Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 1 crisprs NA 0 2 0 0
CP030126 Indioceanicola profundi strain SCSIO 08040 chromosome, complete genome 1 crisprs NA 0 1 0 0
CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP030128
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030128_1 133013-133152 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030128_1 1.1|133036|42|CP030128|CRISPRCasFinder 133036-133077 42 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 133036-133077 0 1.0
CP030128_1 1.2|133101|29|CP030128|CRISPRCasFinder 133101-133129 29 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 133101-133129 0 1.0
CP030128_1 1.2|133101|29|CP030128|CRISPRCasFinder 133101-133129 29 NZ_CP022035 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence 46175-46203 5 0.828
CP030128_1 1.2|133101|29|CP030128|CRISPRCasFinder 133101-133129 29 NC_019342 Salmonella sp. 14 plasmid p14-120, complete sequence 126751-126779 5 0.828
CP030128_1 1.2|133101|29|CP030128|CRISPRCasFinder 133101-133129 29 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 234470-234498 6 0.793

1. spacer 1.1|133036|42|CP030128|CRISPRCasFinder matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgattcgatagcgatgcgcgccgcaatggtcctaagcctga	CRISPR spacer
ccgattcgatagcgatgcgcgccgcaatggtcctaagcctga	Protospacer
******************************************

2. spacer 1.2|133101|29|CP030128|CRISPRCasFinder matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

cgtggaccccgtgcagggctggtcatgtg	CRISPR spacer
cgtggaccccgtgcagggctggtcatgtg	Protospacer
*****************************

3. spacer 1.2|133101|29|CP030128|CRISPRCasFinder matches to NZ_CP022035 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence) position: , mismatch: 5, identity: 0.828 

cgtggaccccgtgcagggctggtcatgtg-	CRISPR spacer
actggaccccgtggagggcaggtca-gtga	Protospacer
  *********** ***** ***** ***

4. spacer 1.2|133101|29|CP030128|CRISPRCasFinder matches to NC_019342 (Salmonella sp. 14 plasmid p14-120, complete sequence) position: , mismatch: 5, identity: 0.828 

cgtggaccccgtgcagggctggtcatgtg-	CRISPR spacer
actggaccccgtggagggcaggtca-gtga	Protospacer
  *********** ***** ***** ***

5. spacer 1.2|133101|29|CP030128|CRISPRCasFinder matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 6, identity: 0.793 

cgtggaccccgtgcagggctggtcatgtg	CRISPR spacer
cgtggacggcgtgcagggctggtcgggcc	Protospacer
*******  ***************. *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030126
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030126_1 2422181-2422296 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030126_1 1.1|2422222|34|CP030126|CRISPRCasFinder 2422222-2422255 34 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 441921-441954 10 0.706

1. spacer 1.1|2422222|34|CP030126|CRISPRCasFinder matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706 

gttccctctgccttgcgccggcggccgagaagcg	CRISPR spacer
gcagcatcagccttgcgctggcggccgagatttc	Protospacer
*.  * ** *********.***********  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage