1. spacer 1.3|1726818|33|AP018532|CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 7, identity: 0.788
aaagcggacggccacaccgtccacgactttgac CRISPR spacer
gcagcggacggccacaccctccaccaccccgac Protospacer
. **************** ***** **...***
2. spacer 1.4|1726884|33|AP018532|CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 7, identity: 0.788
aaagcggacggccacaccgtccacgactttgac CRISPR spacer
gcagcggacggccacaccctccaccaccccgac Protospacer
. **************** ***** **...***
3. spacer 1.2|1726751|34|AP018532|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.735
tcctcccacagcaccgccgtcccctccagcatgt CRISPR spacer
gcgccgatcagcaccgccgtcccggccagcatgg Protospacer
* .* *************** ********
4. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 9, identity: 0.735
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
tccgcggcggcgtcaacgacggcctgctcaccgc Protospacer
*.*.************.*.********* .* .
5. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 9, identity: 0.735
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
tccgcggcggcgtcaacgacggcctgctcgccgg Protospacer
*.*.************.*.********* .*
6. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 9, identity: 0.735
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
tcggcctcggcctccatggcggcctgctgctcgc Protospacer
*. .* **** ** ***************** .
7. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 9, identity: 0.735
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
tcggcctcggcctccatggcggcctgctgctcgg Protospacer
*. .* **** ** *****************
8. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
tcggcctcggcctccatggcggcctgctgctcgg Protospacer
*. .* **** ** *****************
9. spacer 1.7|1727084|34|AP018532|CRISPRCasFinder,CRT matches to MH572442 (Microviridae sp. isolate SD_MC_66, complete genome) position: , mismatch: 10, identity: 0.706
agctccgtctccagacggtgcaccagagcggaga CRISPR spacer
tgtaccgtctccagacggtacaccacagttgccc Protospacer
*. ***************.***** **. *
10. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 10, identity: 0.706
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgtgtga Protospacer
. ************ ** ******** .... **
11. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP036260 (Sporomusa termitida strain DSM 4440 plasmid pSPTER, complete sequence) position: , mismatch: 10, identity: 0.706
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
ttcacggcttcgtcaatggcggcctggcagatgc Protospacer
******** **************** .. . .
12. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 10, identity: 0.706
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
gtcacggcggcgacaatcgcggcctcgtcgtaac Protospacer
*********** **** ******* * * .
13. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NC_010333 (Caulobacter sp. K31 plasmid pCAUL02, complete sequence) position: , mismatch: 10, identity: 0.706
ttcacggcggcgtcaatggcggcctgctgctctt----- CRISPR spacer
ctgtcggcgccgtcaatggcggcct-----tctcgaaaa Protospacer
.* ***** *************** ***.
14. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972693 (Salmonella phage SI23, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
15. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972694 (Salmonella phage SE22, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
16. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972692 (Salmonella phage SE21, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
17. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to AP000400 (Enterobacteria phage VT1-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
18. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP019281 (Escherichia coli strain 13P484A plasmid p13P484A-1, complete sequence) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
19. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK770415 (Salmonella phage SF11, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
20. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK770414 (Salmonella phage SE16, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
21. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to NC_011356 (Enterobacteria phage YYZ-2008, complete prophage genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
22. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972686 (Salmonella phage SF3, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
23. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972685 (Salmonella phage SE10, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
24. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to FJ184280 (Enterobacteria phage YYZ-2008, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
25. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MK972687 (Salmonella phage SE1 (in:P22virus), complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
26. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to MF807953 (Escherichia phage Ayreon, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
27. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to NC_009514 (Phage cdtI DNA, complete genome) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
28. spacer 1.8|1727151|34|AP018532|CRISPRCasFinder,CRT matches to LR595862 (Escherichia virus Lambda_2H10 genome assembly, chromosome: 1) position: , mismatch: 11, identity: 0.676
cccggcggctccggaaggggcatccaccacaaga CRISPR spacer
tgcggcggctccggtagcggcatccagtgggtta Protospacer
. ************ ** ******** .. . *
29. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 11, identity: 0.676
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
cctccggcggcgtcattggcagcctgcttagcac Protospacer
... *********** ****.******* * .
30. spacer 1.10|1727285|34|AP018532|CRISPRCasFinder,CRT matches to NZ_CP043620 (Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.676
ttcacggcggcgtcaatggcggcctgctgctctt CRISPR spacer
ctgacggcgccgtcattggcggcctgcattagcc Protospacer
.* ****** ***** *********** . ..
