Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032099 Arcobacter skirrowii CCUG 10374 chromosome, complete genome 2 crisprs cas4,PrimPol,RT,cas9,csx20,csx23,cas6,cas10,csm3gr7,csx10gr5,csx19,csx1,cas2,cas1,WYL,DEDDh,cas3 0 4 2 0

Results visualization

1. CP032099
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032099_1 833189-833712 TypeIII NA
7 spacers
cas2,cas1,csx1,csm3gr7,csx19,csx10gr5,cas10,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032099_2 834111-834648 TypeIII NA
7 spacers
cas2,cas1,csx1,csm3gr7,csx19,csx10gr5,cas10,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032099_1 1.7|833642|34|CP032099|CRISPRCasFinder,CRT 833642-833675 34 MN694805 Marine virus AFVG_250M201, complete genome 14306-14339 7 0.794
CP032099_2 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR 834219-834254 36 NZ_CP015634 Borrelia turicatae strain BTE5EL plasmid lp40 36983-37018 7 0.806
CP032099_1 1.1|833225|33|CP032099|CRISPRCasFinder,CRT 833225-833257 33 MN692961 Marine virus AFVG_117M41, complete genome 24320-24352 8 0.758
CP032099_2 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR 834219-834254 36 NC_011255 Borrelia recurrentis A1 plasmid pl35, complete sequence 34113-34148 8 0.778
CP032099_2 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR 834219-834254 36 NC_011255 Borrelia recurrentis A1 plasmid pl35, complete sequence 1245-1280 8 0.778
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 MN694719 Marine virus AFVG_250M42, complete genome 20345-20379 8 0.771
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 MN694070 Marine virus AFVG_250M43, complete genome 19397-19431 8 0.771
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 MN693285 Marine virus AFVG_25M368, complete genome 51160-51194 8 0.771
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 NZ_CP043635 Empedobacter brevis strain SE1-3 plasmid pSE1-3-9kb, complete sequence 4060-4094 9 0.743
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 NZ_CP043636 Empedobacter brevis strain SE1-3 plasmid pSE1-3-20kb, complete sequence 13079-13113 9 0.743
CP032099_2 2.7|834578|35|CP032099|CRISPRCasFinder,CRT 834578-834612 35 MN694386 Marine virus AFVG_250M1120, complete genome 6057-6091 10 0.714

1. spacer 1.7|833642|34|CP032099|CRISPRCasFinder,CRT matches to MN694805 (Marine virus AFVG_250M201, complete genome) position: , mismatch: 7, identity: 0.794

aatattctttaaaggctctactgataagaacttt	CRISPR spacer
aatattctttaaagtctcttctgatatatcctta	Protospacer
************** **** ****** .  *** 

2. spacer 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015634 (Borrelia turicatae strain BTE5EL plasmid lp40) position: , mismatch: 7, identity: 0.806

aataactcttcttcatcacaatcatctttatcatag	CRISPR spacer
ttttcctcttcttcatcataatcatcattatcatat	Protospacer
  *  *************.******* ******** 

3. spacer 1.1|833225|33|CP032099|CRISPRCasFinder,CRT matches to MN692961 (Marine virus AFVG_117M41, complete genome) position: , mismatch: 8, identity: 0.758

atagctttttcgttatttattactatcatttaa	CRISPR spacer
atagcttttacgttatttattgcttggtctgaa	Protospacer
********* ***********.**    .* **

4. spacer 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR matches to NC_011255 (Borrelia recurrentis A1 plasmid pl35, complete sequence) position: , mismatch: 8, identity: 0.778

aataactcttcttcatcacaatcatctttatcatag	CRISPR spacer
ctctcctcttcttcatcatattcatctttatcatat	Protospacer
  .  *************.* ************** 

5. spacer 2.2|834219|36|CP032099|CRISPRCasFinder,CRT,PILER-CR matches to NC_011255 (Borrelia recurrentis A1 plasmid pl35, complete sequence) position: , mismatch: 8, identity: 0.778

aataactcttcttcatcacaatcatctttatcatag	CRISPR spacer
ctctcctcttcttcatcatattcatctttatcatat	Protospacer
  .  *************.* ************** 

6. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to MN694719 (Marine virus AFVG_250M42, complete genome) position: , mismatch: 8, identity: 0.771

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
gttcgtatccctttttttggtttgttctagtgttt	Protospacer
 .*.******.************ ***** * * *

7. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to MN694070 (Marine virus AFVG_250M43, complete genome) position: , mismatch: 8, identity: 0.771

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
gttcgtatccctttttttggtttgttctagtgttt	Protospacer
 .*.******.************ ***** * * *

8. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to MN693285 (Marine virus AFVG_25M368, complete genome) position: , mismatch: 8, identity: 0.771

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
tcttgtatccttttctttggtctttctctatcttt	Protospacer
**************.******.***...  *** *

9. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to NZ_CP043635 (Empedobacter brevis strain SE1-3 plasmid pSE1-3-9kb, complete sequence) position: , mismatch: 9, identity: 0.743

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
aatggctttcttttttttcgttttttcttttctaa	Protospacer
  * *. *.********* ********* ***** 

10. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to NZ_CP043636 (Empedobacter brevis strain SE1-3 plasmid pSE1-3-20kb, complete sequence) position: , mismatch: 9, identity: 0.743

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
aatggctttcttttttttcgttttttcttttctaa	Protospacer
  * *. *.********* ********* ***** 

11. spacer 2.7|834578|35|CP032099|CRISPRCasFinder,CRT matches to MN694386 (Marine virus AFVG_250M1120, complete genome) position: , mismatch: 10, identity: 0.714

tcttgtatccttttttttggttttttctattctat	CRISPR spacer
gcttgtatcctttctcttggttttttaaatatagg	Protospacer
 ************.*.**********  ** . . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 702150 : 760723 51 Escherichia_phage(33.33%) transposase,plate,integrase attL 694951:694968|attR 741507:741524
DBSCAN-SWA_2 1098205 : 1104432 8 Enterobacteria_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage