CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
CP025307	Burkholderia pseudomallei strain D286 chromosome 2, complete sequence	3 crisprs	NA	2	1	0	0
CP025306	Burkholderia pseudomallei strain D286 chromosome 1, complete sequence	2 crisprs	NA	1	3	0	0

Cas Category Instructions

Results visualization

1. CP025307

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP025307_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP025307_1

304048-304154

Orphan

Consensus_repeat	Method
GCAACAGCAACAGCAACAGCAAC	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP025307_1

>merge|CP025307|1|304048-304154|CRISPRCasFinder
GCTACCGCTACCGCCACGGCATCGACATCGACTCTGGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAAC

>CP025307|1|1|304048-304154|CRISPRCasFinder
GCTACCGCTACCGCCACGGCATC	GACATCGACTCTGGCAACA
GCAACAGCAACAGCAACAGCAAC	AGCAACAGCAACAGCAACA
GCAACAGCAACAGCAACAGCAAC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP025307_2

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP025307_2

2601977-2602069

Orphan

Consensus_repeat	Method
GCGCGTCGGCGCGCGCGGCGGCGA	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP025307_2

>merge|CP025307|2|2601977-2602069|CRISPRCasFinder
GCGCGTCGGCGCGCGCGGCGGCGATCAGCCGCTCGCGCTCGGCGGCGGCCTGCGCGAGCGCGTCCTTCAGCGCGTCGTCGCGCGCGGCGGCGA

>CP025307|2|2|2601977-2602069|CRISPRCasFinder
GCGCGTCGGCGCGCGCGGCGGCGA	TCAGCCGCTCGCGCTCGGCGGCGGCCTGCGCGAGCGCGTCCTTCA
GCGCGTCGTCGCGCGCGGCGGCGA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP025307_3

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP025307_3

3008484-3008629

Orphan

Consensus_repeat	Method
GCAGAGGCGCCGCCGCCGGAATACCCGATCATCGGGATGCTCGATCGCCGAAG	PILER-CR
CGGAATGCCCGATCATCGGGATGC	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP025307_3

>merge|CP025307|3|3008484-3008629|PILER-CR,CRISPRCasFinder
TCGTCGGGATGCTCGATTGCCGCAGTCACCCTCCGCCGGGGCTCCGTCGTCGGAATGCCCGATCATCGGGATGCCTGCTCGCCGAAGCACTCCACCGCAGAGGCGCCGCCGCCGGAATACCCGATCATCGGGATGCTCGATCGCCG

>CP025307|3|1|3008484-3008629|PILER-CR
TCGTCGGGATGCTCGATTGCCGCAGTCACCCTCCGCCGGGGCTCCGTCGTCGGAA	TGCCCGAT
CATCGGGATGCCTGCTCGCCGAAGCACTCCACCGCAGAGGCGCCGCCGCCGGAAT	ACCCGATCA
TCGGGATGCTCGATCGCCG

>CP025307|3|3|3008534-3008619|CRISPRCasFinder
CGGAATGCCCGATCATCGGGATGC	CTGCTCGCCGAAGCACTCCACCGCAGAGGCGCCGCCGC
CGGAATACCCGATCATCGGGATGC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP025307_1	1.1\|304071\|19\|CP025307\|CRISPRCasFinder	304071-304089	19	CP025307.1	271854-271872	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025306.1	1244998-1245016	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025306.1	1785139-1785157	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	243382-243400	1	0.947
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	2198760-2198778	1	0.947
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	243376-243394	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	319724-319742	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	2182036-2182054	2	0.895
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	CP025307.1	2188645-2188663	2	0.895

1. spacer 1.1|304071|19|CP025307|CRISPRCasFinder matches to position: 271854-271872, mismatch: 2, identity: 0.895

gacatcgactctggcaaca	CRISPR spacer
gatatcgactcgggcaaca	Protospacer
**.******** *******

2. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 1244998-1245016, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcagcagcaacagcagca	Protospacer
****.***********.**

3. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 1785139-1785157, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacgacaaca	Protospacer
************..*****

4. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 243382-243400, mismatch: 1, identity: 0.947

agcaacagcaacagcaaca	CRISPR spacer
agcaacatcaacagcaaca	Protospacer
******* ***********

5. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 2198760-2198778, mismatch: 1, identity: 0.947

agcaacagcaacagcaaca	CRISPR spacer
agcaacggcaacagcaaca	Protospacer
******.************

6. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 243376-243394, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcagcagcaacatcaaca	Protospacer
****.******** *****

7. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 319724-319742, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcaacagccacagcgaca	Protospacer
********* *****.***

8. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 2182036-2182054, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcaacggcaacagcgaca	Protospacer
******.********.***

9. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to position: 2188645-2188663, mismatch: 2, identity: 0.895

agcaacagcaacagcaaca	CRISPR spacer
agcagcggcaacagcaaca	Protospacer
****.*.************

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Identity
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MN310371	Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence	27121-27139	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NC_007974	Cupriavidus metallidurans CH34 megaplasmid, complete sequence	542380-542398	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NC_019739	Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence	134011-134029	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	29614-29632	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	29620-29638	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP047963	Aeromonas media strain MC64 plasmid pMC64A, complete sequence	29626-29644	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482874-482892	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482880-482898	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482886-482904	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482892-482910	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482898-482916	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482904-482922	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482910-482928	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482916-482934	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482922-482940	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482928-482946	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482934-482952	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482940-482958	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482946-482964	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482952-482970	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482958-482976	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482964-482982	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482970-482988	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482976-482994	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045356	Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence	482982-483000	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482539-482557	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482545-482563	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482551-482569	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482557-482575	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482563-482581	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482569-482587	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482575-482593	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482581-482599	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482587-482605	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482593-482611	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482599-482617	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482605-482623	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045339	Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence	482611-482629	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NC_022739	Pseudomonas sp. VLB120 plasmid pSTY, complete sequence	74287-74305	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_AP018257	Calothrix sp. NIES-4071 plasmid plasmid2 DNA, complete genome	110215-110233	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MT446413	UNVERIFIED: Escherichia virus TH42, complete genome	54517-54535	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MK977714	Corynebacterium phage Bran, complete genome	34907-34925	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG748548	Escherichia phage EP335, complete genome	24351-24369	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	KY398841	Escherichia phage vB_Ecos_CEB_EC3a, complete genome	29156-29174	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MH925093	UNVERIFIED: Vibrio phage VspDsh_1, complete genome	7613-7631	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MN781674	Escherichia phage vB_EcoS_XY3, complete genome	33232-33250	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MN856055	Myoviridae sp. isolate 330, complete genome	26769-26787	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NC_023593	Escherichia phage KBNP1711, complete genome	24335-24353	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MN855720	Siphoviridae sp. isolate 41, complete genome	6803-6821	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243381-243399	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243387-243405	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243393-243411	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243399-243417	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243405-243423	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243411-243429	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243417-243435	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP049914	Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence	243423-243441	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022775	Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence	69041-69059	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022775	Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence	69047-69065	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022775	Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence	1973213-1973231	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045351	Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence	1175616-1175634	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045351	Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence	1175622-1175640	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045351	Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence	1175628-1175646	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045351	Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence	1175634-1175652	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP045351	Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence	1175640-1175658	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093548-1093566	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093554-1093572	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093560-1093578	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093566-1093584	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093572-1093590	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093578-1093596	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093584-1093602	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093590-1093608	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093596-1093614	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093602-1093620	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093608-1093626	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093614-1093632	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093620-1093638	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093626-1093644	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093632-1093650	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093638-1093656	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093644-1093662	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093650-1093668	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046163	Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence	1093656-1093674	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_AP021845	Azospira sp. I09 plasmid pAZI09, complete sequence	296518-296536	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046333	Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3	504853-504871	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP016284	Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence	54914-54932	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP016284	Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence	54920-54938	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP016284	Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence	54926-54944	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP016284	Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence	54932-54950	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP016284	Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence	54938-54956	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276934-1276952	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276940-1276958	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276946-1276964	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276952-1276970	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276958-1276976	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276964-1276982	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276970-1276988	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276976-1276994	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276982-1277000	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276988-1277006	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1276994-1277012	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277000-1277018	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277006-1277024	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277012-1277030	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277018-1277036	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277024-1277042	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277030-1277048	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277036-1277054	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277042-1277060	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046066	Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence	1277048-1277066	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	86274-86292	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	86280-86298	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624548-624566	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624554-624572	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624560-624578	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624566-624584	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624572-624590	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624578-624596	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624584-624602	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624590-624608	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP046573	Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence	624596-624614	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP020556	Streptomyces sp. Sge12 plasmid pSGE, complete sequence	48661-48679	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022764	Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence	69053-69071	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022764	Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence	69059-69077	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022764	Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence	1973404-1973422	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022797	Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence	69053-69071	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022797	Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence	69059-69077	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022797	Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence	1973402-1973420	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP029828	Burkholderia sp. JP2-270 plasmid p2, complete sequence	138563-138581	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022758	Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence	69051-69069	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022758	Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence	69057-69075	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	NZ_CP022758	Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence	1973366-1973384	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592572	Vibrio phage 1.201.B._10N.286.55.F1, partial genome	41785-41803	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592572	Vibrio phage 1.201.B._10N.286.55.F1, partial genome	41791-41809	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592472	Vibrio phage 1.100.O._10N.261.45.C3, partial genome	41637-41655	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MN693716	Marine virus AFVG_250M838, complete genome	25025-25043	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592461	Vibrio phage 1.086.O._10N.222.51.F8, partial genome	40679-40697	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592611	Vibrio phage 1.246.O._10N.261.54.E10, partial genome	37899-37917	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592611	Vibrio phage 1.246.O._10N.261.54.E10, partial genome	37905-37923	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592611	Vibrio phage 1.246.O._10N.261.54.E10, partial genome	37911-37929	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592611	Vibrio phage 1.246.O._10N.261.54.E10, partial genome	37917-37935	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592611	Vibrio phage 1.246.O._10N.261.54.E10, partial genome	37923-37941	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MT446407	UNVERIFIED: Escherichia virus TH34, complete genome	65176-65194	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MT446414	UNVERIFIED: Escherichia virus TH43, complete genome	23132-23150	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592542	Vibrio phage 1.175.O._10N.261.55.B3, partial genome	39875-39893	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592526	Vibrio phage 1.158.O._10N.261.45.E12, partial genome	39475-39493	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592454	Vibrio phage 1.079.O._10N.286.45.E9, partial genome	28459-28477	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MT135025	Vibrio phage V07, complete genome	289883-289901	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MK962636	Achromobacter phage vB_AxyS_19-32_Axy19, complete genome	2103-2121	1.0
CP025307_1	1.2\|304113\|19\|CP025307\|CRISPRCasFinder	304113-304131	19	MG592590	Vibrio phage 1.223.O._10N.261.48.A9, partial genome	40855-40873	1.0

1. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

2. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

3. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

4. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP047963 (Aeromonas media strain MC64 plasmid pMC64A, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

5. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP047963 (Aeromonas media strain MC64 plasmid pMC64A, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

6. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP047963 (Aeromonas media strain MC64 plasmid pMC64A, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

7. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

8. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

9. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

10. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

11. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

12. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

13. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

14. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

15. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

16. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

17. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

18. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

19. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

20. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

21. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

22. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

23. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

24. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

25. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

26. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

27. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

28. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

29. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

30. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

31. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

32. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

33. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

34. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

35. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

36. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

37. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

38. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

39. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NC_022739 (Pseudomonas sp. VLB120 plasmid pSTY, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

40. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_AP018257 (Calothrix sp. NIES-4071 plasmid plasmid2 DNA, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

41. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MT446413 (UNVERIFIED: Escherichia virus TH42, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

42. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

43. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG748548 (Escherichia phage EP335, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

44. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to KY398841 (Escherichia phage vB_Ecos_CEB_EC3a, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

45. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MH925093 (UNVERIFIED: Vibrio phage VspDsh_1, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

46. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

47. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MN856055 (Myoviridae sp. isolate 330, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

48. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NC_023593 (Escherichia phage KBNP1711, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

49. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MN855720 (Siphoviridae sp. isolate 41, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

50. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

51. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

52. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

53. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

54. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

55. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

56. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

57. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

58. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

59. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

60. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

61. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

62. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

63. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

64. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

65. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

66. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

67. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

68. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

69. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

70. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

71. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

72. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

73. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

74. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

75. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

76. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

77. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

78. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

79. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

80. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

81. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

82. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

83. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

84. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

85. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

86. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

87. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

88. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

89. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

90. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

91. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

92. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

93. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

94. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

95. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

96. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

97. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

98. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

99. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

100. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

101. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

102. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

103. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

104. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

105. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

106. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

107. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

108. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

109. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

110. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

111. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

112. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

113. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

114. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

115. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

116. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

117. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

118. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

119. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

120. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

121. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

122. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

123. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

124. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

125. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

126. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

127. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

128. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

129. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

130. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

131. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

132. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

133. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

134. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592572 (Vibrio phage 1.201.B._10N.286.55.F1, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

135. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592572 (Vibrio phage 1.201.B._10N.286.55.F1, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

136. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592472 (Vibrio phage 1.100.O._10N.261.45.C3, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

137. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MN693716 (Marine virus AFVG_250M838, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

138. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592461 (Vibrio phage 1.086.O._10N.222.51.F8, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

139. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

140. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

141. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

142. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

143. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592611 (Vibrio phage 1.246.O._10N.261.54.E10, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

144. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MT446407 (UNVERIFIED: Escherichia virus TH34, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

145. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MT446414 (UNVERIFIED: Escherichia virus TH43, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

146. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592542 (Vibrio phage 1.175.O._10N.261.55.B3, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

147. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592526 (Vibrio phage 1.158.O._10N.261.45.E12, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

148. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592454 (Vibrio phage 1.079.O._10N.286.45.E9, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

149. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MT135025 (Vibrio phage V07, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

150. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MK962636 (Achromobacter phage vB_AxyS_19-32_Axy19, complete genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

151. spacer 1.2|304113|19|CP025307|CRISPRCasFinder matches to MG592590 (Vibrio phage 1.223.O._10N.261.48.A9, partial genome) position: , mismatch: 0, identity: 1.0

agcaacagcaacagcaaca	CRISPR spacer
agcaacagcaacagcaaca	Protospacer
*******************

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

2. CP025306

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP025306_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP025306_1

282899-283027

Orphan

Consensus_repeat	Method
GGCTGATCGAAGTGGCTGATCGAAG	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP025306_1

>merge|CP025306|1|282899-283027|CRISPRCasFinder
GGCGGATCGAGGCGGCTCATCGAAGCGATCAATCGAAGCGATCAATCGAAGCGGCCGATCGAAGCGGCTGATCGAAGTGGCTGATCGAAGTGGCTGATCGAAGTGGCTGATCGAAGTGGCTGATCGAAG

>CP025306|1|1|282899-283027|CRISPRCasFinder
GGCGGATCGAGGCGGCTCATCGAAG	CGATCAATCGAAGCGATCAATCGAAGC
GGCCGATCGAAGCGGCTGATCGAAG	TGGCTGATCGAAGTGGCTGATCGAAGT
GGCTGATCGAAGTGGCTGATCGAAG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP025306_2

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP025306_2

1637250-1637362

Orphan

Consensus_repeat	Method
CAAGCACGACAAGCACGACAAGC	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP025306_2

>merge|CP025306|2|1637250-1637362|CRISPRCasFinder
CAAACGCGGCGAGCGCGGCAAACGAGACCAACGCGGTGAGCATTGCAAGCACGACAAGCACGACAAGCACGACAAGCACGACAAGCACGACAAGCACGACAAGCATGACAAGC

>CP025306|2|2|1637250-1637362|CRISPRCasFinder
CAAACGCGGCGAGCGCGGCAAAC	GAGACCAACGCGGTGAGCATTG
CAAGCACGACAAGCACGACAAGC	ACGACAAGCACGACAAGCACGA
CAAGCACGACAAGCATGACAAGC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025306.1	1637345-1637366	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	974480-974501	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345182-1345203	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345191-1345212	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345200-1345221	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345209-1345230	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345218-1345239	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345227-1345248	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345236-1345257	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345245-1345266	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345254-1345275	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345263-1345284	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345272-1345293	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345281-1345302	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1345290-1345311	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP025307.1	1783018-1783039	2	0.909

1. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1637345-1637366, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacaagcatgacaagcatga	Protospacer
**********.********.**

2. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 974480-974501, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acggcaagcacggcaagcacga	Protospacer
***.********.*********

3. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345182-1345203, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

4. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345191-1345212, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

5. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345200-1345221, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

6. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345209-1345230, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

7. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345218-1345239, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

8. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345227-1345248, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

9. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345236-1345257, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

10. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345245-1345266, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

11. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345254-1345275, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacatgcacga	Protospacer
****** ******** ******

12. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345263-1345284, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacatgcacgacacgcacga	Protospacer
****** ******** ******

13. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345272-1345293, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

14. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345281-1345302, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

15. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1345290-1345311, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacacgcacgacacgcacga	Protospacer
****** ******** ******

16. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to position: 1783018-1783039, mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
acgacaagcaccgcaagcacga	Protospacer
*********** .*********

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013598	Rhizobium sp. N741 plasmid pRspN741c, complete sequence	71759-71780	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013561	Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence	72312-72333	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013502	Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence	71683-71704	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013508	Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence	71759-71780	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013519	Rhizobium sp. N113 plasmid pRspN113b, complete sequence	71760-71781	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013492	Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence	71757-71778	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013514	Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence	72311-72332	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013497	Rhizobium sp. N621 plasmid pRspN621b, complete sequence	71757-71778	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013592	Rhizobium sp. N871 plasmid pRspN871b, complete sequence	71683-71704	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NC_010996	Rhizobium etli CIAT 652 plasmid pB, complete sequence	69522-69543	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	NZ_CP013604	Rhizobium sp. N731 plasmid pRspN731c, complete sequence	72311-72332	2	0.909
CP025306_2	2.2\|1637318\|22\|CP025306\|CRISPRCasFinder	1637318-1637339	22	CP006880	Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence	1567061-1567082	2	0.909
CP025306_1	1.2\|282976\|27\|CP025306\|CRISPRCasFinder	282976-283002	27	NZ_CP054621	Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence	1015989-1016015	4	0.852
CP025306_1	1.2\|282976\|27\|CP025306\|CRISPRCasFinder	282976-283002	27	NZ_CP005085	Sphingobium sp. TKS plasmid pTK1, complete sequence	490950-490976	5	0.815
CP025306_1	1.2\|282976\|27\|CP025306\|CRISPRCasFinder	282976-283002	27	NC_009508	Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence	79837-79863	5	0.815
CP025306_1	1.1\|282924\|27\|CP025306\|CRISPRCasFinder	282924-282950	27	NC_010865	Sinorhizobium meliloti plasmid pSmeSM11b, complete sequence	127776-127802	6	0.778
CP025306_1	1.1\|282924\|27\|CP025306\|CRISPRCasFinder	282924-282950	27	NZ_CP021216	Sinorhizobium meliloti RU11/001 plasmid pSmeRU11d, complete sequence	157384-157410	6	0.778
CP025306_1	1.1\|282924\|27\|CP025306\|CRISPRCasFinder	282924-282950	27	NC_008271	Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence	31326-31352	7	0.741

1. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

2. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

3. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

4. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

5. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

6. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

7. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

8. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

9. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

10. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

11. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
tcgacaagcacgacaagcacta	Protospacer
 ******************* *

12. spacer 2.2|1637318|22|CP025306|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.909

acgacaagcacgacaagcacga	CRISPR spacer
ccgccaagcacgacaagcacga	Protospacer
 ** ******************

13. spacer 1.2|282976|27|CP025306|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.852

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
gggctgatcgaaggggttgatcgaagg	Protospacer
 ************ **.*********

14. spacer 1.2|282976|27|CP025306|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
tggctgatcgaagtggatgttcgcggg	Protospacer
**************** ** *** .*

15. spacer 1.2|282976|27|CP025306|CRISPRCasFinder matches to NC_009508 (Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence) position: , mismatch: 5, identity: 0.815

tggctgatcgaagtggctgatcgaagt	CRISPR spacer
tggctgatcgaagtggatgttcgcggg	Protospacer
**************** ** *** .*

16. spacer 1.1|282924|27|CP025306|CRISPRCasFinder matches to NC_010865 (Sinorhizobium meliloti plasmid pSmeSM11b, complete sequence) position: , mismatch: 6, identity: 0.778

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gtagatgtcgaagcgatcaatcgaagc	Protospacer
  *   .********************

17. spacer 1.1|282924|27|CP025306|CRISPRCasFinder matches to NZ_CP021216 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11d, complete sequence) position: , mismatch: 6, identity: 0.778

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gtagatgtcgaagcgatcaatcgaagc	Protospacer
  *   .********************

18. spacer 1.1|282924|27|CP025306|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741

cgatcaatcgaagcgatcaatcgaagc	CRISPR spacer
gcgctgatcgaagcgatcaatcgaatc	Protospacer
  ....******************* *

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage