Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032266 Streptomyces fradiae strain NKZ-259 chromosome, complete genome 17 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,casR,csa3,DinG,WYL,cas4 0 60 3 0

Results visualization

1. CP032266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_2 911236-911419 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_3 1543439-1544687 TypeI-E NA
20 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_5 1557621-1557954 TypeI-E NA
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_4 1554359-1556766 TypeI-E NA
39 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_6 1593736-1593853 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_7 1635598-1635687 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_8 2377023-2377132 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_9 2471764-2471867 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_10 3011182-3011258 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_11 3135676-3135762 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_14 4446385-4446482 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_15 4481040-4481118 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_17 5216762-5216896 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_18 5381538-5381660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_19 5552163-5552258 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_21 5736757-5736907 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032266_22 7523023-7523114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019062 Synechococcus phage ACG-2014d isolate Syn7803C93, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019121 Synechococcus phage ACG-2014d isolate Syn7803US78, complete genome 28616-28647 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019126 Synechococcus phage ACG-2014d isolate Syn7803US83, complete genome 28714-28745 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019047 Synechococcus phage ACG-2014d isolate Syn7803C73, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019072 Synechococcus phage ACG-2014d isolate Syn7803US108, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019032 Synechococcus phage ACG-2014d isolate Syn7803C49, complete genome 28625-28656 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019078 Synechococcus phage ACG-2014d isolate Syn7803US114, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019165 Synechococcus phage ACG-2014d isolate Syn7803C40, complete genome 28621-28652 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019124 Synechococcus phage ACG-2014d isolate Syn7803US80, complete genome 28768-28799 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019074 Synechococcus phage ACG-2014d isolate Syn7803US110, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019034 Synechococcus phage ACG-2014d isolate Syn7803C54, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019127 Synechococcus phage ACG-2014d isolate Syn7803US85, complete genome 28625-28656 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019118 Synechococcus phage ACG-2014d isolate Syn7803US64, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019075 Synechococcus phage ACG-2014d isolate Syn7803US111, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019131 Synechococcus phage ACG-2014d isolate Syn7803US95, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019057 Synechococcus phage ACG-2014d isolate Syn7803C89, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019056 Synechococcus phage ACG-2014d isolate Syn7803C88, partial genome 28751-28782 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019160 Synechococcus phage ACG-2014d isolate Syn7803C35, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019112 Synechococcus phage ACG-2014d isolate Syn7803US59, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019073 Synechococcus phage ACG-2014d isolate Syn7803US109, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019077 Synechococcus phage ACG-2014d isolate Syn7803US113, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019129 Synechococcus phage ACG-2014d isolate Syn7803US89, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019031 Synechococcus phage ACG-2014d isolate Syn7803C48, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019079 Synechococcus phage ACG-2014d isolate Syn7803US115, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019035 Synechococcus phage ACG-2014d isolate Syn7803C55, complete genome 26957-26988 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019120 Synechococcus phage ACG-2014d isolate Syn7803US71, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019036 Synechococcus phage ACG-2014d isolate Syn7803C57, complete genome 28613-28644 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019048 Synechococcus phage ACG-2014d isolate Syn7803C75, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019113 Synechococcus phage ACG-2014d isolate Syn7803US5, complete genome 28673-28704 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019140 Synechococcus phage ACG-2014d isolate Syn7803C109, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019119 Synechococcus phage ACG-2014d isolate Syn7803US65, complete genome 28673-28704 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019162 Synechococcus phage ACG-2014d isolate Syn7803C37, complete genome 28667-28698 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019130 Synechococcus phage ACG-2014d isolate Syn7803US94, complete genome 28623-28654 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019115 Synechococcus phage ACG-2014d isolate Syn7803US61, complete genome 28628-28659 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019139 Synechococcus phage ACG-2014d isolate Syn7803C108, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019125 Synechococcus phage ACG-2014d isolate Syn7803US82, complete genome 28622-28653 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019070 Synechococcus phage ACG-2014d isolate Syn7803US104, complete genome 28670-28701 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019028 Synechococcus phage ACG-2014d isolate Syn7803C45, complete genome 28625-28656 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019083 Synechococcus phage ACG-2014d isolate Syn7803US122, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019164 Synechococcus phage ACG-2014d isolate Syn7803C39, complete genome 28685-28716 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019117 Synechococcus phage ACG-2014d isolate Syn7803US63, complete genome 28604-28635 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019046 Synechococcus phage ACG-2014d isolate Syn7803C72, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019050 Synechococcus phage ACG-2014d isolate Syn7803C77, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019029 Synechococcus phage ACG-2014d isolate Syn7803C46, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 KJ019080 Synechococcus phage ACG-2014d isolate Syn7803US116, complete genome 28619-28650 4 0.875
CP032266_3 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544078-1544109 32 NC_026923 Synechococcus phage ACG-2014d isolate Syn7803C102, complete genome 28625-28656 4 0.875
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 295799-295826 4 0.857
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP010871 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence 55495-55522 4 0.857
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH051248 Mycobacterium phage BigPhil, complete genome 14987-15011 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN369739 Mycobacterium phage Kenuha5, complete genome 15281-15305 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MF668281 Mycobacterium phage RitaG, complete genome 15300-15324 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN369749 Mycobacterium phage MinionDave, complete genome 15841-15865 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT684597 Mycobacterium phage Mandlovu, complete genome 15256-15280 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK494110 Mycobacterium phage SwagPigglett, complete genome 15165-15189 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT553345 Mycobacterium phage LastJedi, complete genome 15157-15181 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KY012363 Mycobacterium phage Empress, complete genome 16509-16533 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH669010 Mycobacterium phage PHappiness, complete genome 15138-15162 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN585973 Mycobacterium phage StAnnes, complete genome 15206-15230 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK016504 Mycobacterium phage Whouxphf, complete genome 15262-15286 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH077578 Mycobacterium phage DillTech15, complete genome 15193-15217 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH020235 Mycobacterium phage Batiatus, complete genome 15209-15233 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KY471267 Mycobacterium phage SassyB, complete genome 15206-15230 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MG872841 Mycobacterium phage Priscilla, complete genome 15168-15192 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MG812488 Mycobacterium phage Frankie, complete genome 15264-15288 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM597530 Mycobacterium phage Bipolar, complete genome 15159-15183 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH590598 Mycobacterium phage Krakatau, complete genome 15856-15880 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT889374 Mycobacterium phage Firehouse51, complete genome 15718-15742 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KY348865 Mycobacterium phage Bubbles123, complete genome 15873-15897 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH669012 Mycobacterium phage QuickMath, complete genome 16504-16528 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN428047 Mycobacterium phage Doomphist, complete genome 15292-15316 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN585995 Mycobacterium phage Chuckly, complete genome 15330-15354 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT684593 Mycobacterium phage Moonbeam, complete genome 15650-15674 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KT281793 Mycobacterium phage Seagreen, complete genome 15002-15026 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH651169 Mycobacterium phage Burwell21, complete genome 15163-15187 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN369755 Mycobacterium phage Minnie, complete genome 15701-15725 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK016496 Mycobacterium phage IrishSherpFalk, complete genome 16516-16540 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MF668271 Mycobacterium phage Geralt, complete genome 15157-15181 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN735431 Mycobacterium phage Hegedechwinu, complete genome 15011-15035 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH051257 Mycobacterium phage OwlsT2W, complete genome 15526-15550 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_041855 Mycobacterium phage Dorothy, complete genome 15118-15142 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH371120 Mycobacterium phage OlympiaSaint, complete genome 15354-15378 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT897904 Mycobacterium phage Royals2015, complete genome 15178-15202 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MF190168 Mycobacterium phage Spoonbill, complete genome 15165-15189 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM101124 Mycobacterium phage Squirty, complete genome 15064-15088 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN735433 Mycobacterium phage Scottish, complete genome 16460-16484 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM101122 Mycobacterium phage Hades, complete genome 15167-15191 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH651183 Mycobacterium phage Nivrat, complete genome 15164-15188 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN586012 Mycobacterium phage Blexus, complete genome 15346-15370 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_041986 Mycobacterium phage Spartacus, complete genome 15188-15212 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MG770213 Mycobacterium phage OldBen, complete genome 15130-15154 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_028961 Mycobacterium phage PopTart, complete genome 15206-15230 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KT309034 Mycobacterium phage Dante, complete genome 15177-15201 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_041989 Mycobacterium phage Shauna1, complete genome 15211-15235 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH155866 Mycobacterium phage Byougenkin, complete genome 15178-15202 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KR997968 Mycobacterium phage Quico, complete genome 14988-15012 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KF017004 Mycobacteriophage Velveteen, complete genome 14987-15011 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH834617 Mycobacterium phage Lizziana, complete genome 15165-15189 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH669009 Mycobacterium phage Nimbo, complete genome 15160-15184 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH371115 Mycobacterium phage Clifton, complete genome 15114-15138 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_041988 Mycobacterium phage ShiLan, complete genome 15164-15188 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH651178 Mycobacterium phage KristaRAM, complete genome 15831-15855 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH669001 Mycobacterium phage EleanorGeorge, complete genome 15326-15350 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT889380 Mycobacterium phage Coco12, complete genome 15556-15580 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH077580 Mycobacterium phage Melissauren88, complete genome 15189-15213 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT684595 Mycobacterium phage Mova, complete genome 15009-15033 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK305886 Mycobacterium phage Poenanya, complete genome 15292-15316 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK016494 Mycobacterium phage Filuzino, complete genome 15151-15175 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM066034 Mycobacterium phage Inventum, complete genome 15292-15316 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM215148 Mycobacterium phage Cerasum, complete genome 14987-15011 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH399784 Mycobacterium phage NormanBulbieJr, complete genome 15152-15176 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_028792 Mycobacterium phage Kimberlium, complete genome 16280-16304 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_021538 Mycobacterium phage Job42, complete genome 16840-16864 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH399771 Mycobacterium phage ByChance, complete genome 15169-15193 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_011288 Mycobacterium phage Fruitloop, complete genome 15190-15214 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN945900 Mycobacterium phage BodEinwohner17, complete genome 15328-15352 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_009820 Mycobacterium phage Tweety, complete genome 15212-15236 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_031262 Mycobacterium phage Brocalys, complete genome 15144-15168 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KY965064 Mycobacterium phage Pippy, complete genome 15150-15174 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KX576644 Mycobacterium phage WillSterrel, complete genome 16516-16540 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KY702574 Mycobacterium phage Kingsley, complete genome 15014-15038 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_013936 Mycobacterium phage Ardmore, complete genome 15208-15232 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN369752 Mycobacterium phage Flathead, complete genome 15026-15050 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KR824843 Mycobacterium phage Ovechkin, complete genome 15188-15212 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 FJ174693 Mycobacterium phage Ramsey, complete genome 15187-15211 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK494118 Mycobacterium phage Cornucopia, complete genome 15196-15220 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN310548 Mycobacterium phage Juice456, complete genome 16280-16304 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KR997930 Mycobacterium phage Florinda, complete genome 15180-15204 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 HQ728524 Mycobacterium phage Wee, complete genome 15732-15756 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH727548 Mycobacterium phage Galactic, complete genome 15155-15179 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MF668270 Mycobacterium phage Emma, complete genome 15209-15233 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH669005 Mycobacterium phage JoeyJr, complete genome 15328-15352 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MF668287 Mycobacterium phage Wachhund, complete genome 15183-15207 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 JN020142 Mycobacterium phage Mutaforma13, complete genome 15205-15229 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN586001 Mycobacterium phage Donkeykong, complete genome 15334-15358 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK875792 Mycobacterium phage Polka14, complete genome 15700-15724 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KF114874 Mycobacterium phage Bobi, complete genome 15748-15772 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_022056 Mycobacterium phage Hamulus, complete genome 15164-15188 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_023728 Mycobacterium virus DeadP, complete genome 15191-15215 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 JN699012 Mycobacterium phage SG4, complete genome 15309-15333 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN586004 Mycobacterium phage Strokeseat, complete genome 15256-15280 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KR997931 Mycobacterium phage Girafales, complete genome 14988-15012 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH316564 Mycobacterium phage Koella, complete genome 15126-15150 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MN204502 Mycobacterium phage KingMidas, complete genome 16460-16484 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT684601 Mycobacterium phage Hlubikazi, complete genome 15256-15280 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MT114167 Mycobacterium phage Phanphagia, complete genome 15211-15235 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KT281795 Mycobacterium phage XFactor, complete genome 15164-15188 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_022068 Mycobacteriophage Daenerys, complete genome 15160-15184 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MH825707 Mycobacterium phage MilleniumForce, complete genome 15972-15996 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KM347889 Mycobacterium phage BuzzLyseyear, complete genome 15550-15574 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 JF937093 Mycobacterium virus DLane, complete genome 15147-15171 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KT895281 Mycobacterium phage Cabrinians, complete genome 15159-15183 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_025433 Mycobacteriophage Taj, complete genome 15191-15215 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 MK494120 Mycobacterium phage Piper2020, complete genome 15029-15053 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 FJ174692 Mycobacterium phage Pacc40, complete genome 15328-15352 4 0.84
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 KX808131 Mycobacterium phage SuperGrey, complete genome 15832-15856 4 0.84
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP015092 Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence 72064-72095 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP015233 Epibacterium mobile F1926 plasmid unnamed3, complete sequence 86284-86315 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP045411 Roseovarius sp. THAF8 plasmid pTHAF8_a, complete sequence 106828-106859 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP045394 Roseovarius sp. THAF27 plasmid pTHAF27_a, complete sequence 108115-108146 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP031600 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence 55173-55204 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP049815 Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence 107258-107289 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP045405 Roseovarius sp. THAF9 plasmid pTHAF9_a, complete sequence 102518-102549 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP010861 Marinovum algicola DG 898 plasmid pMaD6, complete sequence 91148-91179 5 0.844
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP045320 Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence 84447-84478 5 0.844
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 87785-87816 5 0.844
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 266220-266251 5 0.844
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 528398-528429 5 0.844
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1493974-1494005 5 0.844
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 319286-319317 5 0.844
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 483992-484023 5 0.844
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 46790-46821 5 0.844
CP032266_5 5.6|1557712|31|CP032266|CRT 1557712-1557742 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 200686-200716 5 0.839
CP032266_5 5.6|1557712|31|CP032266|CRT 1557712-1557742 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 137388-137418 5 0.839
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 259190-259217 5 0.821
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 45919-45946 5 0.821
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 361810-361837 5 0.821
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 686802-686829 5 0.821
CP032266_15 15.1|4481067|25|CP032266|CRISPRCasFinder 4481067-4481091 25 NC_023722 Rhodococcus phage ReqiPine5, complete genome 51487-51511 5 0.8
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 957341-957367 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 384936-384962 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1687401-1687427 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1712914-1712940 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 958938-958964 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 149520-149546 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1742842-1742868 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1774337-1774363 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1918555-1918581 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1395168-1395194 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 740414-740440 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1673577-1673603 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 286076-286102 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 661005-661031 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2129390-2129416 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1752338-1752364 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 722736-722762 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1459962-1459988 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1694624-1694650 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1711461-1711487 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1689444-1689470 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1758278-1758304 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1359382-1359408 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1632369-1632395 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1688910-1688936 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1763818-1763844 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1758245-1758271 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1667681-1667707 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1743259-1743285 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1757026-1757052 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1654156-1654182 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1667994-1668020 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1743259-1743285 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1757079-1757105 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1667682-1667708 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1654802-1654828 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1666885-1666911 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1743259-1743285 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1743259-1743285 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1743259-1743285 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1757075-1757101 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 288955-288981 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1757064-1757090 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1654178-1654204 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1667904-1667930 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1648550-1648576 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1709594-1709620 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1741575-1741601 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1740574-1740600 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1757064-1757090 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1654178-1654204 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1667993-1668019 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1754224-1754250 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1758068-1758094 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1654178-1654204 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1654178-1654204 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1757075-1757101 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1743264-1743290 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 256806-256832 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1757086-1757112 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1756887-1756913 5 0.815
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 256806-256832 5 0.815
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 41588-41619 6 0.812
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_AP013104 Bradyrhizobium elkanii USDA 61 plasmid pBel61, complete sequence 86167-86198 6 0.812
CP032266_3 3.6|1543773|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543773-1543804 32 NZ_LN831788 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence 44039-44070 6 0.812
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 96018-96049 6 0.812
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1397834-1397865 6 0.812
CP032266_3 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544627-1544658 32 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 295329-295360 6 0.812
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 117321-117352 6 0.812
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 11436-11467 6 0.812
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 86400-86431 6 0.812
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1146251-1146282 6 0.812
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 97962-97993 6 0.812
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_CP035514 Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence 97220-97251 6 0.812
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NC_012797 Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence 28060-28091 6 0.812
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 166595-166626 6 0.812
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 767928-767959 6 0.812
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 229600-229631 6 0.812
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 184790-184821 6 0.812
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_AP022578 Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence 105351-105382 6 0.812
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 76377-76408 6 0.812
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 262136-262167 6 0.812
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 538236-538267 6 0.812
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 538369-538400 6 0.812
CP032266_5 5.2|1557711|32|CP032266|PILER-CR,CRISPRCasFinder 1557711-1557742 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 200686-200717 6 0.812
CP032266_5 5.2|1557711|32|CP032266|PILER-CR,CRISPRCasFinder 1557711-1557742 32 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 137388-137419 6 0.812
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 MF140411 Mycobacterium phage Findley, complete genome 36632-36659 6 0.786
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 33455-33482 6 0.786
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 KY676784 Streptomyces phage ToastyFinz, complete genome 37581-37608 6 0.786
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 21703-21730 6 0.786
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 21703-21730 6 0.786
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 21704-21731 6 0.786
CP032266_16 16.1|4876978|27|CP032266|CRISPRCasFinder 4876978-4877004 27 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1392594-1392620 6 0.778
CP032266_3 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543590-1543621 32 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 593966-593997 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MK524485 Mycobacterium phage MissDaisy, complete genome 53210-53241 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MH926058 Mycobacterium phage Reptar3000, complete genome 53347-53378 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 KX621007 Mycobacterium phage Taquito, complete genome 57136-57167 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MK524488 Mycobacterium phage Patt, complete genome 53357-53388 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 KJ944841 Mycobacterium phage Cheetobro, complete genome 53518-53549 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 KY087992 Mycobacterium phage Mitti, complete genome 54238-54269 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 KT361920 Mycobacterium phage Slarp, complete genome 53521-53552 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 268226-268257 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 217825-217856 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 339888-339919 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 337584-337615 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 352431-352462 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 371575-371606 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 297306-297337 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 334581-334612 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 334489-334520 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 355355-355386 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 302013-302044 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 323045-323076 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 330648-330679 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 342542-342573 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 272859-272890 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 352144-352175 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 334503-334534 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 723672-723703 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 323045-323076 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 335781-335812 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 337268-337299 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 355355-355386 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 326587-326618 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 339831-339862 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 334492-334523 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 341031-341062 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 334503-334534 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 391103-391134 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 329946-329977 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 45290-45321 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 334494-334525 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 337676-337707 7 0.781
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 602446-602477 7 0.781
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 155793-155824 7 0.781
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP025805 Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence 185232-185263 7 0.781
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 67258-67289 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 446721-446752 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 5265-5296 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 563171-563202 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 152467-152498 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 230005-230036 7 0.781
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 576620-576651 7 0.781
CP032266_4 4.5|1554631|32|CP032266|CRISPRCasFinder,CRT 1554631-1554662 32 MG812496 Gordonia phage SallySpecial, complete genome 10764-10795 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 134185-134216 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 131479-131510 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 57166-57197 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 517969-518000 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 57112-57143 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 287096-287127 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 480930-480961 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 452820-452851 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 438393-438424 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 645420-645451 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 438393-438424 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 436834-436865 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 441081-441112 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 435200-435231 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 282643-282674 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 438393-438424 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 282637-282668 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 17459-17490 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 MT521995 Gordonia phage Moosehead, complete genome 37187-37218 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 888142-888173 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 47786-47817 7 0.781
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 847560-847591 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP015319 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123a 71585-71616 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1892687-1892718 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1985679-1985710 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1791283-1791314 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1861494-1861525 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1790303-1790334 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1889049-1889080 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1889051-1889082 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1791293-1791324 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1790677-1790708 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1791263-1791294 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1892878-1892909 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1892875-1892906 7 0.781
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1892840-1892871 7 0.781
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 176711-176742 7 0.781
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 369253-369284 7 0.781
CP032266_4 4.13|1555119|32|CP032266|CRISPRCasFinder,CRT 1555119-1555150 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 32033-32064 7 0.781
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 747866-747897 7 0.781
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 784126-784157 7 0.781
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 538927-538958 7 0.781
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 175406-175437 7 0.781
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 105622-105653 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 KY000034 Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence 25186-25217 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 KY000036 Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence 26451-26482 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP032929 Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence 5459-5490 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP039926 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129c, complete sequence 5549-5580 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP033033 Agrobacterium tumefaciens strain 12D1 plasmid pTi12D1, complete sequence 5591-5622 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP030831 Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence 61592-61623 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_003065 Agrobacterium fabrum str. C58 plasmid Ti, complete sequence 58051-58082 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK439382 Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence 57541-57572 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK439383 Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence 57541-57572 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK318973 Agrobacterium rhizogenes strain Colt5.8 plasmid pOC-Colt5.8, complete sequence 5571-5602 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK318986 Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence 5838-5869 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK439385 Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence 72843-72874 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK439384 Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence 59435-59466 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MK439381 Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence 57541-57572 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_MF511177 Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence 5838-5869 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000068 Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence 45391-45422 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000052 Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence 138974-139005 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000049 Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence 86960-86991 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000055 Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence 167666-167697 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000048 Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence 6476-6507 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000053 Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence 86824-86855 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000054 Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence 103725-103756 7 0.781
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_KY000051 Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence 76415-76446 7 0.781
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 66491-66522 7 0.781
CP032266_4 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT 1555729-1555760 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 655569-655600 7 0.781
CP032266_4 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT 1555729-1555760 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 356180-356211 7 0.781
CP032266_4 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT 1555729-1555760 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 655569-655600 7 0.781
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 521368-521399 7 0.781
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 221770-221801 7 0.781
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 145124-145155 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 279443-279474 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 628222-628253 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 901740-901771 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1419860-1419891 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 727220-727251 7 0.781
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 225815-225846 7 0.781
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 32107-32138 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP018234 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence 152489-152520 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 729335-729366 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 358873-358904 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP021815 Sinorhizobium meliloti strain M270 plasmid accessoryA, complete sequence 186247-186278 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 220298-220329 7 0.781
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 41777-41808 7 0.781
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 10357-10388 7 0.781
CP032266_4 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556339-1556370 32 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 89152-89183 7 0.781
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP014516 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence 40593-40624 7 0.781
CP032266_4 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556583-1556614 32 NZ_AP014708 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence 28603-28634 7 0.781
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1353491-1353522 7 0.781
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1358159-1358190 7 0.781
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 346824-346855 7 0.781
CP032266_5 5.7|1557773|30|CP032266|CRT 1557773-1557802 30 NZ_CP014515 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence 50524-50553 7 0.767
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NZ_CP024587 Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence 125362-125392 7 0.774
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 CP003953 Rhodococcus opacus PD630 plasmid 4, complete sequence 24379-24409 7 0.774
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 248093-248123 7 0.774
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 39777-39807 7 0.774
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 248090-248121 7 0.781
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1039008-1039039 7 0.781
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 257794-257821 7 0.75
CP032266_9 9.1|2471802|28|CP032266|CRISPRCasFinder 2471802-2471829 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1304891-1304918 7 0.75
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 593983-594014 8 0.75
CP032266_3 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543590-1543621 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 961746-961777 8 0.75
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MT889373 Arthrobacter phage Brynnie, complete genome 18027-18058 8 0.75
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MT498036 Gordonia Phage Zitch, complete genome 40305-40336 8 0.75
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 KU160644 Arthrobacter phage Galaxy, complete genome 18005-18036 8 0.75
CP032266_3 3.7|1543834|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543834-1543865 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 28898-28929 8 0.75
CP032266_3 3.9|1543956|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543956-1543987 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 561328-561359 8 0.75
CP032266_3 3.9|1543956|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543956-1543987 32 NZ_CP047636 Klebsiella pneumoniae strain K2606 plasmid unnamed3, complete sequence 53875-53906 8 0.75
CP032266_3 3.10|1544017|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544017-1544048 32 NZ_CP016621 Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence 149631-149662 8 0.75
CP032266_3 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544139-1544170 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 132197-132228 8 0.75
CP032266_3 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544139-1544170 32 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 20086-20117 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KT373978 Mycobacterium phage Ukulele, complete genome 48210-48241 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919525 Mycobacterium phage Murica, complete genome 49784-49815 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF668277 Mycobacterium phage MadamMonkfish, complete genome 48058-48089 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK433262 Mycobacterium phage Nimrod, complete genome 50045-50076 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK016498 Mycobacterium phage Manda, complete genome 49920-49951 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG872843 Mycobacterium phage Sotrice96, complete genome 49078-49109 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH651174 Mycobacterium phage Easy2Say, complete genome 49784-49815 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH000607 Mycobacterium phage RiverMonster, complete genome 48997-49028 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MT723943 Mycobacterium phage Cactus, complete genome 48335-48366 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MT114165 Mycobacterium phage BadStone, complete genome 48880-48911 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG872831 Mycobacterium phage Asriel, complete genome 47674-47705 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK757445 Mycobacterium phage Lilizi, complete genome 48449-48480 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH576953 Mycobacterium phage Hopey, complete genome 48951-48982 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KX834009 Mycobacterium phage Goldilocks, complete genome 48616-48647 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG099953 Mycobacterium phage Youngblood, complete genome 49779-49810 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919506 Mycobacterium phage FireRed, complete genome 49828-49859 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK359320 Mycobacterium phage Cookies, complete genome 48516-48547 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 AY129331 Mycobacterium virus Cjw1, complete genome 50032-50063 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586043 Mycobacterium phage Buck, complete genome 49559-49590 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH536829 Mycobacterium phage TBrady12, complete genome 48817-48848 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN096364 Mycobacterium phage Tomaszewski, complete genome 48228-48259 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH590587 Mycobacterium phage xkcd, complete genome 49969-50000 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH371112 Mycobacterium phage Adnama, complete genome 49337-49368 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919541 Mycobacterium phage YassJohnny, complete genome 48267-48298 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KX611831 Mycobacterium phage Pharsalus, complete genome 48856-48887 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_042027 Mycobacterium phage Pumpkin, complete genome 49477-49508 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF493883 Mycobacterium phage Mosby, complete genome 48135-48166 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH513978 Mycobacterium phage Phaja, complete genome 48882-48913 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN428059 Mycobacterium phage Kanye, complete genome 48464-48495 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KY549152 Mycobacterium phage Maxxinista, complete genome 48709-48740 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH399778 Mycobacterium phage Icee, complete genome 48782-48813 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919529 Mycobacterium phage Sassay, complete genome 47097-47128 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH513972 Mycobacterium phage IHOP, complete genome 48883-48914 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586051 Mycobacterium phage Myrale, complete genome 49478-49509 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK359309 Mycobacterium phage Czyszczon1, complete genome 48841-48872 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KU865303 Mycobacterium phage TeardropMSU, complete genome 48065-48096 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586041 Mycobacterium phage Elite2014, complete genome 48334-48365 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919524 Mycobacterium phage MISSy, complete genome 48840-48871 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 EU816588 Mycobacterium phage Porky, complete genome 48249-48280 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MT952854 Mycobacterium phage Miniwave, complete genome 48378-48409 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK016502 Mycobacterium phage Pat3, complete genome 47588-47619 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JF937106 Mycobacterium phage SirDuracell, complete genome 47683-47714 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KC748969 Mycobacterium phage Phaux, complete genome 49823-49854 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH536827 Mycobacterium phage Simpliphy, complete genome 48397-48428 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH669002 Mycobacterium phage Emmina, complete genome 48241-48272 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586035 Mycobacterium phage ChosenOne, complete genome 48335-48366 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KR080204 Mycobacterium phage Mindy, complete genome 47925-47956 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 DQ398041 Mycobacterium virus 244, complete genome 48958-48989 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG872832 Mycobacterium phage Barbarian, complete genome 47674-47705 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_029079 Mycobacterium phage Dusk, complete genome 48540-48571 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586032 Mycobacterium phage Command613, complete genome 49374-49405 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KC661277 Mycobacterium phage Phrux, complete genome 48419-48450 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JF937096 Mycobacterium phage Henry, complete genome 48759-48790 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_022065 Mycobacterium phage Contagion, complete genome 48135-48166 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KX817173 Mycobacterium phage Tuco, complete genome 49827-49858 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK937593 Mycobacterium phage Flypotenuse, complete genome 48325-48356 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG757160 Mycobacterium phage Kimchi, complete genome 49121-49152 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN096361 Mycobacterium phage Gator, complete genome 49171-49202 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586013 Mycobacterium phage Traaww1, complete genome 48503-48534 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH020247 Mycobacterium phage MPhalcon, complete genome 48833-48864 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JN391441 Mycobacterium phage Elph10, complete genome 48339-48370 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF306380 Mycobacterium phage DrDrey, complete genome 49760-49791 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH576956 Mycobacterium phage Inca, complete genome 47408-47439 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK620893 Mycobacterium phage HanKaySha, complete genome 48419-48450 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH779503 Mycobacterium phage Gemini, complete genome 49635-49666 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_022969 Mycobacterium phage PhatBacter, complete genome 49828-49859 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586019 Mycobacterium phage Stark, complete genome 48880-48911 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586050 Mycobacterium phage Lilpickle, complete genome 48334-48365 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_041850 Mycobacterium phage Eureka, complete genome 48805-48836 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF562099 Mycobacterium phage Bruin, complete genome 47854-47885 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK016491 Mycobacterium phage BaboJay, complete genome 48511-48542 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_028906 Mycobacterium phage Toto, complete genome 49319-49350 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KY319168 Mycobacterium phage CrystalP, complete genome 49319-49350 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF562100 Mycobacterium phage HufflyPuff, complete genome 49784-49815 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MG872837 Mycobacterium phage Gage, complete genome 49118-49149 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH536820 Mycobacterium phage Glexan, complete genome 49455-49486 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_008194 Mycobacterium phage 244, complete genome 48958-48989 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JF937091 Mycobacterium phage Bask21, complete genome 48294-48325 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF188414 Mycobacterium phage ABCat, complete genome 49311-49342 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JN006062 Mycobacterium phage Rakim, complete genome 48933-48964 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK801726 Mycobacterium phage ChotaBhai, complete genome 48659-48690 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH727557 Mycobacterium phage Paperbeatsrock, complete genome 49056-49087 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KF279417 Mycobacterium phage Quink, complete genome 49755-49786 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH399774 Mycobacterium phage DoctorDiddles, complete genome 48703-48734 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 JN382248 Mycobacterium phage Lilac, complete genome 48736-48767 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_028785 Mycobacterium phage NelitzaMV, complete genome 48424-48455 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586044 Mycobacterium phage Rimmer, complete genome 49169-49200 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586017 Mycobacterium phage OrionPax, complete genome 48430-48461 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KT020852 Mycobacterium phage NoSleep, complete genome 48679-48710 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MK559429 Mycobacterium phage Moldemort, complete genome 48937-48968 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919535 Mycobacterium phage Terminus, complete genome 49852-49883 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_022976 Mycobacterium phage Nala, complete genome 49342-49373 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_021305 Mycobacterium phage Murphy, complete genome 49221-49252 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MF919540 Mycobacterium phage Willez, complete genome 47097-47128 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MT522005 Mycobacterium phage Misfit, complete genome 49852-49883 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586037 Mycobacterium phage GooberAzure, complete genome 49118-49149 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 KC691255 Mycobacterium phage Dumbo, complete genome 48240-48271 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 EU816591 Mycobacterium phage Kostya, complete genome 48982-49013 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MN586034 Mycobacterium phage Hoonter, complete genome 49118-49149 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_022085 Mycobacterium phage Goku, complete genome 48534-48565 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_004681 Mycobacterium phage Cjw1, complete genome 50032-50063 8 0.75
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 MH513983 Mycobacterium phage ShereKhan, complete genome 49389-49420 8 0.75
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NC_011961 Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence 283962-283993 8 0.75
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 CP013974 Erwinia phage LS-2018a, complete sequence 14135-14166 8 0.75
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 CP013974 Erwinia phage LS-2018a, complete sequence 45933-45964 8 0.75
CP032266_3 3.18|1544505|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544505-1544536 32 NC_015592 Sinorhizobium meliloti AK83 plasmid pSINME02, complete sequence 56176-56207 8 0.75
CP032266_3 3.18|1544505|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544505-1544536 32 NZ_CP021213 Sinorhizobium meliloti RU11/001 plasmid pSmeRU11a, complete sequence 42697-42728 8 0.75
CP032266_3 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544627-1544658 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1239701-1239732 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP019872 Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence 112072-112103 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP030179 Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence 113766-113797 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP030170 Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence 32652-32683 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP030162 Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence 81635-81666 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP017192 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_2, complete sequence 20250-20281 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP023287 Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence 28792-28823 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP023287 Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence 68347-68378 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP030160 Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence 42968-42999 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018465 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.4, complete sequence 5941-5972 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP030165 Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence 104301-104332 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 10559-10590 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018860 Xanthomonas citri pv. citri strain LH201 plasmid pLH201.2, complete sequence 39112-39143 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018860 Xanthomonas citri pv. citri strain LH201 plasmid pLH201.2, complete sequence 58795-58826 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018852 Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.2, complete sequence 68837-68868 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018852 Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.2, complete sequence 90255-90286 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018849 Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.2, complete sequence 27110-27141 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018849 Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.2, complete sequence 46793-46824 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 463329-463360 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP022266 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plB, complete sequence 35539-35570 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP011165 Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc32, complete sequence 5442-5473 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018856 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.2, complete sequence 10889-10920 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP022425 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence 13713-13744 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_003921 Xanthomonas citri pv. citri str. 306 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP024030 Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence 20791-20822 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP024031 Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC33, complete sequence 21815-21846 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 15612-15643 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP006855 Xanthomonas citri subsp. citri A306 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009011 Xanthomonas citri pv. citri strain JX4 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009012 Xanthomonas citri pv. citri strain JX4 plasmid pXAC64, complete sequence 21034-21065 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP020888 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence 44389-44420 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP022269 Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plB, complete sequence 40168-40199 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008996 Xanthomonas citri pv. citri strain MN12 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008997 Xanthomonas citri pv. citri strain MN12 plasmid pXAC64, complete sequence 19843-19874 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP013664 Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP013665 Xanthomonas citri pv. citri strain jx-6 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008999 Xanthomonas citri pv. citri strain MN11 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009000 Xanthomonas citri pv. citri strain MN11 plasmid pXAC64, complete sequence 19843-19874 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP024032 Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC33, complete sequence 21813-21844 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP024033 Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence 20796-20827 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 CP030167 Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence 42834-42865 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP021022 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence 27469-27500 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP023156 Xanthomonas citri pv. malvacearum strain AR81009 plasmid unnamed1, complete sequence 90471-90502 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP011162 Xanthomonas citri pv. aurantifolii strain FDC 1559 plasmid pXfc38, complete sequence 12710-12741 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP023161 Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed2, complete sequence 12379-12410 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009026 Xanthomonas citri pv. citri strain 5208 plasmid pXAC33, complete sequence 7791-7822 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009014 Xanthomonas citri pv. citri strain GD3 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009015 Xanthomonas citri pv. citri strain GD3 plasmid pXAC64, complete sequence 21041-21072 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_007506 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence 4414-4445 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_020801 Xanthomonas axonopodis Xac29-1 plasmid pXAC33, complete sequence 21813-21844 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008993 Xanthomonas citri pv. citri strain NT17 plasmid pXAC33, complete sequence 7793-7824 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008994 Xanthomonas citri pv. citri strain NT17 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009008 Xanthomonas citri pv. citri strain JX5 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009009 Xanthomonas citri pv. citri strain JX5 plasmid pXAC64, complete sequence 21034-21065 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP017022 Xanthomonas citri pv. malvacearum strain MSCT plasmid pMSCT44kb, complete sequence 24022-24053 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP013005 Xanthomonas citri pv. malvacearum strain XcmH1005 plasmid pXcmH, complete sequence 26230-26261 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009002 Xanthomonas citri pv. citri strain MN10 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009003 Xanthomonas citri pv. citri strain MN10 plasmid pXAC64, complete sequence 19843-19874 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009018 Xanthomonas citri pv. citri strain GD2 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009021 Xanthomonas citri pv. citri strain FB19 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008987 Xanthomonas citri pv. citri strain UI7 plasmid pXAC33, complete sequence 9854-9885 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008988 Xanthomonas citri pv. citri strain UI7 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_020797 Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence 20783-20814 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009005 Xanthomonas citri pv. citri strain MF20 plasmid pXAC33, complete sequence 5950-5981 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP009006 Xanthomonas citri pv. citri strain MF20 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP046021 Xanthomonas citri pv. malvacearum strain HD-1 plasmid unnamed2, complete sequence 36298-36329 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP008991 Xanthomonas citri subsp. citri UI6 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_003922 Xanthomonas citri pv. citri str. 306 plasmid pXAC64, complete sequence 21042-21073 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP011251 Xanthomonas citri pv. aurantifolii strain FDC 1561 plasmid pXfb33, complete sequence 11270-11301 8 0.75
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP018222 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence 34059-34090 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 139943-139974 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 246066-246097 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1036181-1036212 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 165257-165288 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 776945-776976 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 271219-271250 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 529727-529758 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 327281-327312 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 MT521991 Streptomyces phage Eklok, complete genome 1305-1336 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1862304-1862335 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1186895-1186926 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 552605-552636 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1683355-1683386 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_015188 Acidiphilium multivorum AIU301 plasmid pACMV4, complete sequence 10863-10894 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 154431-154462 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 70238-70269 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 177170-177201 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 20364-20395 8 0.75
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 83206-83237 8 0.75
CP032266_4 4.5|1554631|32|CP032266|CRISPRCasFinder,CRT 1554631-1554662 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 718722-718753 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 343937-343968 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 3741-3772 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1669187-1669218 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 721773-721804 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 951542-951573 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 124718-124749 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 907141-907172 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 882498-882529 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 907141-907172 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 601363-601394 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 307321-307352 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 377313-377344 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 210472-210503 8 0.75
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 794666-794697 8 0.75
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 MN908685 Microbacterium phage PauloDiaboli, complete genome 60478-60509 8 0.75
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NC_010627 Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence 168049-168080 8 0.75
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NC_018696 Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence 37779-37810 8 0.75
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 200102-200133 8 0.75
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 320389-320420 8 0.75
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP011000 Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence 192556-192587 8 0.75
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 107807-107838 8 0.75
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 280778-280809 8 0.75
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 558911-558942 8 0.75
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 158328-158359 8 0.75
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 556667-556698 8 0.75
CP032266_4 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT 1554936-1554967 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 558579-558610 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 444214-444245 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 221710-221741 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 72772-72803 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 874765-874796 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 375592-375623 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 920338-920369 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1734819-1734850 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 671815-671846 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 397544-397575 8 0.75
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 21875-21906 8 0.75
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP020540 Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence 143522-143553 8 0.75
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 121907-121938 8 0.75
CP032266_4 4.24|1555790|32|CP032266|CRISPRCasFinder,CRT 1555790-1555821 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 128854-128885 8 0.75
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 425176-425207 8 0.75
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 647581-647612 8 0.75
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1406435-1406466 8 0.75
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 215495-215526 8 0.75
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 838524-838555 8 0.75
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 406100-406131 8 0.75
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 KR053199 Gordonia phage GMA4, complete genome 22535-22566 8 0.75
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 800200-800231 8 0.75
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1107307-1107338 8 0.75
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 MN284901 Microbacterium phage YuuY, complete genome 6726-6757 8 0.75
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 191839-191870 8 0.75
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 243564-243595 8 0.75
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 74148-74179 8 0.75
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 372861-372892 8 0.75
CP032266_4 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556583-1556614 32 NZ_CP038238 Leisingera sp. NJS201 plasmid unnamed4, complete sequence 72395-72426 8 0.75
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 483366-483397 8 0.75
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 123589-123620 8 0.75
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 37821-37852 8 0.75
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_LR134453 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence 18625-18656 8 0.75
CP032266_5 5.3|1557772|31|CP032266|PILER-CR 1557772-1557802 31 NZ_CP014515 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence 50524-50554 8 0.742
CP032266_5 5.3|1557772|31|CP032266|PILER-CR 1557772-1557802 31 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 61696-61726 8 0.742
CP032266_5 5.7|1557773|30|CP032266|CRT 1557773-1557802 30 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 61697-61726 8 0.733
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 145986-146016 8 0.742
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 218930-218960 8 0.742
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 55936-55966 8 0.742
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 43079-43109 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1039011-1039041 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 681458-681488 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 350156-350186 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 625145-625175 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 45869-45899 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 46148-46178 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 326727-326757 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 217225-217255 8 0.742
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 470479-470509 8 0.742
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 45871-45902 8 0.75
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 661978-662009 8 0.75
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 326724-326755 8 0.75
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 217227-217258 8 0.75
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1441469-1441500 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1192291-1192322 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1441616-1441647 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1192266-1192297 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 937776-937807 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1799612-1799643 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 905199-905230 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1816302-1816333 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1192298-1192329 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 202702-202733 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1441191-1441222 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 202700-202731 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1441135-1441166 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1119218-1119249 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 928751-928782 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1779538-1779569 9 0.719
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1065813-1065844 9 0.719
CP032266_3 3.2|1543529|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543529-1543560 32 CP000876 Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence 286060-286091 9 0.719
CP032266_3 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543590-1543621 32 NZ_LR723672 Rhizobium flavum strain YW14 plasmid 3 21761-21792 9 0.719
CP032266_3 3.4|1543651|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543651-1543682 32 NC_010492 Arthrobacter sp. Chr15 plasmid pChr15, complete sequence 33913-33944 9 0.719
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 9587-9618 9 0.719
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MT952853 Arthrobacter phage Orcanus, complete genome 17876-17907 9 0.719
CP032266_3 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543712-1543743 32 MF140397 Arthrobacter phage Abidatro, complete genome 18000-18031 9 0.719
CP032266_3 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544139-1544170 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1384950-1384981 9 0.719
CP032266_3 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544261-1544292 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 351250-351281 9 0.719
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 164316-164347 9 0.719
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 JQ680352 Unidentified phage clone 1013_scaffold1713 genomic sequence 1230-1261 9 0.719
CP032266_3 3.16|1544383|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544383-1544414 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4455845-4455876 9 0.719
CP032266_3 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544627-1544658 32 MK165658 Pseudomonas phage vB_PaeS_SCUT-S4, complete genome 32719-32750 9 0.719
CP032266_3 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544627-1544658 32 HG962376 Pseudomonas phage vB_PaeS_SCH_Ab26, complete genome 32704-32735 9 0.719
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MK524486 Mycobacterium phage Waleliano, complete genome 67356-67387 9 0.719
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 414373-414404 9 0.719
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 113539-113570 9 0.719
CP032266_4 4.3|1554509|32|CP032266|CRISPRCasFinder,CRT 1554509-1554540 32 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 109201-109232 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 189114-189145 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP041606 Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence 89488-89519 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP047174 Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence 80683-80714 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 824763-824794 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP044544 Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence 85274-85305 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 549719-549750 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 853692-853723 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 225169-225200 9 0.719
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 69532-69563 9 0.719
CP032266_4 4.6|1554692|32|CP032266|CRISPRCasFinder,CRT 1554692-1554723 32 NZ_CP015171 Acetobacter ascendens strain LMG 1591 plasmid unnamed3, complete sequence 9004-9035 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 201060-201091 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1068734-1068765 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 61143-61174 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1078053-1078084 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1234244-1234275 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 53548-53579 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 218535-218566 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 34527-34558 9 0.719
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 704460-704491 9 0.719
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 213497-213528 9 0.719
CP032266_4 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT 1554814-1554845 32 NC_047804 Ralstonia phage RS-PII-1, complete genome 34904-34935 9 0.719
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 40259-40290 9 0.719
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 143879-143910 9 0.719
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 67518-67549 9 0.719
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 255034-255065 9 0.719
CP032266_4 4.13|1555119|32|CP032266|CRISPRCasFinder,CRT 1555119-1555150 32 MN855734 Siphoviridae sp. isolate 120, complete genome 18792-18823 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4564935-4564966 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 44441-44472 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 122454-122485 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 150959-150990 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 89536-89567 9 0.719
CP032266_4 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT 1555180-1555211 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 108167-108198 9 0.719
CP032266_4 4.17|1555363|32|CP032266|CRISPRCasFinder,CRT 1555363-1555394 32 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 114195-114226 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP032319 Hymenobacter oligotrophus strain sh-6 plasmid unnamed2, complete sequence 1609-1640 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 MH509442 Mycobacterium phage Aminay, complete genome 43083-43114 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 303841-303872 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP029542 Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence 19376-19407 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 85742-85773 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 85742-85773 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 157543-157574 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 347473-347504 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 97317-97348 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 155304-155335 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 111195-111226 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 310151-310182 9 0.719
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 79563-79594 9 0.719
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 KC862297 Pseudomonas phage PAK_P1, complete genome 79631-79662 9 0.719
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 432113-432144 9 0.719
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 502395-502426 9 0.719
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112361-112392 9 0.719
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 225280-225311 9 0.719
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90483-90514 9 0.719
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271091-271122 9 0.719
CP032266_4 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT 1555729-1555760 32 MH727550 Corynebacterium phage Juicebox, complete genome 8845-8876 9 0.719
CP032266_4 4.24|1555790|32|CP032266|CRISPRCasFinder,CRT 1555790-1555821 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 678133-678164 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 976528-976559 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 667883-667914 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 171123-171154 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1613513-1613544 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 MH669000 Gordonia phage Ali17, complete genome 11225-11256 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 MN586026 Gordonia phage Leonard, complete genome 11823-11854 9 0.719
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NC_031112 Gordonia phage Phinally, complete genome 11820-11851 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1451294-1451325 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1413731-1413762 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 289597-289628 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1517516-1517547 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1526524-1526555 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 284844-284875 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1017820-1017851 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 901989-902020 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 630894-630925 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1139420-1139451 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 166389-166420 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 678161-678192 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1073638-1073669 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 730531-730562 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 438165-438196 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 288770-288801 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1568817-1568848 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1345169-1345200 9 0.719
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1451300-1451331 9 0.719
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP014678 Kozakia baliensis strain DSM 14400 plasmid pKB14400_4, complete sequence 6020-6051 9 0.719
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 691755-691786 9 0.719
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1121316-1121347 9 0.719
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_CP020702 Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS2, complete sequence 21988-22019 9 0.719
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 293949-293980 9 0.719
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 65225-65256 9 0.719
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 601777-601808 9 0.719
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 319317-319348 9 0.719
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 261436-261467 9 0.719
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP053567 Pseudonocardia sp. Gen01 plasmid unnamed3, complete sequence 25937-25968 9 0.719
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_CP015420 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence 75783-75814 9 0.719
CP032266_4 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556278-1556309 32 NZ_CP046349 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed2, complete sequence 38758-38789 9 0.719
CP032266_4 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556339-1556370 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 897244-897275 9 0.719
CP032266_4 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556339-1556370 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1199136-1199167 9 0.719
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 75569-75600 9 0.719
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 3520-3551 9 0.719
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 452924-452955 9 0.719
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP023038 Komagataeibacter saccharivorans strain CV1 plasmid unnamed2, complete sequence 18147-18178 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 639317-639348 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1720324-1720355 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 NZ_CP012941 Ralstonia solanacearum strain UW163 plasmid pUW163a, complete sequence 81848-81879 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1720322-1720353 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 376518-376549 9 0.719
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 356636-356667 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 660011-660042 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 61195-61226 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 730730-730761 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 104481-104512 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 88138-88169 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 585288-585319 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 307889-307920 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1962981-1963012 9 0.719
CP032266_4 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556522-1556553 32 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 189707-189738 9 0.719
CP032266_4 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556583-1556614 32 NC_011667 Thauera sp. MZ1T plasmid pTha01, complete sequence 311-342 9 0.719
CP032266_4 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556583-1556614 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 141209-141240 9 0.719
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 121957-121988 9 0.719
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP020084 Blastomonas fulva strain T2 plasmid unnamed, complete sequence 136919-136950 9 0.719
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 475748-475779 9 0.719
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 357345-357375 9 0.71
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 MT498059 Gordonia phage Doggs, complete genome 36813-36843 9 0.71
CP032266_5 5.8|1557833|31|CP032266|CRT 1557833-1557863 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4508897-4508927 9 0.71
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 436237-436267 9 0.71
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1115646-1115676 9 0.71
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 697480-697510 9 0.71
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1115648-1115679 9 0.719
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 697477-697508 9 0.719
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 39779-39810 9 0.719
CP032266_7 7.1|1635627|32|CP032266|CRISPRCasFinder 1635627-1635658 32 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 319729-319760 9 0.719
CP032266_7 7.1|1635627|32|CP032266|CRISPRCasFinder 1635627-1635658 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 24505-24536 9 0.719
CP032266_12 12.1|3490021|37|CP032266|CRISPRCasFinder 3490021-3490057 37 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1063141-1063177 9 0.757
CP032266_12 12.1|3490021|37|CP032266|CRISPRCasFinder 3490021-3490057 37 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1069229-1069265 9 0.757
CP032266_3 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT 1543468-1543499 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1230357-1230388 10 0.688
CP032266_3 3.7|1543834|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1543834-1543865 32 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 246539-246570 10 0.688
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NZ_KU140623 Sinorhizobium sp. M14 plasmid pSinB, complete sequence 284185-284216 10 0.688
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 16920-16951 10 0.688
CP032266_3 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1544322-1544353 32 CP003950 Rhodococcus opacus PD630 plasmid 1, complete sequence 101250-101281 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MT897910 Mycobacterium phage VioletZ, complete genome 67629-67660 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MT818419 Mycobacterium phage Lolalove, complete genome 67504-67535 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MN428050 Mycobacterium phage Apex, complete genome 67591-67622 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MN234171 Mycobacterium phage Magpie, complete genome 67250-67281 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MH513970 Mycobacterium phage Hangman, complete genome 67700-67731 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 KX589269 Mycobacterium phage Fortunato, complete genome 66900-66931 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 MT639648 Mycobacterium phage Heath, complete genome 65470-65501 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_042035 Mycobacterium phage Zemanar, complete sequence 67304-67335 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_022331 Mycobacterium phage Bane1, complete genome 65528-65559 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 KF279413 Mycobacterium phage Bane2, complete genome 65506-65537 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 KF493881 Mycobacterium phage JAMaL, complete genome 67008-67039 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_028968 Mycobacterium phage BrownCNA, complete genome 67607-67638 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP011296 Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence 157558-157589 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NC_004954 Micrococcus sp. 28 plasmid pSD10, complete sequence 3175-3206 10 0.688
CP032266_4 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT 1554448-1554479 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 770567-770598 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP041156 Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence 105038-105069 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 641164-641195 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 466452-466483 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP015008 Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence 16254-16285 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 767150-767181 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 85186-85217 10 0.688
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 281453-281484 10 0.688
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 CP054930 Streptomyces sp. NA00687 plasmid unnamed, complete sequence 11845-11876 10 0.688
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 14960-14991 10 0.688
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_LN868941 Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence 34373-34404 10 0.688
CP032266_4 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT 1554753-1554784 32 NZ_CP031419 Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence 72963-72994 10 0.688
CP032266_4 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT 1554875-1554906 32 AP018698 Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome 307-338 10 0.688
CP032266_4 4.17|1555363|32|CP032266|CRISPRCasFinder,CRT 1555363-1555394 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 137763-137794 10 0.688
CP032266_4 4.18|1555424|32|CP032266|CRISPRCasFinder,CRT 1555424-1555455 32 NZ_AP018720 Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence 53928-53959 10 0.688
CP032266_4 4.18|1555424|32|CP032266|CRISPRCasFinder,CRT 1555424-1555455 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 309372-309403 10 0.688
CP032266_4 4.20|1555546|32|CP032266|CRISPRCasFinder,CRT 1555546-1555577 32 NZ_CP038146 Streptomyces sp. S501 plasmid unnamed, complete sequence 153874-153905 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 291943-291974 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1120500-1120531 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 6862-6893 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1141645-1141676 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 444036-444067 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 664418-664449 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 962183-962214 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 228410-228441 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 471594-471625 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1180189-1180220 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 394998-395029 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1397537-1397568 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 350911-350942 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1335630-1335661 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 851546-851577 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 77310-77341 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 30837-30868 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1422811-1422842 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 974410-974441 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 931794-931825 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1118839-1118870 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 MF974178 Pseudomonas phage YS35, complete genome 82444-82475 10 0.688
CP032266_4 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT 1555607-1555638 32 MH791399 UNVERIFIED: Pseudomonas phage PaGz-1, complete genome 16391-16422 10 0.688
CP032266_4 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT 1555668-1555699 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 220671-220702 10 0.688
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_CP044332 Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence 92020-92051 10 0.688
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 MN694649 Marine virus AFVG_250M190, complete genome 29423-29454 10 0.688
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 MN694572 Marine virus AFVG_250M22, complete genome 29488-29519 10 0.688
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 MN694546 Marine virus AFVG_250M837, complete genome 28928-28959 10 0.688
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 MN694062 Marine virus AFVG_250M191, complete genome 4017-4048 10 0.688
CP032266_4 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556034-1556065 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1228218-1228249 10 0.688
CP032266_4 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556156-1556187 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 88501-88532 10 0.688
CP032266_4 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556339-1556370 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 267782-267813 10 0.688
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 253446-253477 10 0.688
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 NZ_CP051543 Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence 41347-41378 10 0.688
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 MT491207 Pseudomonas phage vB_PaeM_USP_18, complete genome 6658-6689 10 0.688
CP032266_4 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556461-1556492 32 MT491208 Pseudomonas phage vB_PaeM_USP_25, complete genome 6618-6649 10 0.688
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 422162-422193 10 0.688
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP015446 Streptomyces sp. S8 plasmid unnamed, complete sequence 57579-57610 10 0.688
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 661981-662011 10 0.677
CP032266_5 5.9|1557894|31|CP032266|CRT 1557894-1557924 31 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 891635-891665 10 0.677
CP032266_5 5.10|1557891|32|CP032266|CRISPRCasFinder 1557891-1557922 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 891637-891668 10 0.688
CP032266_11 11.1|3135701|37|CP032266|CRISPRCasFinder 3135701-3135737 37 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 94822-94858 10 0.73
CP032266_12 12.1|3490021|37|CP032266|CRISPRCasFinder 3490021-3490057 37 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 286472-286508 10 0.73
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 49588-49619 11 0.656
CP032266_4 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT 1554570-1554601 32 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 57916-57947 11 0.656
CP032266_4 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT 1555485-1555516 32 NZ_CP023065 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence 254898-254929 11 0.656
CP032266_4 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT 1555851-1555882 32 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 204166-204197 11 0.656
CP032266_4 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1555973-1556004 32 NZ_LR026982 Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence 22048-22079 11 0.656
CP032266_4 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556217-1556248 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1987782-1987813 11 0.656
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2082679-2082710 11 0.656
CP032266_4 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556400-1556431 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1011536-1011567 11 0.656
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 8074-8105 11 0.656
CP032266_4 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR 1556644-1556675 32 MN694589 Marine virus AFVG_250M1203, complete genome 3871-3902 11 0.656
CP032266_7 7.1|1635627|32|CP032266|CRISPRCasFinder 1635627-1635658 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 53769-53800 11 0.656

1. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019062 (Synechococcus phage ACG-2014d isolate Syn7803C93, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

2. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019121 (Synechococcus phage ACG-2014d isolate Syn7803US78, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

3. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019126 (Synechococcus phage ACG-2014d isolate Syn7803US83, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

4. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019047 (Synechococcus phage ACG-2014d isolate Syn7803C73, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

5. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019072 (Synechococcus phage ACG-2014d isolate Syn7803US108, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

6. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019032 (Synechococcus phage ACG-2014d isolate Syn7803C49, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

7. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019078 (Synechococcus phage ACG-2014d isolate Syn7803US114, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

8. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019165 (Synechococcus phage ACG-2014d isolate Syn7803C40, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

9. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019124 (Synechococcus phage ACG-2014d isolate Syn7803US80, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

10. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019074 (Synechococcus phage ACG-2014d isolate Syn7803US110, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

11. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019034 (Synechococcus phage ACG-2014d isolate Syn7803C54, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

12. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019127 (Synechococcus phage ACG-2014d isolate Syn7803US85, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

13. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019118 (Synechococcus phage ACG-2014d isolate Syn7803US64, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

14. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019075 (Synechococcus phage ACG-2014d isolate Syn7803US111, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

15. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019131 (Synechococcus phage ACG-2014d isolate Syn7803US95, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

16. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019057 (Synechococcus phage ACG-2014d isolate Syn7803C89, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

17. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019056 (Synechococcus phage ACG-2014d isolate Syn7803C88, partial genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

18. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019160 (Synechococcus phage ACG-2014d isolate Syn7803C35, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

19. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019112 (Synechococcus phage ACG-2014d isolate Syn7803US59, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

20. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019073 (Synechococcus phage ACG-2014d isolate Syn7803US109, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

21. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019077 (Synechococcus phage ACG-2014d isolate Syn7803US113, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

22. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019129 (Synechococcus phage ACG-2014d isolate Syn7803US89, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

23. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019031 (Synechococcus phage ACG-2014d isolate Syn7803C48, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

24. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019079 (Synechococcus phage ACG-2014d isolate Syn7803US115, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

25. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019035 (Synechococcus phage ACG-2014d isolate Syn7803C55, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

26. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019120 (Synechococcus phage ACG-2014d isolate Syn7803US71, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

27. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019036 (Synechococcus phage ACG-2014d isolate Syn7803C57, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

28. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019048 (Synechococcus phage ACG-2014d isolate Syn7803C75, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

29. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019113 (Synechococcus phage ACG-2014d isolate Syn7803US5, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

30. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019140 (Synechococcus phage ACG-2014d isolate Syn7803C109, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

31. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019119 (Synechococcus phage ACG-2014d isolate Syn7803US65, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

32. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019162 (Synechococcus phage ACG-2014d isolate Syn7803C37, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

33. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019130 (Synechococcus phage ACG-2014d isolate Syn7803US94, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

34. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019115 (Synechococcus phage ACG-2014d isolate Syn7803US61, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

35. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019139 (Synechococcus phage ACG-2014d isolate Syn7803C108, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

36. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019125 (Synechococcus phage ACG-2014d isolate Syn7803US82, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

37. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019070 (Synechococcus phage ACG-2014d isolate Syn7803US104, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

38. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019028 (Synechococcus phage ACG-2014d isolate Syn7803C45, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

39. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019083 (Synechococcus phage ACG-2014d isolate Syn7803US122, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

40. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019164 (Synechococcus phage ACG-2014d isolate Syn7803C39, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

41. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019117 (Synechococcus phage ACG-2014d isolate Syn7803US63, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

42. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019046 (Synechococcus phage ACG-2014d isolate Syn7803C72, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

43. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019050 (Synechococcus phage ACG-2014d isolate Syn7803C77, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

44. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019029 (Synechococcus phage ACG-2014d isolate Syn7803C46, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

45. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ019080 (Synechococcus phage ACG-2014d isolate Syn7803US116, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

46. spacer 3.11|1544078|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_026923 (Synechococcus phage ACG-2014d isolate Syn7803C102, complete genome) position: , mismatch: 4, identity: 0.875

-cggcggtgggtcgtcacatcatgatgttcacg	CRISPR spacer
acggtggt-ggtcgtcacgtcatgatattcacg	Protospacer
 ***.*** *********.*******.******

47. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.857

gtgccccggcccgccctcgaccgcgggc-	CRISPR spacer
ctgccccggcccgacctcgacc-caggcg	Protospacer
 ************ ******** *.*** 

48. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 4, identity: 0.857

gtgcc-ccggcccgccctcgaccgcgggc	CRISPR spacer
-cgccaccggcccgccctcggccgcggtc	Protospacer
 .*** **************.****** *

49. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH051248 (Mycobacterium phage BigPhil, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

50. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

51. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MF668281 (Mycobacterium phage RitaG, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

52. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN369749 (Mycobacterium phage MinionDave, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

53. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT684597 (Mycobacterium phage Mandlovu, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

54. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK494110 (Mycobacterium phage SwagPigglett, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

55. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT553345 (Mycobacterium phage LastJedi, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

56. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KY012363 (Mycobacterium phage Empress, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

57. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH669010 (Mycobacterium phage PHappiness, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

58. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

59. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK016504 (Mycobacterium phage Whouxphf, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

60. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

61. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH020235 (Mycobacterium phage Batiatus, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

62. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KY471267 (Mycobacterium phage SassyB, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

63. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

64. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MG812488 (Mycobacterium phage Frankie, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

65. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

66. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH590598 (Mycobacterium phage Krakatau, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

67. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT889374 (Mycobacterium phage Firehouse51, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

68. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

69. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH669012 (Mycobacterium phage QuickMath, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

70. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

71. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN585995 (Mycobacterium phage Chuckly, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

72. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT684593 (Mycobacterium phage Moonbeam, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

73. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KT281793 (Mycobacterium phage Seagreen, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

74. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH651169 (Mycobacterium phage Burwell21, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

75. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN369755 (Mycobacterium phage Minnie, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

76. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

77. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MF668271 (Mycobacterium phage Geralt, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

78. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN735431 (Mycobacterium phage Hegedechwinu, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

79. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH051257 (Mycobacterium phage OwlsT2W, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

80. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_041855 (Mycobacterium phage Dorothy, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

81. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

82. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT897904 (Mycobacterium phage Royals2015, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

83. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MF190168 (Mycobacterium phage Spoonbill, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

84. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM101124 (Mycobacterium phage Squirty, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

85. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN735433 (Mycobacterium phage Scottish, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

86. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

87. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH651183 (Mycobacterium phage Nivrat, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

88. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN586012 (Mycobacterium phage Blexus, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

89. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_041986 (Mycobacterium phage Spartacus, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

90. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MG770213 (Mycobacterium phage OldBen, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

91. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_028961 (Mycobacterium phage PopTart, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

92. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

93. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

94. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH155866 (Mycobacterium phage Byougenkin, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

95. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KR997968 (Mycobacterium phage Quico, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

96. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KF017004 (Mycobacteriophage Velveteen, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

97. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH834617 (Mycobacterium phage Lizziana, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

98. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH669009 (Mycobacterium phage Nimbo, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

99. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH371115 (Mycobacterium phage Clifton, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

100. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_041988 (Mycobacterium phage ShiLan, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

101. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH651178 (Mycobacterium phage KristaRAM, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

102. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

103. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

104. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH077580 (Mycobacterium phage Melissauren88, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

105. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT684595 (Mycobacterium phage Mova, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

106. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

107. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK016494 (Mycobacterium phage Filuzino, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

108. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM066034 (Mycobacterium phage Inventum, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

109. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM215148 (Mycobacterium phage Cerasum, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

110. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH399784 (Mycobacterium phage NormanBulbieJr, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

111. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_028792 (Mycobacterium phage Kimberlium, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

112. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

113. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH399771 (Mycobacterium phage ByChance, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

114. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_011288 (Mycobacterium phage Fruitloop, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

115. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN945900 (Mycobacterium phage BodEinwohner17, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

116. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_009820 (Mycobacterium phage Tweety, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

117. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_031262 (Mycobacterium phage Brocalys, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

118. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KY965064 (Mycobacterium phage Pippy, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

119. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

120. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

121. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_013936 (Mycobacterium phage Ardmore, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

122. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN369752 (Mycobacterium phage Flathead, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

123. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KR824843 (Mycobacterium phage Ovechkin, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

124. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to FJ174693 (Mycobacterium phage Ramsey, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

125. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK494118 (Mycobacterium phage Cornucopia, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

126. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN310548 (Mycobacterium phage Juice456, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

127. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KR997930 (Mycobacterium phage Florinda, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

128. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to HQ728524 (Mycobacterium phage Wee, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

129. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH727548 (Mycobacterium phage Galactic, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

130. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MF668270 (Mycobacterium phage Emma, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

131. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH669005 (Mycobacterium phage JoeyJr, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

132. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MF668287 (Mycobacterium phage Wachhund, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

133. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to JN020142 (Mycobacterium phage Mutaforma13, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

134. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN586001 (Mycobacterium phage Donkeykong, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

135. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK875792 (Mycobacterium phage Polka14, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

136. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KF114874 (Mycobacterium phage Bobi, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

137. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

138. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_023728 (Mycobacterium virus DeadP, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

139. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to JN699012 (Mycobacterium phage SG4, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

140. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN586004 (Mycobacterium phage Strokeseat, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

141. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KR997931 (Mycobacterium phage Girafales, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

142. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH316564 (Mycobacterium phage Koella, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

143. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MN204502 (Mycobacterium phage KingMidas, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

144. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT684601 (Mycobacterium phage Hlubikazi, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

145. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

146. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

147. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_022068 (Mycobacteriophage Daenerys, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

148. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MH825707 (Mycobacterium phage MilleniumForce, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

149. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KM347889 (Mycobacterium phage BuzzLyseyear, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

150. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to JF937093 (Mycobacterium virus DLane, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

151. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KT895281 (Mycobacterium phage Cabrinians, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

152. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_025433 (Mycobacteriophage Taj, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

153. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to MK494120 (Mycobacterium phage Piper2020, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

154. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to FJ174692 (Mycobacterium phage Pacc40, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

155. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 4, identity: 0.84

aaccccgcgacagcggatggaccgg	CRISPR spacer
agtaccgcgacagcgcatggaccgg	Protospacer
*.. *********** *********

156. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

157. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015233 (Epibacterium mobile F1926 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

158. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP045411 (Roseovarius sp. THAF8 plasmid pTHAF8_a, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

159. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP045394 (Roseovarius sp. THAF27 plasmid pTHAF27_a, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

160. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP031600 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

161. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

162. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP045405 (Roseovarius sp. THAF9 plasmid pTHAF9_a, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

163. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

164. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP045320 (Roseivivax sp. THAF197b plasmid pTHAF197b_b, complete sequence) position: , mismatch: 5, identity: 0.844

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gccatctgcggccagatcgcgtatctgagccg	Protospacer
*  **********************.*.** *

165. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 5, identity: 0.844

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
cggatggcggtctccagggagatgaggccggc	Protospacer
*************************  .. **

166. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.844

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tggcaacccgaagcgcggcgtcggcatcctca	Protospacer
.  ****** ****************.*****

167. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.844

ctcgccg--aggccgcgcaggatcacgaccaggc	CRISPR spacer
--cgccgtcaggtcgcgcaggatctcgaccagga	Protospacer
  *****  ***.*********** ******** 

168. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.844

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
acctcggcggcagccacgccggcatcgccgtg	Protospacer
***** ****** ************** * * 

169. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.844

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
acctcggcggcagccacgccggcatcgccgtg	Protospacer
***** ****** ************** * * 

170. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
accgcgccgggccgctggtagccgggccgcgc	Protospacer
* ****.*****.**************** *.

171. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 5, identity: 0.844

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
atcgcgtcgtgctgctggaagccgggccgcgg	Protospacer
* ******* ******** ********** * 

172. spacer 5.6|1557712|31|CP032266|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 5, identity: 0.839

cggaccgcgatgcctgaccagatg-acccgtc	CRISPR spacer
gggaccgcgttgtctgaccagatgtacctgt-	Protospacer
 ******** **.*********** ***.** 

173. spacer 5.6|1557712|31|CP032266|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 5, identity: 0.839

cggaccgcgatgcctgaccagatg-acccgtc	CRISPR spacer
gggaccgcgttgtctgaccagatgtacctgt-	Protospacer
 ******** **.*********** ***.** 

174. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 5, identity: 0.821

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ctgccccggcccgccctcgcccgagacc	Protospacer
 ****************** *** *. *

175. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 5, identity: 0.821

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ggggaccggccggccctcgaccgggggc	Protospacer
* *  ****** *********** ****

176. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
gtcccccggcccggcctcgaccgggacc	Protospacer
** ********** ********* *. *

177. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
gtcccccggcccggcctcgaccgggacc	Protospacer
** ********** ********* *. *

178. spacer 15.1|4481067|25|CP032266|CRISPRCasFinder matches to NC_023722 (Rhodococcus phage ReqiPine5, complete genome) position: , mismatch: 5, identity: 0.8

aaccccgcgacagcggatggaccgg	CRISPR spacer
tcgccctcgacagcggatggaccgt	Protospacer
   *** ***************** 

179. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

180. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

181. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

182. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

183. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

184. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

185. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

186. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

187. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

188. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

189. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

190. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

191. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

192. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

193. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

194. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

195. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

196. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

197. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

198. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

199. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

200. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

201. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

202. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

203. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

204. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

205. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

206. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

207. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

208. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

209. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

210. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

211. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

212. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

213. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

214. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

215. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

216. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

217. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

218. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

219. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

220. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

221. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

222. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

223. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

224. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

225. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

226. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

227. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

228. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

229. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

230. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

231. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

232. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

233. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

234. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

235. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

236. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

237. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

238. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

239. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

240. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

tcagggcaaggacagcctgaccgacac	CRISPR spacer
cgatggcaaggacaccctgaccgacgc	Protospacer
. * ********** **********.*

241. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 6, identity: 0.812

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gggctgttcggccagatcgcgtaccagggcgg	Protospacer
*.* * * ***************.* ******

242. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP013104 (Bradyrhizobium elkanii USDA 61 plasmid pBel61, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccgc-acgccccgagccgatccggccgggg	CRISPR spacer
-ggctgcaacgcaccgagccgatccggccggtg	Protospacer
  .*.** **** ****************** *

243. spacer 3.6|1543773|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 6, identity: 0.812

--tgtcggctcacggcttcgctccgtcctgccgt	CRISPR spacer
gcggtcg--tcacggctgcgccccgtcctgccgc	Protospacer
   ****  ******** ***.***********.

244. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

-tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
tcggcgtggg-tgtcggagcaggagcgggcgca	Protospacer
 .** ***** *****************.** .

245. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.812

-tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
tcggcgtggg-tgtcggagcaggagcgggcgca	Protospacer
 .** ***** *****************.** .

246. spacer 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 6, identity: 0.812

cccgca-gacgaccccgcagccgtcttccccga	CRISPR spacer
-caacacgacgaccccgcagccgtctccccaaa	Protospacer
 * .** *******************.*** .*

247. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 6, identity: 0.812

ctcgccg-aggccgcgcaggatcacgaccaggc	CRISPR spacer
-gcgcggcagcccgcgcaggatctcgaccagac	Protospacer
  *** * ** ************ *******.*

248. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 6, identity: 0.812

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tcgtccgcgacatccacgccggcaccgagcac	Protospacer
 * ******.**************.*** * *

249. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.812

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
attttcgcggcatcaacgccggcatcgagcgc	Protospacer
*..*.********* ************* * *

250. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.812

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
attttcgcggcatcgacgccggcatcgagcgc	Protospacer
*..*.********* ************* * *

251. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gccagcgcggcatcgacgccggcatcgaattc	Protospacer
.**  ********* ************* .**

252. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 6, identity: 0.812

--ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
ttggaccgtcgc--gccgctcctgcgggagctgg	Protospacer
    **** ***  **************** ***

253. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NC_012797 (Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence) position: , mismatch: 6, identity: 0.812

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
cccgatcggccccgggccacggccgcccgggc	Protospacer
 *** . ********** ******** *****

254. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 6, identity: 0.812

accgccag--gccccgggcgacggccgcgcgggc	CRISPR spacer
--cgcccgtcgcgccgggcgacggccgtgcggga	Protospacer
  **** *  ** **************.***** 

255. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcgaccgccgcgtccgccggtcgcgcgcga	Protospacer
***** ****************** ** * . 

256. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812

-aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
gaacg-gccgggctgctggtcggcgggccggtg	Protospacer
 **** *.************ * ********  

257. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 6, identity: 0.812

-aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
gaacg-gccgggctgctggtcggcgggccggtg	Protospacer
 **** *.************ * ********  

258. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022578 (Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence) position: , mismatch: 6, identity: 0.812

tggaggacggcctgctcgaccaggaagcggtc--	CRISPR spacer
ttgacgatggcctgctcgaccagga--tggtcgg	Protospacer
* ** **.*****************  .****  

259. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

tggaggacggcctgctcgaccaggaagcggtc--	CRISPR spacer
tcgacgacggcctgctccaccagga--tggtcgg	Protospacer
* ** ************ *******  .****  

260. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 6, identity: 0.812

gtcgacacggacggctcggagctggccgagcc-	CRISPR spacer
gtcgagaaggacggctcggagct-tctgagcga	Protospacer
***** * ***************  *.****  

261. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 6, identity: 0.812

gtcgacacggacggctcggagctggccgagcc-	CRISPR spacer
gtcgagaaggacggctcggagct-tctgagcga	Protospacer
***** * ***************  *.****  

262. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 6, identity: 0.812

gtcgacacggacggctcggagctggccgagcc-	CRISPR spacer
gtcgagaaggacggctcggagct-tctgagcga	Protospacer
***** * ***************  *.****  

263. spacer 5.2|1557711|32|CP032266|PILER-CR,CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 6, identity: 0.812

gcggaccgcgatgcctgaccagatg-acccgtc	CRISPR spacer
cgggaccgcgttgtctgaccagatgtacctgt-	Protospacer
  ******** **.*********** ***.** 

264. spacer 5.2|1557711|32|CP032266|PILER-CR,CRISPRCasFinder matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 6, identity: 0.812

gcggaccgcgatgcctgaccagatg-acccgtc	CRISPR spacer
cgggaccgcgttgtctgaccagatgtacctgt-	Protospacer
  ******** **.*********** ***.** 

265. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
cgaccctggcccgccctcgacagcgggg	Protospacer
  .***.************** ***** 

266. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
gcgccccggcccgccctcgaaagcgacg	Protospacer
*.******************  ***.  

267. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ccccaccggcccgccctcgcccgagggc	Protospacer
 . * ************** *** ****

268. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ctgccccggcccggcctcgatcgccatc	Protospacer
 ************ ******.*** . *

269. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ctgccccggcccggcctcgatcgccatc	Protospacer
 ************ ******.*** . *

270. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 6, identity: 0.786

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
ctgccccggcccggcctcgatcgccatc	Protospacer
 ************ ******.*** . *

271. spacer 16.1|4876978|27|CP032266|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.778

tcagggcaaggacagcctgaccgacac	CRISPR spacer
agagggcaaggacagcctgtccgcccg	Protospacer
  ***************** *** *  

272. spacer 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tccttcagggccttgttctggctcggcatcgc	CRISPR spacer
tccgtatcggccttgttctcgctcagcatcgt	Protospacer
*** *   *********** ****.******.

273. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
tccaaaagcgccccgagccgatctggccgggg	Protospacer
**   . .***************.********

274. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
tccaaaagcgccccgagccgatctggccgggg	Protospacer
**   . .***************.********

275. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
tccaaaagcgccccgagccgatctggccgggg	Protospacer
**   . .***************.********

276. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
tccaaaagcgccccgagccgatctggccgggg	Protospacer
**   . .***************.********

277. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
cgacggagcgccccgagccgacctggccgggg	Protospacer
. ** * .*************.*.********

278. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
cgacggagcgccccgagccgacctggccgggg	Protospacer
. ** * .*************.*.********

279. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 7, identity: 0.781

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
cgacggagcgccccgagccgacctggccgggg	Protospacer
. ** * .*************.*.********

280. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

281. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

282. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

283. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

284. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

285. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

286. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

287. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

288. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

289. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

290. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

291. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

292. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

293. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

294. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

295. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

296. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

297. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

298. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

299. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

300. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

301. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

302. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

303. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

304. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

305. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

306. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

307. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

308. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

309. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

310. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

311. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

312. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 7, identity: 0.781

----tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ggctgcaacgcacg----gagccgatccggccggtg	Protospacer
     ** ******    **************** *

313. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 7, identity: 0.781

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gccagcgcggtctccagcgggatgactttcgc	Protospacer
   *  *********** *.************

314. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP025805 (Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
gcgcggcaccaaccgcggcctcggcaccctca	Protospacer
 * *..* **** ****** ************

315. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 7, identity: 0.781

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
caccttcaccaagcgcggcgccggcaacctca	Protospacer
* .*  * ************.***** *****

316. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcgggcgca	Protospacer
************* ******.*   * *.***   

317. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcgggcgca	Protospacer
************* ******.*   * *.***   

318. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcgggcgca	Protospacer
************* ******.*   * *.***   

319. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
cgcgccgaggtcgcgcaggagcacggcacggg	Protospacer
* ********.********* ****.*  ** 

320. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcgggcgca	Protospacer
************* ******.*   * *.***   

321. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcgggcgca	Protospacer
************* ******.*   * *.***   

322. spacer 4.5|1554631|32|CP032266|CRISPRCasFinder,CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 7, identity: 0.781

cggcgcaggccgaccccaccagctttgcactg	CRISPR spacer
cggcgcaggccgaccccaccggccaggaatcg	Protospacer
********************.**.  * *..*

323. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tgatccgcggcacccacgccgacatcgacgtg	Protospacer
   *********.********.******* * 

324. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tgatccgcggcacccacgccgacatcgacgtg	Protospacer
   *********.********.******* * 

325. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gcacgcgcagcgtccacgccggcatcgaccgc	Protospacer
.* . ***.**.****************** *

326. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

327. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gcacgcgcagcgtccacgccggcatcgaccgc	Protospacer
.* . ***.**.****************** *

328. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
ccagcgccggcatcaccgccggcatcgacctc	Protospacer
 *  *  *******  ****************

329. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

330. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

331. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

332. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

333. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

334. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

335. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

336. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

337. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

338. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

339. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 7, identity: 0.781

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cgagcgccggcatcaccgccggcatcgacctc	Protospacer
     **     *******  ****************

340. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
acaccgctggcgtccacgctggcatcgacctc	Protospacer
** .*  .***.*******.************

341. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to MT521995 (Gordonia phage Moosehead, complete genome) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
ccatgagccgcatccaggccggcatcgaccgc	Protospacer
 * *  ** ******* ************* *

342. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
aactccgcggcatcgccgccggcatgtgccgc	Protospacer
* ************  *********  .** *

343. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gcatcgacggcatcgacgccggcgtcgaccgc	Protospacer
.* ** .******* ********.****** *

344. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
aactccgcggcatcgccgccggcatgtgccgc	Protospacer
* ************  *********  .** *

345. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015319 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123a) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
tcggcatcatcgctgcccgcaacgatcgcttc	Protospacer
.**.**.******************.  *.**

346. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

347. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

348. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

349. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

350. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

351. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

352. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

353. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

354. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

355. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

356. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

357. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

358. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccagcacaaccgctgcccgcaacgacgggccc	Protospacer
**..*** *.*****************  *.*

359. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 7, identity: 0.781

tgaccccgggcccgcccggcaggcgaatgcgc----	CRISPR spacer
tgaccccggccccgtccggcaggc----ccgccgcg	Protospacer
********* ****.*********     ***    

360. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.781

-tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
gcggcgcc-cgcccgcccggcaggaaaatgcgc	Protospacer
 .*.* **  ************** .*******

361. spacer 4.13|1555119|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 7, identity: 0.781

tcctgctcgatgagccgcatgctcacggcggc	CRISPR spacer
gcctgctcgatgagccgcatgaacaccggccc	Protospacer
 ********************  *** *   *

362. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
ccgccgacgcgggccgctcctgcgcgcagcac	Protospacer
**.********************* * .*.. 

363. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
atggccaggcccagggcggcggccgcctggac	Protospacer
*. ********* *****.******* .**.*

364. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccaggcccagggcgacggccgcggagag	Protospacer
 * ********* ************** .*. 

365. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 7, identity: 0.781

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
accgccaggacccgggccacggcgtcgagctc	Protospacer
********* ******* *****  ** *  *

366. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

--accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
gggccggc--gccccgggcgccggccgggcgggg	Protospacer
  .*** *  ********** ****** ***** 

367. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to KY000034 (Agrobacterium sp. strain C58PMP90 plasmid pTi_C58PMP90, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

368. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to KY000036 (Agrobacterium sp. strain GV3101 plasmid pTi_GV3101, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

369. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032929 (Agrobacterium tumefaciens strain 1D1460 plasmid pTi1D1460, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

370. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP039926 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

371. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP033033 (Agrobacterium tumefaciens strain 12D1 plasmid pTi12D1, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

372. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP030831 (Neorhizobium sp. NCHU2750 plasmid pTiNCHU2750, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

373. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_003065 (Agrobacterium fabrum str. C58 plasmid Ti, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

374. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK439382 (Agrobacterium tumefaciens strain CFBP2178 plasmid pTiCFBP2178, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

375. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK439383 (Agrobacterium tumefaciens strain CFBP1935 plasmid pTiCFBP1935, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

376. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK318973 (Agrobacterium rhizogenes strain Colt5.8 plasmid pOC-Colt5.8, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

377. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK318986 (Agrobacterium rhizogenes strain C6.5 plasmid pTiC6.5, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

378. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK439385 (Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

379. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK439384 (Agrobacterium tumefaciens strain Kerr108 plasmid pTiKerr108, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

380. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MK439381 (Agrobacterium tumefaciens strain Sule1 plasmid pTiSule1, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

381. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_MF511177 (Agrobacterium rhizogenes strain C5.7 plasmid pTiC5.7, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

382. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000068 (Agrobacterium deltaense strain Tun151 plasmid pTi_Tun151, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

383. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000052 (Agrobacterium tumefaciens strain CFBP7000 plasmid pTi_CFBP7000, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

384. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000049 (Agrobacterium rhizogenes strain CFBP4423 plasmid pTi_CFBP4423, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

385. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000055 (Agrobacterium rubi strain Tun159 plasmid pTi_Tun159, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

386. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000048 (Agrobacterium rhizogenes strain CFBP2746 plasmid pTi_CFBP2746, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

387. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000053 (Agrobacterium genomosp. 1 strain DC12-001 plasmid pTi_DC12-001, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

388. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000054 (Agrobacterium tumefaciens strain Tun154 plasmid pTi_Tun154, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

389. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KY000051 (Agrobacterium genomosp. 1 strain CFBP5503 plasmid pTi_CFBP5503, complete sequence) position: , mismatch: 7, identity: 0.781

gcgattctggctcaggctga-----tgctgaccagtg	CRISPR spacer
gcggttctggctcaggctgacgccttgccgac-----	Protospacer
***.****************     ***.***     

390. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
accatggtcaggatcaggttccggtaggtgag	Protospacer
 **. * ****************** ****  

391. spacer 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 7, identity: 0.781

gtcttcatcttcgccagccgctgctgaatctt	CRISPR spacer
gtctgcatcttcgcccgccgctgatcgaacat	Protospacer
**** ********** ******* * .* * *

392. spacer 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 7, identity: 0.781

gtcttcatcttcgccagccgctgctgaatctt	CRISPR spacer
gtctgcatcttcgcccgccgctgatcgaacat	Protospacer
**** ********** ******* * .* * *

393. spacer 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 7, identity: 0.781

gtcttcatcttcgccagccgctgctgaatctt	CRISPR spacer
gtctgcatcttcgcccgccgctgatcgaacat	Protospacer
**** ********** ******* * .* * *

394. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

--tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cgccgat--agcgggtgagagggcgggggcgagc	Protospacer
  .**.*  .** ************ ********

395. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781

gtctcgtagaacgtctcggcgatcagcgggcc--	CRISPR spacer
gtctcgtcgaacgtcgcggcgat--gtcgcccag	Protospacer
******* ******* *******  *. * **  

396. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781

gtctcgtagaacgtctcggcgatcagcgggcc--	CRISPR spacer
gtctcgtcgaacgtcgcggcgat--gtcgcccag	Protospacer
******* ******* *******  *. * **  

397. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
tgccgtccgccccggccgccggtctcccggtc	Protospacer
.* ******** ** ***********  ** *

398. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcttccgccgcgtccgcccgtgcctcggcc	Protospacer
**** *************** ** .*  ** *

399. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcttccgccgcgtccgcccgtgcctcggcc	Protospacer
**** *************** ** .*  ** *

400. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcttccgccgcgtccgcccgtgcctcggcc	Protospacer
**** *************** ** .*  ** *

401. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcttccgccgcgtccgcccgtgcctcggcc	Protospacer
**** *************** ** .*  ** *

402. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcttccgccgcgtccgcccgtgcctcggcc	Protospacer
**** *************** ** .*  ** *

403. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.781

-aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
tgatccg-cggccagctggtagccgggccggga	Protospacer
 .*. ** *** * ****************** 

404. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018234 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tcgataccgtcctggtcgaccaggaagcggtt	Protospacer
* ** . ** **** ****************.

405. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tggaggacgccctgctcgaccggggcgtgcgc	Protospacer
********* ***********.**. *.*  *

406. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tcgataccgtcctgatcgaccaggaagcggtt	Protospacer
* ** . ** **** ****************.

407. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021815 (Sinorhizobium meliloti strain M270 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tcgataccgtcctgatcgaccaggaagcggtt	Protospacer
* ** . ** **** ****************.

408. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggac-ggcctgctcgaccaggaagcggtc	CRISPR spacer
-gcatcacgggcctcctcgaccaggtagcggta	Protospacer
 * *  ** ***** ********** ****** 

409. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 7, identity: 0.781

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tcgacaagcgcctgcgcgaccaggatgcggtc	Protospacer
* ** .*  ****** ********* ******

410. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 7, identity: 0.781

gtcgac--acggacggctcggagctggccgagcc	CRISPR spacer
--cggccgatggacggctcggggctggccgcgcg	Protospacer
  **.*  *.***********.******** ** 

411. spacer 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 7, identity: 0.781

tcctgttcggctgctaccagccgcgcgacctc	CRISPR spacer
gcatcttaagcagctacctgccgcgcgacctc	Protospacer
 * * ** .** ****** *************

412. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014516 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
tagctggccgcgccggacccagtcgccggtgg	Protospacer
.** ****************.*****.* *  

413. spacer 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014708 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_4p, complete sequence) position: , mismatch: 7, identity: 0.781

-tgctctccggggccgggcaggaccgtctcggc	CRISPR spacer
atgatc-gaggggccgggagggaccgtctcggg	Protospacer
 ** **   ********* .************ 

414. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 7, identity: 0.781

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
acgaggccgagatccacgccgatcacccggcc	Protospacer
* ** ******.***************. . *

415. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 7, identity: 0.781

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
acgaggccgagatccacgccgatcacccggcc	Protospacer
* ** ******.***************. . *

416. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
aggatgccgaggtccgcgcccatgagcagatc	Protospacer
***************.**** ** * *  * *

417. spacer 5.7|1557773|30|CP032266|CRT matches to NZ_CP014515 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767

ccagccaccccacctacggcaaggcgacac	CRISPR spacer
gtaatcaccccacctacggcaagcccactc	Protospacer
 .*..****************** * ** *

418. spacer 5.8|1557833|31|CP032266|CRT matches to NZ_CP024587 (Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
atgcgtctcgccaccggcccctgcgccgagg	Protospacer
*** .   ************** ******* 

419. spacer 5.8|1557833|31|CP032266|CRT matches to CP003953 (Rhodococcus opacus PD630 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.774

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
atcgtcggccccaccggcgccttcgccgact	Protospacer
** .  *** ******** ********** *

420. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 7, identity: 0.774

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
cttccggcgaccaagaaggggatgtcccctg	Protospacer
.*  *********.*************.*  

421. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
gtcacggggaccaggaaggggacgtcggggt	Protospacer
 * **** **************.***   **

422. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 7, identity: 0.781

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
gaccttccggcgaccaagaaggggatgtcccc	Protospacer
 * .*  *********.*************.*

423. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 7, identity: 0.781

-tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
tcagccaac-gcgaactggaaggggatgtcctc	Protospacer
 .**...** **** * ****************

424. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
acgccccggcccgccctggaccgctaca	Protospacer
..*************** ****** .  

425. spacer 9.1|2471802|28|CP032266|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.75

gtgccccggcccgccctcgaccgcgggc	CRISPR spacer
acgccccgccccgccctcggccgcgtca	Protospacer
..****** **********.*****   

426. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
gaacttgccggccagctcgcgtatccgcgcgc	Protospacer
**. *.  ******* *********** *** 

427. spacer 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

tccttcagggccttgttctggctcggcatcgc	CRISPR spacer
gtcatgatggccttgtcctcgctcggcatcga	Protospacer
 .* * * ********.** *********** 

428. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT889373 (Arthrobacter phage Brynnie, complete genome) position: , mismatch: 8, identity: 0.75

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
acaagcagggccccgagtcgatccggccgggg	Protospacer
 **    . ********.**************

429. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT498036 (Gordonia Phage Zitch, complete genome) position: , mismatch: 8, identity: 0.75

tcaccgcacgccccgagccgatccggccgggg--	CRISPR spacer
tcaccgcacgtcccgagtcgatc--gacgaactc	Protospacer
**********.******.*****  * **..   

430. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KU160644 (Arthrobacter phage Galaxy, complete genome) position: , mismatch: 8, identity: 0.75

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
tcaagcagggccccgagtcgttccggccgggg	Protospacer
***    . ********.** ***********

431. spacer 3.7|1543834|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ctgatgagcagtaccggcgcggccgaacggtt	CRISPR spacer
ttgatggtcagtaccggcgcggccgcggcgct	Protospacer
.*****. ***************** .  *.*

432. spacer 3.9|1543956|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccatgacgcgccgccatgatcctcgtg	CRISPR spacer
ggcggccatcgcgcgccgccatgacgtgcgca	Protospacer
********* .*************. . **..

433. spacer 3.9|1543956|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047636 (Klebsiella pneumoniae strain K2606 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ggcggccatgacgcgccgccatgatcctcgtg	CRISPR spacer
gattggcatgacacgccgccttgatcctcaag	Protospacer
*.. * ******.******* ********. *

434. spacer 3.10|1544017|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016621 (Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

cgggtggca---gttcaggaggcgaggcgtacggg	CRISPR spacer
---attgaacacgttcaggaggcgagacgtatggg	Protospacer
   .* * *   **************.****.***

435. spacer 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tcctcaccatgccccggcaccgcttcgaacag	CRISPR spacer
accgcaccatgccgcggcaccgcttcttctcg	Protospacer
 ** ********* ************   . *

436. spacer 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tcctcaccatgccccggcaccgcttcgaacag	CRISPR spacer
tccaggccatacccgggcaccgcttcgaagct	Protospacer
***  .****.*** **************   

437. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KT373978 (Mycobacterium phage Ukulele, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

438. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919525 (Mycobacterium phage Murica, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

439. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF668277 (Mycobacterium phage MadamMonkfish, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

440. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK433262 (Mycobacterium phage Nimrod, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

441. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK016498 (Mycobacterium phage Manda, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

442. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

443. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH651174 (Mycobacterium phage Easy2Say, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

444. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

445. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

446. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT114165 (Mycobacterium phage BadStone, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

447. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG872831 (Mycobacterium phage Asriel, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

448. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

449. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

450. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KX834009 (Mycobacterium phage Goldilocks, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

451. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG099953 (Mycobacterium phage Youngblood, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

452. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

453. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK359320 (Mycobacterium phage Cookies, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

454. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

455. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

456. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH536829 (Mycobacterium phage TBrady12, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

457. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN096364 (Mycobacterium phage Tomaszewski, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

458. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH590587 (Mycobacterium phage xkcd, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

459. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH371112 (Mycobacterium phage Adnama, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

460. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919541 (Mycobacterium phage YassJohnny, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

461. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KX611831 (Mycobacterium phage Pharsalus, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

462. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_042027 (Mycobacterium phage Pumpkin, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

463. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF493883 (Mycobacterium phage Mosby, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

464. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH513978 (Mycobacterium phage Phaja, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

465. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN428059 (Mycobacterium phage Kanye, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

466. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

467. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH399778 (Mycobacterium phage Icee, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

468. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919529 (Mycobacterium phage Sassay, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

469. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH513972 (Mycobacterium phage IHOP, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

470. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586051 (Mycobacterium phage Myrale, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

471. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK359309 (Mycobacterium phage Czyszczon1, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

472. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KU865303 (Mycobacterium phage TeardropMSU, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

473. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586041 (Mycobacterium phage Elite2014, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

474. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

475. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

476. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

477. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

478. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JF937106 (Mycobacterium phage SirDuracell, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

479. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KC748969 (Mycobacterium phage Phaux, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

480. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH536827 (Mycobacterium phage Simpliphy, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

481. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

482. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586035 (Mycobacterium phage ChosenOne, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

483. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

484. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to DQ398041 (Mycobacterium virus 244, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

485. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG872832 (Mycobacterium phage Barbarian, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

486. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_029079 (Mycobacterium phage Dusk, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

487. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586032 (Mycobacterium phage Command613, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

488. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

489. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

490. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_022065 (Mycobacterium phage Contagion, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

491. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KX817173 (Mycobacterium phage Tuco, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

492. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

493. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG757160 (Mycobacterium phage Kimchi, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

494. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN096361 (Mycobacterium phage Gator, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

495. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586013 (Mycobacterium phage Traaww1, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

496. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

497. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

498. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF306380 (Mycobacterium phage DrDrey, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

499. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH576956 (Mycobacterium phage Inca, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

500. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK620893 (Mycobacterium phage HanKaySha, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

501. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH779503 (Mycobacterium phage Gemini, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

502. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

503. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

504. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586050 (Mycobacterium phage Lilpickle, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

505. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

506. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF562099 (Mycobacterium phage Bruin, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

507. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

508. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

509. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

510. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF562100 (Mycobacterium phage HufflyPuff, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

511. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MG872837 (Mycobacterium phage Gage, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

512. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

513. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_008194 (Mycobacterium phage 244, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

514. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

515. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF188414 (Mycobacterium phage ABCat, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

516. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JN006062 (Mycobacterium phage Rakim, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

517. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

518. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

519. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

520. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH399774 (Mycobacterium phage DoctorDiddles, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

521. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

522. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_028785 (Mycobacterium phage NelitzaMV, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

523. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586044 (Mycobacterium phage Rimmer, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

524. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

525. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KT020852 (Mycobacterium phage NoSleep, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

526. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK559429 (Mycobacterium phage Moldemort, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

527. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919535 (Mycobacterium phage Terminus, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

528. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

529. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_021305 (Mycobacterium phage Murphy, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

530. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF919540 (Mycobacterium phage Willez, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

531. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT522005 (Mycobacterium phage Misfit, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

532. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586037 (Mycobacterium phage GooberAzure, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

533. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

534. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to EU816591 (Mycobacterium phage Kostya, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

535. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

536. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

537. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

538. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MH513983 (Mycobacterium phage ShereKhan, complete genome) position: , mismatch: 8, identity: 0.75

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
gggatggtggtctccagggtgatgacgatgcg	Protospacer
 ******.*********** ******  *   

539. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gcgggcgggctgtcggggcaggagcagcggcg	Protospacer
  ***.**********.********.*  * *

540. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP013974 (Erwinia phage LS-2018a, complete sequence) position: , mismatch: 8, identity: 0.75

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gcggctaccctgacagagcaggagcggacggg	Protospacer
  ** *.  *** *.*****************

541. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP013974 (Erwinia phage LS-2018a, complete sequence) position: , mismatch: 8, identity: 0.75

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gcggctaccctgacagagcaggagcggacggg	Protospacer
  ** *.  *** *.*****************

542. spacer 3.18|1544505|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_015592 (Sinorhizobium meliloti AK83 plasmid pSINME02, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgatctcatccgccgctaccctgccag	CRISPR spacer
ctgatcgatctcagccgccgctatcctggctt	Protospacer
** ..******** *********.**** *  

543. spacer 3.18|1544505|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021213 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11a, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgatctcatccgccgctaccctgccag	CRISPR spacer
ctgatcgatctcagccgccgctatcctggctt	Protospacer
** ..******** *********.**** *  

544. spacer 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

cccgcagacgaccccgcagccgtcttccccga	CRISPR spacer
caagctcgcgaccccgcagccgtcgaccccgg	Protospacer
*  **  .****************  *****.

545. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

546. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP030179 (Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

547. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP030170 (Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

548. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP030162 (Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

549. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017192 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

550. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023287 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

551. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023287 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

552. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP030160 (Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

553. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018465 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.4, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

554. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

555. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

556. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018860 (Xanthomonas citri pv. citri strain LH201 plasmid pLH201.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

557. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018860 (Xanthomonas citri pv. citri strain LH201 plasmid pLH201.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

558. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018852 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

559. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018852 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

560. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018849 (Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

561. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018849 (Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

562. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
cgccgtgtccaagcgcggcatcggcaccatca	Protospacer
* .*.  .***********.******** ***

563. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022266 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plB, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

564. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011165 (Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc32, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

565. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018856 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

566. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022425 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

567. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_003921 (Xanthomonas citri pv. citri str. 306 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

568. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024030 (Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

569. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024031 (Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

570. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
cgtcaacctcaagggcggcgtcggcaagaccc	Protospacer
* ******.**** ************   .* 

571. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP006855 (Xanthomonas citri subsp. citri A306 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

572. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009011 (Xanthomonas citri pv. citri strain JX4 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

573. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009012 (Xanthomonas citri pv. citri strain JX4 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

574. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020888 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

575. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP022269 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plB, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

576. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008996 (Xanthomonas citri pv. citri strain MN12 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

577. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008997 (Xanthomonas citri pv. citri strain MN12 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

578. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013664 (Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

579. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013665 (Xanthomonas citri pv. citri strain jx-6 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

580. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008999 (Xanthomonas citri pv. citri strain MN11 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

581. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009000 (Xanthomonas citri pv. citri strain MN11 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

582. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024032 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

583. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024033 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

584. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to CP030167 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

585. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021022 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

586. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023156 (Xanthomonas citri pv. malvacearum strain AR81009 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

587. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011162 (Xanthomonas citri pv. aurantifolii strain FDC 1559 plasmid pXfc38, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

588. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023161 (Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

589. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009026 (Xanthomonas citri pv. citri strain 5208 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

590. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009014 (Xanthomonas citri pv. citri strain GD3 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

591. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009015 (Xanthomonas citri pv. citri strain GD3 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

592. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_007506 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

593. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_020801 (Xanthomonas axonopodis Xac29-1 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

594. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008993 (Xanthomonas citri pv. citri strain NT17 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

595. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008994 (Xanthomonas citri pv. citri strain NT17 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

596. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009008 (Xanthomonas citri pv. citri strain JX5 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

597. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009009 (Xanthomonas citri pv. citri strain JX5 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

598. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017022 (Xanthomonas citri pv. malvacearum strain MSCT plasmid pMSCT44kb, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

599. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013005 (Xanthomonas citri pv. malvacearum strain XcmH1005 plasmid pXcmH, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

600. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009002 (Xanthomonas citri pv. citri strain MN10 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

601. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009003 (Xanthomonas citri pv. citri strain MN10 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

602. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009018 (Xanthomonas citri pv. citri strain GD2 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

603. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009021 (Xanthomonas citri pv. citri strain FB19 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

604. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008987 (Xanthomonas citri pv. citri strain UI7 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

605. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008988 (Xanthomonas citri pv. citri strain UI7 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

606. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_020797 (Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

607. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009005 (Xanthomonas citri pv. citri strain MF20 plasmid pXAC33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

608. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009006 (Xanthomonas citri pv. citri strain MF20 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

609. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP046021 (Xanthomonas citri pv. malvacearum strain HD-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

610. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP008991 (Xanthomonas citri subsp. citri UI6 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

611. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_003922 (Xanthomonas citri pv. citri str. 306 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

612. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011251 (Xanthomonas citri pv. aurantifolii strain FDC 1561 plasmid pXfb33, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacaccaagggcggcgtcggcaagacca	Protospacer
. ***** ***** ************   .**

613. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018222 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence) position: , mismatch: 8, identity: 0.75

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
caacaaccgcaagggcggcgtcggcaagacca	Protospacer
*  ***** **** ************   .**

614. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaggcggcgcaggattaccgcgtcgt	Protospacer
*********** *********.** .*   *.

615. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaggcggcgcaggattaccgcgtcgt	Protospacer
*********** *********.** .*   *.

616. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ggagacccggccgcgcaggatcacgtccaggt	Protospacer
   * *  ***************** *****.

617. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
cggggtcaggccgcgcaggatcgcgaccagcg	Protospacer
*  * . ***************.*******  

618. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ggagacccggccgcgcaggatcacgtccaggt	Protospacer
   * *  ***************** *****.

619. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
cggggtcaggccgcgcaggatcgcgaccagcg	Protospacer
*  * . ***************.*******  

620. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
cgggttcaggccgcgcaggatcgcgaccagcg	Protospacer
*  *.. ***************.*******  

621. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gctgccgagcccgcccaggatcacgaccgtga	Protospacer
 ..****** **** *************. * 

622. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to MT521991 (Streptomyces phage Eklok, complete genome) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gacgccgaggccgagcaggatcacggacgtgg	Protospacer
  *********** ***********. *. * 

623. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaggcggcgcaggattaccgcgtcgt	Protospacer
*********** *********.** .*   *.

624. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaggcggcgcaggattaccgcgtcgt	Protospacer
*********** *********.** .*   *.

625. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
cggggtgagaccgcgcaggatcgcgaccagcg	Protospacer
*  * .***.************.*******  

626. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaggccgcgcggcatcagcagcgagt	Protospacer
****************.* ****  * *..*.

627. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_015188 (Acidiphilium multivorum AIU301 plasmid pACMV4, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
atcgccgcggccgcgccggatcaccgcaagat	Protospacer
 ****** ******** ******* .* **..

628. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gccgccgaagccgagcaggatcacggcgcggt	Protospacer
 .******.**** ***********.*  **.

629. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcggacgca	Protospacer
************* ******.*   * *.*.*   

630. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.75

-ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggcacc-agcccgcgcaggatcgcgaccagcg	Protospacer
   *.** ** ************.*******  

631. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcggacgca	Protospacer
************* ******.*   * *.*.*   

632. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccgaggccgcgcaggatcacgaccaggc---	CRISPR spacer
ctcgccgaggccgagcaggacc---agcggacgca	Protospacer
************* ******.*   * *.*.*   

633. spacer 4.5|1554631|32|CP032266|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75

cggcgcaggccgaccccaccagctttgcactg	CRISPR spacer
tcgcgcacgccgaccccaccagctgtgcggcc	Protospacer
. ***** **************** ***. . 

634. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
agaaacgcggcagcgacgccggcatcgaccgg	Protospacer
*    ******* * ***************  

635. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tggtggtcggcatcgacgccggcctcgacctc	Protospacer
   *   ******* ******** ********

636. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
agcgtggcggcatccacgccggcttcggccag	Protospacer
* * . ***************** ***.**  

637. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
acctgcgcggcatcgacgccggcaccctgtgc	Protospacer
**** ********* *********.*   . *

638. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tgatccgcggcatgctcgccggcatcgggctg	Protospacer
   ********** * ***********. ** 

639. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
ttgtccgcggcatccgcgccggcgtcgtgcac	Protospacer
 . ************.*******.***  * *

640. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tggtccgcggcatccgcgccggcgtcgtgcac	Protospacer
   ************.*******.***  * *

641. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tggtccgcggcatccgcgccggcgtcgtgcac	Protospacer
   ************.*******.***  * *

642. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tggtccgcggcatccgcgccggcgtcgtgcac	Protospacer
   ************.*******.***  * *

643. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75

acctccg-----cggcatccacgccggcatcgacctc	CRISPR spacer
-----cggagttcggcatggacgccggcatcgaccgc	Protospacer
     **     ******  *************** *

644. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gcggacgccgcgtccacgccggcatcgaggtc	Protospacer
.*   *** **.****************  **

645. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
attttcgcggcgtcaacgccggcatcgagtgc	Protospacer
*..*.******.** ************* . *

646. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tccgctcgcgcatccacgacggcatccacctc	Protospacer
 ** *.   ********* ******* *****

647. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
acagcggcgtcatccacgccggcatctactat	Protospacer
**  * *** **************** **. .

648. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to MN908685 (Microbacterium phage PauloDiaboli, complete genome) position: , mismatch: 8, identity: 0.75

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
cctacaccattgctgcccgcaacgcctactca	Protospacer
** *******.************* *  *.. 

649. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 8, identity: 0.75

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccccctatgtcgctgcccgtaacgacgtactc	Protospacer
**  *  ..**********.******** ***

650. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 8, identity: 0.75

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
ccccctatgtcgctgcccgtaacgacgtactc	Protospacer
**  *  ..**********.******** ***

651. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gacgaggcggacctggacgaactctcgcgctt	Protospacer
  ********.********* ****** . *.

652. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gaagtggcggtcctggacggcctctcgggctc	Protospacer
   * ***** ********.********. **

653. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011000 (Sinorhizobium meliloti strain USDA1963 plasmid pHRB800, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgaggcgggcctggacgacctc--tcggaatc	CRISPR spacer
atcgcggcgggcctggacgatctcgtccataa--	Protospacer
 *** ***************.***  .*. **  

654. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gaagtggcggtcctggacggcctctcgggctc	Protospacer
   * ***** ********.********. **

655. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.75

tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
cggtcccgggctcgaccggcaggcgaattggt	Protospacer
.*..*******.** *************  *.

656. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

--tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
cctga--tcgggcccgcccgggcggcgaatgaaa	Protospacer
  ***  .*************  ******** . 

657. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

--tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
cctga--tcgggcccgcccgggcggcgaatgaaa	Protospacer
  ***  .*************  ******** . 

658. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
cgccgaccggcccgcccggccggcgaaggcgg	Protospacer
.* *  * ************ ****** *** 

659. spacer 4.10|1554936|32|CP032266|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

--tgaccccgggcccgcccggcaggcgaatgcgc	CRISPR spacer
cctga--tcgggcccgcccgggcggcgaatgaaa	Protospacer
  ***  .*************  ******** . 

660. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc-	CRISPR spacer
tgggcgagggcccgggcgacggccgc-cgcacg	Protospacer
   ** *** **************** ** .* 

661. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccagacccagggcgacggccgcggagag	Protospacer
 * *****.*** ************** .*. 

662. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
aggatctctccccgggcgaccgccgcgcgggc	Protospacer
*  ..*   *********** ***********

663. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccagacccagggcgacggccgcggagag	Protospacer
 * *****.*** ************** .*. 

664. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ctcgtcacgccccgggcgacggccgcccagaa	Protospacer
 .**.** ****************** *.*. 

665. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccagacccagggcgacggccgcggagag	Protospacer
 * *****.*** ************** .*. 

666. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccagacccagggcgacggccgcggagag	Protospacer
 * *****.*** ************** .*. 

667. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ctcgtcacgccccgggcgacggccgcccagaa	Protospacer
 .**.** ****************** *.*. 

668. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ccggccagacccagggcgacggccgcggagag	Protospacer
 * *****.*** ************** .*. 

669. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 8, identity: 0.75

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
cacattaggccccgggcggcggccgcccggac	Protospacer
  *...************.******* ***.*

670. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
gcgatcctggctgaggctgatgcgctcggctg	Protospacer
*****.****** **********   * . **

671. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 8, identity: 0.75

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
gcagggttcaggatcaggttccagccgaggag	Protospacer
 * *******************.*.**. *  

672. spacer 4.24|1555790|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

atggacaacgtcctcttcctgccccgccccgt	CRISPR spacer
ctgctccccgtcctcgtcccgccccgccccgc	Protospacer
 **  *  ******* ***.***********.

673. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
actgaacggcctgtgagcgggcgcgggcgacg	Protospacer
 * *  ***** ***** ************  

674. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
ccggtccggccggtgagagcacgcagtgaagt	Protospacer
.****************** .***.*  .**.

675. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
aactcgttgagcgtctcggcgatcaccagaac	Protospacer
. ***** **.************** *.*. *

676. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 8, identity: 0.75

cggcgtccgccgcgtccgccggtctcggggac----	CRISPR spacer
cggcgtccgtcgcgcccgccggtc----agatcttc	Protospacer
*********.****.*********    .**.    

677. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
cggcatccgccgcggccgccggttcacgtgcc	Protospacer
****.********* ********..  * * *

678. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
cgggcgtcgggctgccggtagccgggctgccg	Protospacer
 . ************.***********.*   

679. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to KR053199 (Gordonia phage GMA4, complete genome) position: , mismatch: 8, identity: 0.75

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
tgctggacgggctgctggtagacgggctgggc	Protospacer
 .*  * ************** *****.***.

680. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tgtgcggcgggctgctcgaccaggaaacggcg	Protospacer
** . *.*** ***************.***. 

681. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tggaggatgccctgctcgaccagggtgtcacc	Protospacer
*******.* **************. *. ..*

682. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN284901 (Microbacterium phage YuuY, complete genome) position: , mismatch: 8, identity: 0.75

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
acgaggacggcctgcccgagcaggaccccggc	Protospacer
  *************.*** *****  * * *

683. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgacacggacggctcggagctggccgagcc	CRISPR spacer
accgtcaccgacggctcggagctggcgctgtc	Protospacer
..** *** *****************   *.*

684. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
cagctggccgcgccgggcccggtggtcctgac	Protospacer
*** ************.****** *.. *  *

685. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 8, identity: 0.75

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
ggagtggccgcgccgtaccccgtcgcggatgc	Protospacer
 ..************ **** ***** * * *

686. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

gtgaaccccgccttcatgcccgacgatcgcca-	CRISPR spacer
ctgaagcccgccttcatggccgacgg-cgtggt	Protospacer
 **** ************ ******. **. . 

687. spacer 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

tgctctccggggccgggcaggaccgtctcggc	CRISPR spacer
atctctccggggccgggcaacaccggcgtcgc	Protospacer
  *****************. **** * . **

688. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
cgctcgccgaggtcctcgccgatcgcctcggg	Protospacer
 *  .********** ********.****.* 

689. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
accatgacgaggaccacgccgatcaccacgtg	Protospacer
*  *** ***** ************** *.  

690. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.75

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
cggaagccgaggtcctcgccgatctcggtggc	Protospacer
 *** ********** ******** *  ..**

691. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 8, identity: 0.75

aggatgc-cgaggtccacgccgatcacctcagc	CRISPR spacer
-ccctgctcgagggccacgccgatcacgtcatg	Protospacer
    *** ***** ************* ***  

692. spacer 5.3|1557772|31|CP032266|PILER-CR matches to NZ_CP014515 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742

gccagccaccccacctacggcaaggcgacac	CRISPR spacer
cgtaatcaccccacctacggcaagcccactc	Protospacer
  .*..****************** * ** *

693. spacer 5.3|1557772|31|CP032266|PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.742

gccagccaccccacctacggcaaggcgacac	CRISPR spacer
gagtgccaccccagctacggcaagacgcccg	Protospacer
*   ********* **********.** *  

694. spacer 5.7|1557773|30|CP032266|CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.733

ccagccaccccacctacggcaaggcgacac	CRISPR spacer
agtgccaccccagctacggcaagacgcccg	Protospacer
   ********* **********.** *  

695. spacer 5.8|1557833|31|CP032266|CRT matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.742

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
gtcagcggcgacaccggccccttcgccggca	Protospacer
.* *. **** *****************.  

696. spacer 5.8|1557833|31|CP032266|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
ctcaagggcgtcaccggctccttcgcccgcg	Protospacer
 * *******.*******.******** .  

697. spacer 5.8|1557833|31|CP032266|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

-----atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
cattcat-----gcgccacccgccccgtcgccgagg	Protospacer
     **     ******** ***** ******** 

698. spacer 5.8|1557833|31|CP032266|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 8, identity: 0.742

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
gacatgtgcgccatcggcccctttgccgagg	Protospacer
.  * * ******.*********.****** 

699. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
gccaacgcgaactggaaggggatgtcctcgc	Protospacer
 . *  **** * *****************.

700. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
acggaatcgaccaggaagggcatgtcgtcgt	Protospacer
 .*. . ************* ***** ****

701. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
accgagtcgaccaggaagggcatgtcgtcgt	Protospacer
 . . * ************* ***** ****

702. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
acggaatcgaccaggaagggcatgtcgtcgt	Protospacer
 .*. . ************* ***** ****

703. spacer 5.9|1557894|31|CP032266|CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
ttgatgacgaccaggaaggggatgcctctcg	Protospacer
****.*.*****************.*...  

704. spacer 5.9|1557894|31|CP032266|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
acggaatcgaccaggaagggcatgtcgtcgt	Protospacer
 .*. . ************* ***** ****

705. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
atgatggcgaccaagaaggggatgatcgccg	Protospacer
 ***.********.********** .* *  

706. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
aggacgccgacccggaaggggatgttcggtt	Protospacer
  **** ***** ************.*   *

707. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 8, identity: 0.742

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
ttttcggcgatcaggaagcggatgtccgtca	Protospacer
**  ******.******* ******** .  

708. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.75

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
atgttgatgacgaccaggaaggggatgcctct	Protospacer
  *****.*.*****************.*...

709. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.75

-tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
atgaatg-cggtgaccaggaaggggatctccat	Protospacer
 *.. ** ***.*************** *** .

710. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.75

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
gacatgatggcgaccaagaaggggatgatcgc	Protospacer
 *  ***.********.********** .* *

711. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
tggaggacgccgacccggaaggggatgttcgg	Protospacer
*.*  **** ***** ************.*  

712. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

713. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

714. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

715. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

716. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

717. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
cggcgacgcggccagatcccgcatccgggccg	Protospacer
 .*   .*********** **.******** *

718. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

719. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
cggcgacgcggccagatcccgcatccgggccg	Protospacer
 .*   .*********** **.******** *

720. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

721. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
cggcgacgcggccagatcccgcatccgggccg	Protospacer
 .*   .*********** **.******** *

722. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

723. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
cggcgacgcggccagatcccgcatccgggccg	Protospacer
 .*   .*********** **.******** *

724. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

725. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

726. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

727. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
cggcgacgcggccagatcccgcatccgggccg	Protospacer
 .*   .*********** **.******** *

728. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
ggttccggcgatcagatcgcgtatccgggcct	Protospacer
*.  .* ***..******************  

729. spacer 3.2|1543529|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagaggaagcagcgcaaggtcagcgacaag	CRISPR spacer
cgctcaacaagcatcgcaaggtcagcgagaat	Protospacer
*    *. ***** ************** ** 

730. spacer 3.3|1543590|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 9, identity: 0.719

tccttcagggccttgttctggctcggcatcgc	CRISPR spacer
ggcgcgacggccttgttcgcgctcggcatcgg	Protospacer
  * . * **********  *********** 

731. spacer 3.4|1543651|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_010492 (Arthrobacter sp. Chr15 plasmid pChr15, complete sequence) position: , mismatch: 9, identity: 0.719

ggggagaagtcctctcctcggtcctgaccggg	CRISPR spacer
tttcagtgctccggtcctcggtcctgaccggg	Protospacer
    ** . ***  ******************

732. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
gcgccggacgcaccgagccgatccggctctcc	Protospacer
 *.*** **** ***************.    

733. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT952853 (Arthrobacter phage Orcanus, complete genome) position: , mismatch: 9, identity: 0.719

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
ccaagtagggccccgagtcgttccggccgggg	Protospacer
.**    . ********.** ***********

734. spacer 3.5|1543712|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MF140397 (Arthrobacter phage Abidatro, complete genome) position: , mismatch: 9, identity: 0.719

tcaccgcacgccccgagccgatccggccgggg	CRISPR spacer
gcaagcagggccccgagtcgttccggccgggg	Protospacer
 **    . ********.** ***********

735. spacer 3.12|1544139|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tcctcaccatgccccggcaccgcttcgaacag	CRISPR spacer
cagtgaccatccaccggcaccgcttcgaccga	Protospacer
.  * ***** * *************** *..

736. spacer 3.14|1544261|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.719

cggatggcggtctccagggagatgactttcgc	CRISPR spacer
cggatggtggtctccagggtgatgtgccggtc	Protospacer
*******.*********** ****  ..   *

737. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
aacgaggcgctgtctgagcaggagcagacggc	Protospacer
 . *. * ****** **********.***** 

738. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to JQ680352 (Unidentified phage clone 1013_scaffold1713 genomic sequence) position: , mismatch: 9, identity: 0.719

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gttgtccggctgacggagcaggagcgtacgag	Protospacer
   * . ***** ************* ***.*

739. spacer 3.16|1544383|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gaagcagccaaagcggccggtggtcagcaaag	CRISPR spacer
ggggtagccaaagcggacgttggtcagctcga	Protospacer
*..*.*********** ** ********  ..

740. spacer 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MK165658 (Pseudomonas phage vB_PaeS_SCUT-S4, complete genome) position: , mismatch: 9, identity: 0.719

cccgcagacgaccccgcagccgtcttccccga	CRISPR spacer
cccgaagacgacgccgcagccgtgaacgtcat	Protospacer
**** ******* **********   * .*. 

741. spacer 3.20|1544627|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to HG962376 (Pseudomonas phage vB_PaeS_SCH_Ab26, complete genome) position: , mismatch: 9, identity: 0.719

cccgcagacgaccccgcagccgtcttccccga	CRISPR spacer
cccgaagacgacgccgcagccgtgaacgtcat	Protospacer
**** ******* **********   * .*. 

742. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MK524486 (Mycobacterium phage Waleliano, complete genome) position: , mismatch: 9, identity: 0.719

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
cgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
* ***** ******.***********.  . .

743. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
gcaggatatcaagcgcggcgtcgtcaccatca	Protospacer
 *  .*. .************** **** ***

744. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
cctcaagccccagcgcggcgtcgccgtcgggg	Protospacer
****** *** ************ *..*   .

745. spacer 4.3|1554509|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 9, identity: 0.719

acgtccgcagactcgcccggcagtgcaccgtg	CRISPR spacer
ccgcccgcagactcgcccgccagtacgatttt	Protospacer
 **.*************** ****.*. . * 

746. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ctcgccgaagccgcgcaggaacacaggtttgt	Protospacer
********.*********** ***.. .  *.

747. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ttcgccgaggccgcgccggatcgcgttggcga	Protospacer
.*************** *****.** . . * 

748. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
accgccgactccgcgcaggatcacgccgtcga	Protospacer
 .******  *************** *   * 

749. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggggccaggccgcgcaggatggcgaccagcg	Protospacer
   * * ************** .*******  

750. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP044544 (Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
atcgccgaggccgagcacgatcacatgctcga	Protospacer
 ************ *** ******.  *  * 

751. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gccgccgaagccgcccaggatcacgttgaaga	Protospacer
 .******.***** ********** . *.* 

752. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ggcgccgaagccgcccaggatcacgctgatga	Protospacer
  ******.***** ********** . * * 

753. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
accgccgaagccgcccaggatcacgttgaaga	Protospacer
 .******.***** ********** . *.* 

754. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
catattgaggccgcgcagcatcaccaccacgg	Protospacer
* ....************ ***** **** * 

755. spacer 4.6|1554692|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015171 (Acetobacter ascendens strain LMG 1591 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

cgtcaccgagatcccgtccatcaggagcaggg	CRISPR spacer
ggaacccaagatcctgtccatcaggagcacca	Protospacer
 *   **.******.**************  .

756. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tggtgattggcatcgactccggcatcgacctc	Protospacer
   *   .****** ** **************

757. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
aggcgatgggcatcgacaccggcatcgacctc	Protospacer
*  .    ****** **.**************

758. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gtgtccacggcatccgcgccggcatcgtaaac	Protospacer
.. ***.********.***********    *

759. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tgatggttggcatccacgccggcctcgacttc	Protospacer
   *   .*************** *****.**

760. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
tgatgattggcatccacgccggcctcgacttc	Protospacer
   *   .*************** *****.**

761. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gcgagtaccgcctgcacgccggcatcgacctc	Protospacer
.*   ..* ** * ******************

762. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
caatagacggcatcggcgccggcatcgaccgc	Protospacer
   *  .******* .************** *

763. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
cgccgtgcggcatcctcgccggcagcgacgac	Protospacer
  *. .********* ******** ****  *

764. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
ggcacaccggcatccccgcaggcatcgaccat	Protospacer
. * *  ******** *** ********** .

765. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 9, identity: 0.719

ccgacaccatcgctgcccgcaacgacgtcctc	CRISPR spacer
gagacaccatcgctgaccgccacgacaactat	Protospacer
  ************* **** *****. *. .

766. spacer 4.8|1554814|32|CP032266|CRISPRCasFinder,CRT matches to NC_047804 (Ralstonia phage RS-PII-1, complete genome) position: , mismatch: 9, identity: 0.719

ccgacaccatcgctgcccgca----acgacgtcctc	CRISPR spacer
acgacatcatcgctgcccgcatcgtgcggcgc----	Protospacer
 *****.**************    .**.**.    

767. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gacgaggcggacctggacgaactctcgcgcct	Protospacer
  ********.********* ****** . ..

768. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
ttcgaagcgggcctgcacgacctgcgagcgtt	Protospacer
*****.********* ******* . .* .*.

769. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gtcgaggcggccctggccgacctcgagcacaa	Protospacer
 ********* ***** *******  * *   

770. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
agcgaggcgagcctggccgacctctatgacat	Protospacer
  *******.****** ********  **  .

771. spacer 4.13|1555119|32|CP032266|CRISPRCasFinder,CRT matches to MN855734 (Siphoviridae sp. isolate 120, complete genome) position: , mismatch: 9, identity: 0.719

tcctgctcgatgagccgcatgctcacggcggc	CRISPR spacer
ccggtcacgatcagccgcatgttcacggcgcg	Protospacer
.*   * **** *********.********  

772. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
ccaacgacgcgcgccgctcctgcggcgccaac	Protospacer
*** ******* ************* .   . 

773. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
acaccgacgtgtgccgctcctgcgaggtccgc	Protospacer
 ********.* ************.*.  .* 

774. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
cgaccgacgcgggcctctcccgcggcctggcc	Protospacer
* ************* ****.****   *   

775. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
acctcgacgcgggccgcacctgcgtgatgctc	Protospacer
 * .************* ****** ** *.  

776. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
acctcgacgcgggccgcacctgcgtgatgctc	Protospacer
 * .************* ****** ** *.  

777. spacer 4.14|1555180|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgacgcgggccgctcctgcgggaggtgg	CRISPR spacer
acctcgacgcgggccgcacctgcgtgatgctc	Protospacer
 * .************* ****** ** *.  

778. spacer 4.17|1555363|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 9, identity: 0.719

ccgctcgacctctcgcccgtggccgaccggct	CRISPR spacer
ctcctcgatctctcgcccgtgcccgaaggtgc	Protospacer
*. *****.************ ****  *  .

779. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032319 (Hymenobacter oligotrophus strain sh-6 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tagcccaggccccgggcgtcggccgcccgctg	Protospacer
    ************** ******* **   

780. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
gggtgagggccccggtcgacggccgcgctggc	Protospacer
.     .******** ************ ***

781. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
cgtgccagggcccgcgcgacggccgcggcgcg	Protospacer
  .****** **** ************  *  

782. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP029542 (Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
ttggccaggcccgggtcgacggccgcgggcaa	Protospacer
 . ********* ** *********** * . 

783. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
accgtccggccccgggcgacggcgaggcccca	Protospacer
****.* **************** . **    

784. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
accgtccggccccgggcgacggcgaggcccca	Protospacer
****.* **************** . **    

785. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tgcggcaggccccgcgcgacggccgggtgatg	Protospacer
  ** ********* ********** *.*.  

786. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
gcgtccaggccgcgggcgatggccgcggcgat	Protospacer
.*  ******* *******.*******  *..

787. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tgcggcaggccccgcgcgacggccgggtgatg	Protospacer
  ** ********* ********** *.*.  

788. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
accgtccggccccgggcgacggcgaggcccca	Protospacer
****.* **************** . **    

789. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tgcggcaggccccgcgcgacggccgggtgatg	Protospacer
  ** ********* ********** *.*.  

790. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tgcggcaggccccgcgcgacggccgggtgatg	Protospacer
  ** ********* ********** *.*.  

791. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 9, identity: 0.719

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
tcggacaggcccggcgcgacggccgcgccaag	Protospacer
 * * ******* * ************* .. 

792. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to KC862297 (Pseudomonas phage PAK_P1, complete genome) position: , mismatch: 9, identity: 0.719

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ccagaatatgctcaggctgctgctgaccagtg	Protospacer
 *..  .  ********** ************

793. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
cggattctgggtcgggctgatgctggtgatcg	Protospacer
  ******** **.***********.. * .*

794. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
cggattctgggtcgggctgatgctggtgatcg	Protospacer
  ******** **.***********.. * .*

795. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.719

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
cctcgggtcaggatcaggatccggtcggccag	Protospacer
.*. ** *********** *********.   

796. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
cctcgggtcaggatcaggatccggtcggccag	Protospacer
.*. ** *********** *********.   

797. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
cctcgggtcaggatcaggatccggtcggccag	Protospacer
.*. ** *********** *********.   

798. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.719

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
cctcgggtcaggatcaggatccggtcggccag	Protospacer
.*. ** *********** *********.   

799. spacer 4.23|1555729|32|CP032266|CRISPRCasFinder,CRT matches to MH727550 (Corynebacterium phage Juicebox, complete genome) position: , mismatch: 9, identity: 0.719

gtcttcat----cttcgccagccgctgctgaatctt	CRISPR spacer
----ccaccgcacttcgccagctgctgctgaagctc	Protospacer
    .**.    **********.********* **.

800. spacer 4.24|1555790|32|CP032266|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

atggacaacgtcctcttcctgccccgccccgt	CRISPR spacer
aggctttccgtcgtctccctgccccgccccga	Protospacer
* *  .  **** ***.************** 

801. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
acggtccggtcggtgagaaggcgccgataact	Protospacer
 ********.********.***** *...* .

802. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
acggtccggtcggtgagaaggcgccgataact	Protospacer
 ********.********.***** *...* .

803. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
tcggtccggccgttgagaaggcggacggcttc	Protospacer
************ *****.**** . *    *

804. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cagcgtcaaccggtgaaaggtcgcgggcgagc	Protospacer
. *  .*..*******.*** ***********

805. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to MH669000 (Gordonia phage Ali17, complete genome) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cccgctcgcccggtgagagggtgcgggcggcg	Protospacer
.* *..** ************.*******.  

806. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cccgctcgcccggtgagagggtgcgggcggcg	Protospacer
.* *..** ************.*******.  

807. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 9, identity: 0.719

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cccgctcgcccggtgagagggtgcgggcggcg	Protospacer
.* *..** ************.*******.  

808. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

809. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

810. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

811. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

812. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

813. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

814. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

815. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

816. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

817. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

818. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

819. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

820. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

821. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

822. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

823. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

824. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

825. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

826. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
tcgacaccgaacgtctcggcgaccagccggcc	Protospacer
 .  *.. **************.**** ****

827. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014678 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_4, complete sequence) position: , mismatch: 9, identity: 0.719

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
ttgcgtccgccgcccccgccggtcttccggcg	Protospacer
. *********** .**********.  **  

828. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

cggcgt-ccgccgcgtccgccggtctcggggac	CRISPR spacer
-gccacaccgccgcgtccgccgtcctcgggccg	Protospacer
 * *.. *************** .******   

829. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

cggcgt-ccgccgcgtccgccggtctcggggac	CRISPR spacer
-gccacaccgccgcgtccgccgtcctcgggccg	Protospacer
 * *.. *************** .******   

830. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020702 (Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS2, complete sequence) position: , mismatch: 9, identity: 0.719

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
gagcgttcggcgcgtccgccggtctgctcgcc	Protospacer
 .****.** ***************    * *

831. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
ggctggccgggctgctggtcggcgggccggtg	Protospacer
..*  *.************ * ********  

832. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
ccacggaccgcctgctcgcccaggaagctttt	Protospacer
. . **** ********* *********  *.

833. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tggaggacggcccgcccgaccaggtgctgaaa	Protospacer
************.**.******** . .*.  

834. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
ccgaggagggcctgctcgacctggacgatccc	Protospacer
. ***** ************* *** *   .*

835. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.719

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
ccgaggacggcctgctggacctggacgatccc	Protospacer
. ************** **** *** *   .*

836. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053567 (Pseudonocardia sp. Gen01 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tggaggacggcgtgctcgacgagctgagcatc	Protospacer
*********** ******** **  ..  .**

837. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacacggacggctcggagctggccgagcc	CRISPR spacer
cgcccgatggacggctcggggctggccgcgcg	Protospacer
  *   *.***********.******** ** 

838. spacer 4.32|1556278|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046349 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacacggacggctcggagctggccgagcc	CRISPR spacer
gagcttgcggacggctcgaagctgggcgaggc	Protospacer
*    ..***********.****** **** *

839. spacer 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

tcctgttcggctgctaccagccgcgcgacctc	CRISPR spacer
aggcgctcggctgctacgagcggcgcgacacc	Protospacer
   .*.*********** *** ******* .*

840. spacer 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctgttcggctgctaccagccgcgcgacctc	CRISPR spacer
gacagatcggcggccaccagccgcgcgacgat	Protospacer
  * * ***** **.**************  .

841. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 9, identity: 0.719

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
gccacggccgcgccggagccggtcgctgccgc	Protospacer
   ..************ **********.. *

842. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 9, identity: 0.719

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
ggtgtggccgcgcccgacccggccgccgcgca	Protospacer
 . *********** *******.***.*. * 

843. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.719

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
cggcctgccgcgccggacccggtcccggtcgg	Protospacer
*.* . ****************** * **.  

844. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023038 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
cttcgtccggcgccggacgcgggcgctgttcc	Protospacer
*      * ********* *** *********

845. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccaggtcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

846. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccaggtcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

847. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012941 (Ralstonia solanacearum strain UW163 plasmid pUW163a, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccaggtcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

848. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccaggtcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

849. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccaggtcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

850. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccagatcccccgcggcccgcacccccagcc	Protospacer
   .*. *.** ********* **********

851. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

852. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
ggcattggcggcttcgtgcccgacgatcgccg	Protospacer
*  * .  ** ****.***************.

853. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

854. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
ccgcagcccgccttcatgtccgccgatcggat	Protospacer
 .* * ************.*** ******   

855. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

856. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

857. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

858. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
gatgccggcgccttcatggccgaggatcgccg	Protospacer
*  . *  ********** **** *******.

859. spacer 4.36|1556522|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 9, identity: 0.719

gtgaaccccgccttcatgcccgacgatcgcca	CRISPR spacer
ggcattggcggcttcgtgcccgacgatcgccg	Protospacer
*  * .  ** ****.***************.

860. spacer 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 9, identity: 0.719

tgctctccggggccgggcaggaccgtctcggc	CRISPR spacer
ggacgcccgaggccgtgcaggaccgtctcgca	Protospacer
 * . .***.***** **************  

861. spacer 4.37|1556583|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

tgctctccggggccgggcaggaccgtctcggc	CRISPR spacer
ggcctcccggggcggggcgggaccgtctcccg	Protospacer
 **...******* ****.**********   

862. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.719

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
gagcagccgaggtcctcgtcgatcacctcgat	Protospacer
..*  ********** **.**********...

863. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020084 (Blastomonas fulva strain T2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
caattgccgaggtcaacgccgatgacctgcga	Protospacer
 .. ********** ******** ****  * 

864. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 9, identity: 0.719

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
cggatgccgacgtccacgcccatccggtcgcg	Protospacer
 ********* ********* ***   **.  

865. spacer 5.8|1557833|31|CP032266|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
tgcacaaccgccaccggcaccttcgccgagc	Protospacer
   * .. ********** ***********.

866. spacer 5.8|1557833|31|CP032266|CRT matches to MT498059 (Gordonia phage Doggs, complete genome) position: , mismatch: 9, identity: 0.71

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
tcgggcggcgccaccggctccttcgccgccg	Protospacer
 .*.. ************.*********   

867. spacer 5.8|1557833|31|CP032266|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

atgaagggcgccaccggccccttcgccgagt	CRISPR spacer
gcgctggccgccaccggcgccttcgccgccg	Protospacer
..*  ** ********** *********   

868. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.71

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
gcacccaacaccaggaaggcgatgtcctcgt	Protospacer
 .. * .  ********** ***********

869. spacer 5.9|1557894|31|CP032266|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.71

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
gcgccggcgaccaggaacgcgatgtcccacc	Protospacer
 .* ************* * *******.  .

870. spacer 5.9|1557894|31|CP032266|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.71

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
gcgccggcgaccaggaacgcgatgtcccacc	Protospacer
 .* ************* * *******.  .

871. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
acggcgccggcgaccaggaacgcgatgtccca	Protospacer
  * .* ************* * *******. 

872. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
acggcgccggcgaccaggaacgcgatgtccca	Protospacer
  * .* ************* * *******. 

873. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
agggtcacggggaccaggaaggggacgtcggg	Protospacer
 .* * **** **************.***   

874. spacer 7.1|1635627|32|CP032266|CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719

gacggacggtgcggcccaaggccacgacggaa	CRISPR spacer
gcaggacggtgcgacccaaggctacgtggacg	Protospacer
*  **********.********.***  *. .

875. spacer 7.1|1635627|32|CP032266|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719

gacggacggtgcggcccaaggccacgacggaa	CRISPR spacer
gcgaggcggtgcgccccgaggccacgacgttc	Protospacer
*  .*.******* ***.***********   

876. spacer 12.1|3490021|37|CP032266|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.757

ctacacctggcggaagtccagccacagcggcggcgcc	CRISPR spacer
cggcgcctcgcggacgtccagccacagcggcacgccc	Protospacer
* .*.*** ***** ****************.   **

877. spacer 12.1|3490021|37|CP032266|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.757

ctacacctggcggaagtccagccacagcggcggcgcc	CRISPR spacer
cggcgcctcgcggacgtccagccacagcggcacgccc	Protospacer
* .*.*** ***** ****************.   **

878. spacer 3.1|1543468|32|CP032266|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 10, identity: 0.688

gagatctgcggccagatcgcgtatccgggcgg	CRISPR spacer
tcgatctgctgccagatcgcgtttctgccgct	Protospacer
  ******* ************ **.*     

879. spacer 3.7|1543834|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 10, identity: 0.688

ctgatgagcagtaccggcgcggccgaacggtt	CRISPR spacer
aggatgagcagcaccggcacggccgtgcccag	Protospacer
  *********.******.****** .*    

880. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 10, identity: 0.688

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
ccgaaaaagctgtcggagcaggggctgacggt	Protospacer
. *.. ..**************.** ***** 

881. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 10, identity: 0.688

tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gccgctgggcagacggagcaggagcggagtcc	Protospacer
   * ***** * ***************    

882. spacer 3.15|1544322|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

----tggggtgggctgtcggagcaggagcggacggg	CRISPR spacer
gtttcggggcg----gtcggggcaggagcggacaac	Protospacer
    .****.*    *****.************.. 

883. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

884. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

885. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

886. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

887. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

888. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

889. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

890. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

891. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

892. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

893. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

894. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_028968 (Mycobacterium phage BrownCNA, complete genome) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
tgtcaacgccaagcacggcgtcggcatggcgg	Protospacer
. ***** ******.***********.  . .

895. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
cgccaatcccaagggcggcgtcggcaagactc	Protospacer
* .***.****** ************   .. 

896. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NC_004954 (Micrococcus sp. 28 plasmid pSD10, complete sequence) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
ttccaacaccaagggcggcgtcggcaagacga	Protospacer
...**** ***** ************   . *

897. spacer 4.2|1554448|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

cctcaaccccaagcgcggcgtcggcaccctca	CRISPR spacer
ggccaaccgcaagggcggcgtcggcaagaccg	Protospacer
  .***** **** ************   .*.

898. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gccgccgaagccgcccaggatcacgctgacaa	Protospacer
 .******.***** ********** . * . 

899. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggggtcaggccgcgcaggatggcgaccagcg	Protospacer
   * . ************** .*******  

900. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggggtcaggccgcgcaggatggcgaccagcg	Protospacer
   * . ************** .*******  

901. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
atcgccgaggctgcgcgggatcacccttgagg	Protospacer
 **********.****.*******  ....* 

902. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggggtcaggccgcgcaggatggcgaccagcg	Protospacer
   * . ************** .*******  

903. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
ggattcgagggcgtgcaggatcacgacctcgt	Protospacer
    .***** **.**************  *.

904. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 10, identity: 0.688

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gggggtcaggccgcgcaggatggcgaccagcg	Protospacer
   * . ************** .*******  

905. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to CP054930 (Streptomyces sp. NA00687 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
gagctggcggcagccaggccggcatcgaccga	Protospacer
.  .. ****** *** *************  

906. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 10, identity: 0.688

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
cggtccgctgcatccacgccggcctcgtggag	Protospacer
   ***** ************** ***     

907. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_LN868941 (Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.688

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
catacgacggcatccgcgcccgcatcgaccgg	Protospacer
  . * .********.**** *********  

908. spacer 4.7|1554753|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP031419 (Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acctccgcggcatccacgccggcatcgacctc	CRISPR spacer
catacgacggcatccgcgcccgcatcgaccgg	Protospacer
  . * .********.**** *********  

909. spacer 4.9|1554875|32|CP032266|CRISPRCasFinder,CRT matches to AP018698 (Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

ttcgaggcgggcctggacgacctctcggaatc	CRISPR spacer
gcgcaggcgggccttgccgacctctcggcgct	Protospacer
 .  ********** * *********** ...

910. spacer 4.17|1555363|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctcgacctctcgcccgtggccgaccggct	CRISPR spacer
gacctcgacctcacgcccgtggcccacaccac	Protospacer
   ********* *********** **    .

911. spacer 4.18|1555424|32|CP032266|CRISPRCasFinder,CRT matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 10, identity: 0.688

cctcacctcccggccgtaaggccagaaaataa	CRISPR spacer
aagggcctcccggccgtatcgccagaaaagct	Protospacer
    .*************  *********   

912. spacer 4.18|1555424|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

cctcacctcccggccgtaaggccagaaaataa	CRISPR spacer
ggacacctcccggccgaaaagccagacgctcc	Protospacer
   ************* **.****** . *  

913. spacer 4.20|1555546|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gagtacccgatgaccgacccctccgaagagac	CRISPR spacer
tggtacccgatgaccgacgccaccgccgcccg	Protospacer
 .**************** ** ***  *    

914. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

915. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

916. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
atacttctggctcaggctgatcgtgacggtgg	Protospacer
... *****************  **** .  *

917. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

918. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

919. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
cggattctgggtcgggctgatgctggtggtcg	Protospacer
  ******** **.***********.. . .*

920. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

921. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ctatttctggctcaggctgatcgtgacggtgg	Protospacer
 .. *****************  **** .  *

922. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

923. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

924. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

925. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

926. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

927. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

928. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

929. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

930. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

931. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

932. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

933. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

934. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ggcgccactgctcagggtgatgttgaccagtg	Protospacer
*  ... . ******* *****.*********

935. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to MF974178 (Pseudomonas phage YS35, complete genome) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ccagaatatgctcagactgctgctgaccagtg	Protospacer
 *..  .  ******.*** ************

936. spacer 4.21|1555607|32|CP032266|CRISPRCasFinder,CRT matches to MH791399 (UNVERIFIED: Pseudomonas phage PaGz-1, complete genome) position: , mismatch: 10, identity: 0.688

gcgattctggctcaggctgatgctgaccagtg	CRISPR spacer
ccagaatatgctcagactgctgctgaccagtg	Protospacer
 *..  .  ******.*** ************

937. spacer 4.22|1555668|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tccgggttcaggatcaggttccggtcggtgct	CRISPR spacer
gccgggttccggatgaggttccggatgaaatc	Protospacer
 ******** **** ********* .*. ...

938. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
acgatctggatcgtctcggcgatcagcgcgcg	Protospacer
..  . *.** ***************** ** 

939. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN694649 (Marine virus AFVG_250M190, complete genome) position: , mismatch: 10, identity: 0.688

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
aagaaatagaacgtctgggcgaccagcggtgc	Protospacer
.    .********** *****.******  *

940. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN694572 (Marine virus AFVG_250M22, complete genome) position: , mismatch: 10, identity: 0.688

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
aagaaatagaacgtctgggcgaccagcggtgc	Protospacer
.    .********** *****.******  *

941. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN694546 (Marine virus AFVG_250M837, complete genome) position: , mismatch: 10, identity: 0.688

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
aagaaatagaacgtctgggcgaccagcggtgc	Protospacer
.    .********** *****.******  *

942. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN694062 (Marine virus AFVG_250M191, complete genome) position: , mismatch: 10, identity: 0.688

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
aagaaatagaacgtctgggcgaccagcggtgc	Protospacer
.    .********** *****.******  *

943. spacer 4.28|1556034|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cggcgtccgccgcgtccgccggtctcggggac	CRISPR spacer
ttcttgccgccgcgcccgccggtcttgggccc	Protospacer
.  .  ********.**********.***  *

944. spacer 4.30|1556156|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 10, identity: 0.688

aacgcgtcgggctgctggtagccgggccgggt	CRISPR spacer
tgggcgtggggctgctggtggccggggtgctg	Protospacer
 . **** ***********.****** .*   

945. spacer 4.33|1556339|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tcctgttcggctgctaccagccgcgcgacctc	CRISPR spacer
aggctctcggctgctacgagcggcgcgacaac	Protospacer
   . .*********** *** *******  *

946. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
ccggtggccgcgccggtcccagtcgtccccgg	Protospacer
* ************** ***.****.. ..  

947. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 10, identity: 0.688

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
cgccgccgcccgcgcggcccgcacccccaccc	Protospacer
   .. * .************ ******* **

948. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT491207 (Pseudomonas phage vB_PaeM_USP_18, complete genome) position: , mismatch: 10, identity: 0.688

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
ggataacttccgcgccgcccgtacccaggtgg	Protospacer
* .************ ***** ****  .   

949. spacer 4.35|1556461|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MT491208 (Pseudomonas phage vB_PaeM_USP_25, complete genome) position: , mismatch: 10, identity: 0.688

gtgtaacttccgcgcggcccgaacccccagcc	CRISPR spacer
ggataacttccgcgccgcccgtacccaggtgg	Protospacer
* .************ ***** ****  .   

950. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 10, identity: 0.688

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
gcgacgccgacgtccacgccgatcactgggag	Protospacer
. **.***** ***************.  .. 

951. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015446 (Streptomyces sp. S8 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
gcgatgccgaggtcgacgccgaacagcggctt	Protospacer
. ************ ******* ** *    .

952. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 10, identity: 0.677

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
aatgcggtgaccaggaaggggatctccattc	Protospacer
   .***.*************** *** . .

953. spacer 5.9|1557894|31|CP032266|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.677

ttgacggcgaccaggaaggggatgtcctcgt	CRISPR spacer
cccccggcggccaggatggggatgtccagcg	Protospacer
..  *****.****** **********    

954. spacer 5.10|1557891|32|CP032266|CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

tagttgacggcgaccaggaaggggatgtcctc	CRISPR spacer
atgcccccggcggccaggatggggatgtccag	Protospacer
  *..  *****.****** **********  

955. spacer 11.1|3135701|37|CP032266|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 10, identity: 0.73

aaccggccgagacccgccagcacggccccgccacaca	CRISPR spacer
agcaggccgagacccgccagcacagcgccgaggaccg	Protospacer
*.* *******************.** ***  .  *.

956. spacer 12.1|3490021|37|CP032266|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.73

ctacacctggcggaagtccagccacagcggcggcgcc	CRISPR spacer
cggggcctcgcggacgtccagccacagcggcacgccc	Protospacer
* . .*** ***** ****************.   **

957. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 11, identity: 0.656

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gagcccgagcccgcgcacgatcacgacggtat	Protospacer
    ***** ******* ********* . ..

958. spacer 4.4|1554570|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 11, identity: 0.656

ctcgccgaggccgcgcaggatcacgaccaggc	CRISPR spacer
gccgccgaagccgcgcaggaacacgctgtcat	Protospacer
 .******.*********** **** .   ..

959. spacer 4.19|1555485|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 11, identity: 0.656

accgccaggccccgggcgacggccgcgcgggc	CRISPR spacer
caggccaggcgcagggcgacggccgcagcttt	Protospacer
   ******* * *************.    .

960. spacer 4.25|1555851|32|CP032266|CRISPRCasFinder,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 11, identity: 0.656

tcggtccggccggtgagagggcgcgggcgagc	CRISPR spacer
cgacagcggcgggtgagcgggcgcgggcgcag	Protospacer
. .   **** ****** *********** . 

961. spacer 4.27|1555973|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR026982 (Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.656

gtctcgtagaacgtctcggcgatcagcgggcc	CRISPR spacer
caagcgtcgaacgtctcggcggtcagctccga	Protospacer
    *** *************.*****     

962. spacer 4.31|1556217|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656

tggaggacggcctgctcgaccaggaagcggtc	CRISPR spacer
tgaagaacggcctgctcgaccagccgcatact	Protospacer
**.**.*****************  .   ...

963. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
tgcaatgccgcgccggacccggccgcggtcgg	Protospacer
.. .  ****************.*** **.  

964. spacer 4.34|1556400|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

caggtggccgcgccggacccggtcgctgttcc	CRISPR spacer
tgcaatgccgcgccggacccggccgcggtcgg	Protospacer
.. .  ****************.*** **.  

965. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 11, identity: 0.656

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
tcatcgccgaggtgctcgccgatcaccttcca	Protospacer
  . .******** * ************.   

966. spacer 4.38|1556644|32|CP032266|CRISPRCasFinder,CRT,PILER-CR matches to MN694589 (Marine virus AFVG_250M1203, complete genome) position: , mismatch: 11, identity: 0.656

aggatgccgaggtccacgccgatcacctcagc	CRISPR spacer
ccctcgccgaagtccacgccggtcacctgctt	Protospacer
    .*****.**********.******   .

967. spacer 7.1|1635627|32|CP032266|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 11, identity: 0.656

gacggacggtgcggcccaaggccacgacggaa	CRISPR spacer
cctatgcggtgcagcccaaggcgacgacgacg	Protospacer
  .. .******.********* ******. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 859799 : 918458 54 Synechococcus_phage(25.0%) tail,holin,plate NA
DBSCAN-SWA_2 5025272 : 5074184 46 Streptomyces_phage(58.82%) portal,protease,holin,capsid,tail,head NA
DBSCAN-SWA_3 5091428 : 5100656 18 Streptomyces_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage