688

1. spacer 1.1|2258546|57|CP022780|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

tgggaagcgctgttggcggcgcgcccggacggggcgccctgctccggcagcggaggc	CRISPR spacer
tgggaagcgctgttggcggcgcgcccggacggggcgccctgctccggcagcggaggc	Protospacer
*********************************************************

2. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

accatctccgccgacagcggcaccacctccac	CRISPR spacer
accatctccgccgaccgcggcagcaccagcgc	Protospacer
*************** ****** ****  *.*

3. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acgatcgccgccgacagcggcaccatccgctt	Protospacer
** *** ******************.*. * .

4. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacctccac	CRISPR spacer
accatctccgcggaccgcggcaccgcaagcgc	Protospacer
*********** *** ********.*   *.*

5. spacer 2.3|3720083|32|CP022780|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacctccac	CRISPR spacer
agccttctcgccgcctgcggcaccacctccac	Protospacer
* * *...***** * ****************

6. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacc-tccac	CRISPR spacer
cgcgtctccgccgacacccgcaccaccgtgca-	Protospacer
  *.************ * ******** * ** 

7. spacer 2.3|3720083|32|CP022780|CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacctccac	CRISPR spacer
agcagcagcgccgccagcggcaccaccgccat	Protospacer
* ** *  ***** ************* ***.

8. spacer 2.3|3720083|32|CP022780|CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

accatctccgccgacagcggcaccacctccac	CRISPR spacer
agcagcagcgccgccagcggcaccaccgccat	Protospacer
* ** *  ***** ************* ***.

9. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ggcggcgccgccgacagcggcatcacctccga	Protospacer
. *. * ***************.*******. 

10. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
agcatctccgccaacggcggcaccaccaatgg	Protospacer
* **********.**.***********  .. 

11. spacer 2.3|3720083|32|CP022780|CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcggcgcccgccgacggcggcaccccctccac	Protospacer
.* .. .********.******** *******

12. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

13. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

14. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

15. spacer 2.3|3720083|32|CP022780|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

16. spacer 2.3|3720083|32|CP022780|CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

17. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

18. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

19. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

20. spacer 2.3|3720083|32|CP022780|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgatctccgccgacttcggcaccaccgtgtc	Protospacer
.* ************  ********** .  *

21. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

22. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

23. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

24. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

25. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

26. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

27. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

28. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

29. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

30. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

31. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

32. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ttgaccagcgccgacagcggcaccatctcaac	Protospacer
 . *.*  *****************.*** **

33. spacer 2.3|3720083|32|CP022780|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ggcatctccgccgccggcggcaccacaggcgg	Protospacer
. *********** *.**********   *. 

34. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
aatctcgccgccgacagcggccccaccagcgt	Protospacer
* . ** ************** *****  *..

35. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

36. spacer 2.3|3720083|32|CP022780|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

37. spacer 2.3|3720083|32|CP022780|CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gagaccgccgccgacggcgccaccacctcccg	Protospacer
.  *.* ********.*** **********  

38. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
cccgcctccgccgacagcgtgaccaccttgtg	Protospacer
 **..**************  *******.   

39. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

40. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acgatctccgccgacaccggcacgtcgagatc	Protospacer
** ************* ******  *     *

41. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

42. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

43. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gcgttgcgcgccgacagcggcaccagcaccat	Protospacer
.*  * . ***************** * ***.

44. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acctgctccgccgacagcggcacgcgggcgga	Protospacer
***  ******************     * . 

45. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acctgctccgccgacagcggcacgcgggcgga	Protospacer
***  ******************     * . 

46. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acctgctccgccgacagcggcacgcgggcgga	Protospacer
***  ******************     * . 

47. spacer 2.3|3720083|32|CP022780|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
acctgctccgccgacagcggcacgcgggcgga	Protospacer
***  ******************     * . 

48. spacer 2.3|3720083|32|CP022780|CRT matches to KY783914 (Mycobacterium phage GardenSalsa, complete genome) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ggcatcgccgccgacagcgccaccactagtca	Protospacer
. **** ************ ******.  .  

49. spacer 2.3|3720083|32|CP022780|CRT matches to MT658802 (Mycobacterium phage Aziz, complete genome) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gacatcgccgccgacagcgccaccactagtca	Protospacer
. **** ************ ******.  .  

50. spacer 2.3|3720083|32|CP022780|CRT matches to MF319184 (Mycobacterium phage GenevaB15, complete genome) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gacatcgccgccgacagcgccaccactagtca	Protospacer
. **** ************ ******.  .  

51. spacer 2.3|3720083|32|CP022780|CRT matches to KY223999 (Mycobacterium phage MrMagoo, complete genome) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
ggcatcgccgccgacagcgccaccactagtca	Protospacer
. **** ************ ******.  .  

52. spacer 2.3|3720083|32|CP022780|CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 10, identity: 0.688

accatctccgccgacagcggcaccacctccac	CRISPR spacer
gtgttctccggcgccagcggcaccaccgagcc	Protospacer
..  ****** ** *************    *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 213992 : 227787 18 Acidithiobacillus_phage(75.0%) NA NA
DBSCAN-SWA_2 232251 : 280103 39 uncultured_Caudovirales_phage(20.0%) head,transposase,terminase,capsid,portal,protease NA
DBSCAN-SWA_3 854416 : 919687 58 Lake_Baikal_phage(25.0%) transposase,protease,coat NA
DBSCAN-SWA_4 936693 : 946832 9 Hokovirus(14.29%) NA NA
DBSCAN-SWA_5 2735994 : 2794605 46 Acidithiobacillus_phage(27.78%) transposase NA
DBSCAN-SWA_6 2813281 : 2935056 115 Acidithiobacillus_phage(37.21%) head,transposase,terminase,capsid,portal,integrase,protease attL 2848029:2848088|attR 2914013:2915143
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP022781
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022781_1 625697-625813 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1296637-1296667 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1709809-1709839 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1699564-1699594 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 625740-625770 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 756530-756560 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1410460-1410490 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1589274-1589304 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1334277-1334307 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1417918-1417948 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1127597-1127627 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1377032-1377062 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1304303-1304333 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1429382-1429412 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1428631-1428661 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1428631-1428661 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1428631-1428661 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1428631-1428661 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1428631-1428661 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1335532-1335562 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1316193-1316223 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1368160-1368190 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1408313-1408343 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1428634-1428664 0 1.0
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 483451-483481 1 0.968
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 946133-946163 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1939161-1939191 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 727609-727639 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1714322-1714352 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 855964-855994 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1846214-1846244 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1900102-1900132 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1524951-1524981 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1393675-1393705 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1327667-1327697 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1393675-1393705 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1393675-1393705 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1327689-1327719 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1393679-1393709 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1327689-1327719 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1327689-1327719 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1393674-1393704 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1327689-1327719 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1327689-1327719 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 732687-732717 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1725715-1725745 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 39670-39700 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 300352-300382 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1328204-1328234 2 0.935
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1785170-1785200 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1287424-1287454 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1894969-1894999 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 180304-180334 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 602789-602819 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 882026-882056 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1378361-1378391 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1454273-1454303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 288372-288402 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 571067-571097 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1651339-1651369 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1700596-1700626 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2063755-2063785 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1103922-1103952 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 615642-615672 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1212768-1212798 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 747318-747348 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 819619-819649 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1420558-1420588 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 931126-931156 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1015598-1015628 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1598487-1598517 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 735945-735975 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1343490-1343520 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 845744-845774 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 825157-825187 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1248136-1248166 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1428016-1428046 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1675467-1675497 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 935473-935503 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1090161-1090191 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1137695-1137725 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 654918-654948 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 277238-277268 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 652211-652241 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1090330-1090360 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1126665-1126695 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1387456-1387486 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 648502-648532 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 760275-760305 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 763851-763881 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 992613-992643 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1306618-1306648 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1311062-1311092 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 748728-748758 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1313516-1313546 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 825146-825176 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1248125-1248155 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1439480-1439510 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1686947-1686977 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 935462-935492 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1437843-1437873 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1437843-1437873 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1437843-1437873 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1437843-1437873 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1437843-1437873 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 753119-753149 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1298098-1298128 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1345630-1345660 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 782261-782291 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 862852-862882 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 733815-733845 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1278758-1278788 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1326290-1326320 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 762956-762986 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 843542-843572 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 788943-788973 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1379470-1379500 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 50364-50394 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 824332-824362 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1418411-1418441 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 93523-93553 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 936145-936175 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1664517-1664547 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1437846-1437876 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 308577-308607 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 663665-663695 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1214505-1214535 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 474239-474269 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 784442-784472 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1393356-1393386 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1949260-1949290 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 574598-574628 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 195730-195760 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 943662-943692 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1168517-1168547 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1724421-1724451 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1857942-1857972 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1148381-1148411 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1254978-1255008 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 936522-936552 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1306758-1306788 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 936489-936519 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1306725-1306755 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 813421-813451 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1403773-1403803 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 936490-936520 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 557619-557649 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1305530-1305560 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 719245-719275 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 825834-825864 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 813421-813451 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1403773-1403803 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 936503-936533 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1305567-1305597 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 813421-813451 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1403773-1403803 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 719273-719303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 825857-825887 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 813425-813455 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1402976-1403006 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 936503-936533 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1305567-1305597 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 936492-936522 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1305556-1305586 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 719273-719303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 825857-825887 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 936492-936522 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1305556-1305586 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 719273-719303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 825857-825887 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 813421-813451 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1403772-1403802 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 936486-936516 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 557618-557648 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1306723-1306753 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 719273-719303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 825857-825887 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 719273-719303 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 825857-825887 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 936503-936533 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1305567-1305597 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 936514-936544 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1305578-1305608 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 936492-936522 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 557621-557651 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1305556-1305586 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 722588-722618 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1278492-1278522 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 147381-147411 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1651960-1651990 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1682150-1682180 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1318105-1318135 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1875176-1875206 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 603455-603485 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 603455-603485 3 0.903
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 366595-366625 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1039301-1039331 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1216648-1216678 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1659038-1659068 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1124715-1124745 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1315280-1315310 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 857793-857823 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1031057-1031087 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 968513-968543 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1145860-1145890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1661723-1661753 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 968513-968543 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1145860-1145890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1661723-1661753 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 968513-968543 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1145860-1145890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1661723-1661753 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 968513-968543 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1145860-1145890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1661723-1661753 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 968513-968543 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1145860-1145890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1661723-1661753 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 968515-968545 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1145861-1145891 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1661726-1661756 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 550893-550923 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 826416-826446 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 947130-947160 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1502517-1502547 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1940004-1940034 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1675980-1676010 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 728606-728636 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1277678-1277708 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1715165-1715195 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1451141-1451171 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1562005-1562035 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1848686-1848716 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1902420-1902450 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 95917-95947 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1181911-1181941 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1366933-1366963 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1530039-1530069 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2144089-2144119 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1534162-1534192 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 600175-600205 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 927371-927401 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1394518-1394548 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 562858-562888 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1118237-1118267 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1336878-1336908 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 600175-600205 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 927371-927401 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1394518-1394548 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 562858-562888 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1118237-1118267 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 600175-600205 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 927371-927401 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1394518-1394548 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 562858-562888 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1118237-1118267 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1336900-1336930 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 600179-600209 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 927375-927405 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 562862-562892 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1118241-1118271 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1336900-1336930 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1336900-1336930 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 600175-600205 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 927371-927401 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1394517-1394547 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 562858-562888 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1118236-1118266 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1336900-1336930 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1336900-1336930 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 995868-995898 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 731844-731874 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1169331-1169361 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1724718-1724748 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1591356-1591386 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 297880-297910 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1327361-1327391 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1764814-1764844 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 917664-917694 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 383860-383890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1210531-1210561 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1240444-1240474 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 917664-917694 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 383860-383890 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1210531-1210561 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1240444-1240474 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 95538-95568 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 749451-749481 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1344617-1344647 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 95624-95654 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 752879-752909 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1350776-1350806 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 95629-95659 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 751478-751508 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1347503-1347533 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 96778-96808 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 642089-642119 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1236594-1236624 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1072743-1072773 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 974475-974505 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 974464-974494 4 0.871
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1690351-1690381 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 484389-484419 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1545060-1545090 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1201194-1201224 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 625666-625696 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1410534-1410564 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1417992-1418022 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1127671-1127701 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1429456-1429486 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1335606-1335636 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1316267-1316297 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1368234-1368264 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1408387-1408417 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1083907-1083937 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1812352-1812382 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 135719-135749 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1451478-1451508 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 516030-516060 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 516056-516086 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 402871-402901 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 178320-178350 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 515805-515835 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 515801-515831 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 398686-398716 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 147408-147438 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1682171-1682201 5 0.839
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 193580-193610 6 0.806
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 227097-227127 6 0.806
CP022781_1 1.1|625740|31|CP022781|CRISPRCasFinder 625740-625770 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 240473-240503 6 0.806

1. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

2. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

3. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

4. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

5. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

6. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

7. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

8. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

9. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

10. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

11. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

12. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

13. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

14. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

15. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

16. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

17. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

18. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

19. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

20. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

21. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

22. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

23. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 0, identity: 1.0

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcgatgagcggcttgc	Protospacer
*******************************

24. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatatcgcaatgagcggcttgc	Protospacer
*****************.*************

25. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

26. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

27. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

28. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

29. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

30. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

31. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

32. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

33. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

34. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

35. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

36. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

37. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

38. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

39. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

40. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

41. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

42. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

43. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

44. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

45. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

46. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

47. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

48. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.935

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
tagatgattcatgtcgcaatgagcggcttgc	Protospacer
************.****.*************

49. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

50. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

51. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

52. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

53. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

54. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

55. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

56. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

57. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

58. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

59. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

60. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

61. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

62. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

63. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

64. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

65. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

66. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

67. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

68. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

69. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

70. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

71. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

72. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

73. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

74. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

75. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

76. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

77. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

78. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

79. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

80. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

81. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

82. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

83. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

84. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

85. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

86. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

87. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

88. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

89. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

90. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

91. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

92. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

93. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

94. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

95. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

96. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

97. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

98. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

99. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

100. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

101. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

102. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

103. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

104. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

105. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

106. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

107. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

108. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

109. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

110. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

111. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

112. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

113. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

114. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

115. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

116. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

117. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

118. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

119. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

120. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

121. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

122. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

123. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

124. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

125. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

126. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

127. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

128. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

129. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

130. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

131. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

132. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

133. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

134. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

135. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

136. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

137. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

138. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

139. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

140. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

141. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

142. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

143. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

144. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

145. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

146. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

147. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

148. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

149. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

150. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

151. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

152. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

153. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

154. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

155. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

156. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

157. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

158. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

159. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

160. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

161. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

162. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

163. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

164. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

165. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

166. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

167. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

168. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

169. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

170. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

171. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

172. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

173. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

174. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

175. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

176. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

177. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

178. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

179. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

180. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

181. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

182. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

183. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

184. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

185. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

186. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

187. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

188. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

189. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

190. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

191. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

192. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

193. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

194. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

195. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

196. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

197. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

198. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

199. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

200. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gtcatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

201. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

202. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.903

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgc	Protospacer
   ****************************

203. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

204. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

205. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

206. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

207. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

208. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

209. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

210. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

211. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

212. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

213. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

214. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

215. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

216. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

217. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

218. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

219. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

220. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

221. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

222. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

223. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

224. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

225. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

226. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

227. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

228. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

229. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgt	Protospacer
   ***************************.

230. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

231. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

232. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

233. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

234. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

235. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

236. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

237. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

238. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

239. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

240. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

241. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

242. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

243. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

244. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

245. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

246. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

247. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

248. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

249. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

250. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

251. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

252. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

253. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

254. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

255. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

256. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

257. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

258. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

259. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

260. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

261. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

262. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

263. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

264. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

265. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

266. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

267. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

268. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

269. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

270. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

271. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

272. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

273. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

274. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

275. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

276. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

277. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

278. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

279. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

280. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

281. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

282. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

283. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

284. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

285. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

286. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

287. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

288. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

289. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

290. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

291. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

292. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgc	Protospacer
   ********************.*******

293. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

294. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgt	Protospacer
   ***************************.

295. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

296. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

297. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgt	Protospacer
   ***************************.

298. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

299. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

300. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgt	Protospacer
   ***************************.

301. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

302. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

303. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagcggcttgt	Protospacer
   ***************************.

304. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgctgagcggcttgc	Protospacer
   *************** ************

305. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagcggcttgc	Protospacer
   **************.*************

306. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgccatgagcggcttgc	Protospacer
   ************** *************

307. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgccatgagcggcttgc	Protospacer
   ************** *************

308. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgccatgagcggcttgc	Protospacer
   ************** *************

309. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
ccatggattcatatcgcgatgagcggcttgc	Protospacer
. .  **************************

310. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

311. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

312. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

313. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

314. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

315. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

316. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

317. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

318. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

319. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

320. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

321. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

322. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

323. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

324. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

325. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcttgt	Protospacer
   ********************.******.

326. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

327. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

328. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

329. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

330. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

331. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

332. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

333. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

334. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcgatgagtggcctgc	Protospacer
   ********************.***.***

335. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagtggcttgt	Protospacer
   **************.*****.******.

336. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagtggcttgt	Protospacer
   **************.*****.******.

337. spacer 1.1|625740|31|CP022781|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

tagatgattcatatcgcgatgagcggcttgc	CRISPR spacer
gccatgattcatatcgcaatgagtggcttgt	Protospacer
   **************.*****.******.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 565547 : 625722 54 Ralstonia_phage(22.22%) holin,transposase NA
DBSCAN-SWA_2 887807 : 899017 15 Ralstonia_phage(92.31%) integrase,transposase NA
DBSCAN-SWA_3 1100692 : 1154439 41 uncultured_Caudovirales_phage(33.33%) plate,transposase NA
DBSCAN-SWA_4 1468722 : 1478799 12 Acidithiobacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 1521894 : 1531502 7 Burkholderia_virus(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage