1. spacer 6.2|2003928|31|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
-ttgttgggtgcggtttaggtcctctgggtga CRISPR spacer
gccgct-ggtgcggttcaggtcctatgggtat Protospacer
..*.* *********.******* *****.
2. spacer 4.1|1393739|34|CP032152|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 9, identity: 0.735
tggtgaacagttggtgtttgccgcgaccgctgag CRISPR spacer
tacctggtcgttggtgtttgccgcgagcgctgag Protospacer
*. . ... ***************** *******
3. spacer 4.17|1394899|33|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP054911 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
tatttccgcatcatattgatgcagataaagtat CRISPR spacer
attttccgcatcatatagatacagataagcagc Protospacer
************** ***.*******. ..
4. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP021676 (Lactobacillus brevis strain SRCM101106 plasmid pLB1106-4 sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
5. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP032750 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
6. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP021473 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-3, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
7. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP016631 (Lactobacillus plantarum strain LY-78 plasmid pLY7801, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatatatat Protospacer
.******** ****** *********. * .*
8. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP045731 (Lactobacillus gastricus strain LG045 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaataatata Protospacer
.******** ****** *********. * *
9. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP046039 (Lactobacillus sakei strain CBA3614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
10. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NC_024984 (Lactobacillus plantarum subsp. plantarum strain Zhang-11 plasmid pZL3, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
11. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_AP017933 (Lactobacillus sakei strain LK-145 plasmid pLs145-b, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
12. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NC_017018 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-7, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
13. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP019716 (Lactobacillus plantarum strain Q7 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
14. spacer 5.5|1874937|34|CP032152|CRISPRCasFinder,CRT matches to NZ_CP019740 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-6, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
15. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP021676 (Lactobacillus brevis strain SRCM101106 plasmid pLB1106-4 sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
16. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP032750 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
17. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP021473 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-3, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
18. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP016631 (Lactobacillus plantarum strain LY-78 plasmid pLY7801, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatatatat Protospacer
.******** ****** *********. * .*
19. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP045731 (Lactobacillus gastricus strain LG045 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaataatata Protospacer
.******** ****** *********. * *
20. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP046039 (Lactobacillus sakei strain CBA3614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
21. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NC_024984 (Lactobacillus plantarum subsp. plantarum strain Zhang-11 plasmid pZL3, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
22. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_AP017933 (Lactobacillus sakei strain LK-145 plasmid pLs145-b, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
23. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NC_017018 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-7, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
24. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP019716 (Lactobacillus plantarum strain Q7 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
25. spacer 5.28|1874938|34|CP032152|PILER-CR matches to NZ_CP019740 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-6, complete sequence) position: , mismatch: 9, identity: 0.735
agctttttaatttgacgttggtataaggcttcaa CRISPR spacer
ggctttttattttgactttggtataaatgtatat Protospacer
.******** ****** *********. * .*
26. spacer 1.10|5087|35|CP032152|PILER-CR,CRISPRCasFinder,CRT matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.714
acggaggcagagtggcaggcggctgttcaaaaaga CRISPR spacer
gcctgggccgagtggcatgcggctgttcaacatag Protospacer
.* .*** ******** ************ * ..
27. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020577 (Acinetobacter baumannii strain SSA12 plasmid pSSA12_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
28. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012008 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
29. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP033518 (Acinetobacter baumannii strain 2008S11-069 plasmid p2008S11-069-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
30. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016302 (Acinetobacter baumannii strain CMC-CR-MDR-Ab66 plasmid pCMCVTAb2-Ab66, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
31. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033857 (Acinetobacter sp. FDAARGOS_493 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
32. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008851 (Acinetobacter baumannii strain AC29 plasmid pAC29b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
33. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023033 (Acinetobacter baumannii strain 7847 plasmid pAba7847b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
34. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP014292 (Acinetobacter baumannii strain AB34299 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
35. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027121 (Acinetobacter baumannii strain AR_0056 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
36. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020580 (Acinetobacter baumannii strain SSMA17 plasmid pSSMA17_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
37. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015366 (Acinetobacter baumannii strain 3207 plasmid pAba3207b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
38. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017645 (Acinetobacter baumannii strain KAB02 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
39. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020573 (Acinetobacter baumannii strain 15A5 plasmid p15A5_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
40. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020582 (Acinetobacter baumannii strain JBA13 plasmid pJBA13_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
41. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026712 (Acinetobacter baumannii strain AR_0063 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
42. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017647 (Acinetobacter baumannii strain KAB03 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
43. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026706 (Acinetobacter baumannii strain AR_0056 plasmid tig00000059_pilon, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
44. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033245 (Acinetobacter baumannii strain 7835 plasmid pAba7835b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
45. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021787 (Acinetobacter baumannii strain A85 plasmid pA85-3, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
46. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG954379 (Acinetobacter baumannii strain SGH0905 plasmid pS32-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
47. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023028 (Acinetobacter baumannii strain 10042 plasmid pAba10042b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
48. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to MK531538 (Acinetobacter baumannii strain MC23 plasmid pMC23.1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
49. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027243 (Acinetobacter baumannii strain WCHAB005078 plasmid p1_005078, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
50. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY022424 (Acinetobacter baumannii strain Ab8098 plasmid pAb8098, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
51. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035052 (Acinetobacter baumannii strain ABUH763 plasmid p74.1Kbp, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
52. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017657 (Acinetobacter baumannii strain KAB08 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
53. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NC_025111 (Acinetobacter baumannii strain D72 plasmid pD72-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
54. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KF889012 (Acinetobacter baumannii TYTH-1 plasmid pAB_CC, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
55. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NC_025109 (Acinetobacter baumannii strain A85 plasmid pA85-3 clone GC1 AbaR4 resistance island, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
56. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016297 (Acinetobacter baumannii strain CMC-CR-MDR-Ab4 plasmid pCMCVTAb2-Ab4, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
57. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NC_017163 (Acinetobacter baumannii 1656-2 plasmid ABKp1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
58. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050392 (Acinetobacter baumannii strain VB11737 plasmid pVB11737_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
59. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050413 (Acinetobacter baumannii strain PM192696 plasmid pPM192696_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
60. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
61. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017649 (Acinetobacter baumannii strain KAB04 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
62. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050404 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
63. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT984690 (Acinetobacter baumannii isolate K50 plasmid I, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
64. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029571 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-71, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
65. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039994 (Acinetobacter baumannii strain TG22182 plasmid pTG22182_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
66. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014216 (Acinetobacter baumannii strain YU-R612 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
67. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017655 (Acinetobacter baumannii strain KAB07 plasmid pKAB07, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
68. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023030 (Acinetobacter baumannii strain 9102 plasmid pAba9102a, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
69. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP040043 (Acinetobacter baumannii strain VB958 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
70. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050915 (Acinetobacter baumannii strain DT-Ab007 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
71. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050909 (Acinetobacter baumannii strain DT-Ab022 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
72. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008707 (Acinetobacter baumannii strain AB5075-UW plasmid p1AB5075, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
73. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017643 (Acinetobacter baumannii strain KAB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
74. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030109 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-85, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
75. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017651 (Acinetobacter baumannii strain KAB05 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
76. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP032137 (Acinetobacter haemolyticus strain sz1652 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
77. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020589 (Acinetobacter baumannii strain 15A34 plasmid p15A34_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
78. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NC_010606 (Acinetobacter baumannii ACICU plasmid pACICU2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
79. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042842 (Acinetobacter baumannii strain ATCC BAA-1790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
80. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP007580 (Acinetobacter baumannii AC30 plasmid pAC30c, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
81. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019115 (Acinetobacter baumannii strain MDR-CQ plasmid pMDR-CQ, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
82. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU549175 (Acinetobacter baumannii strain C13 plasmid pC13-2 clone GC2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
83. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX230794 (Acinetobacter baumannii strain MAL plasmid pMAL-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
84. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025267 (Acinetobacter baumannii isolate SMC_Paed_Ab_BL01 plasmid pSMC_AB_BL01_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
85. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020593 (Acinetobacter baumannii strain USA2 plasmid pUSA2_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
86. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020594 (Acinetobacter baumannii strain USA15 plasmid pUSA15_1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
87. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KR535992 (Acinetobacter baumannii strain A105 plasmid pA105-1, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
88. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to CP002524 (Acinetobacter baumannii TCDC-AB0715 plasmid p2ABTCDC0715, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
89. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KM977710 (Acinetobacter baumannii strain D46 plasmid pD46-3, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
90. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017653 (Acinetobacter baumannii strain KAB06 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
91. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KF669606 (Acinetobacter baumannii strain G7 plasmid pAb-G7-2 clone GC1 (global clone 1), complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
92. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK386681 (Acinetobacter baumannii strain ABAY09008 plasmid pABAY09008_1B, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
93. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024578 (Acinetobacter baumannii strain AbPK1 plasmid pAbPK1b, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
94. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK243454 (Acinetobacter baumannii strain 09A16CRGN0014 plasmid pCRA914-67, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
95. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019218 (Acinetobacter baumannii strain XH731 plasmid pXH731, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
96. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG954377 (Acinetobacter baumannii strain SGH9601 plasmid pS21-2, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
97. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038264 (Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr6, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
98. spacer 6.12|2004631|34|CP032152|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035047 (Acinetobacter baumannii strain ABUH793 plasmid p74.1Kbp, complete sequence) position: , mismatch: 10, identity: 0.706
aaaaatcctttaatcgatccttccactgttctgc CRISPR spacer
tatgggcctttaatccagccttccactgttgtcg Protospacer
* .. ********* * ************ *
