Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032308 Enterococcus faecium strain HY07 chromosome, complete genome 2 crisprs cas9,cas1,cas2,csn2,DEDDh,cas3,csa3,DinG,cas14j 0 5 5 0
CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 0 crisprs cas14j,csa3 0 0 4 0
CP032309 Enterococcus faecium strain HY07 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP032308
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032308_2 428382-428473 TypeII II-A
1 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032308_4 2293637-2293772 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032308_1 1.3|322282|35|CP032308|CRT 322282-322316 35 AB711120 Bacillus phage PM1 DNA, complete genome 15177-15211 9 0.743
CP032308_1 1.5|322420|35|CP032308|CRT 322420-322454 35 NC_011413 Escherichia coli SE11 plasmid pSE11-2, complete sequence 3807-3841 9 0.743
CP032308_1 1.1|322144|35|CP032308|CRT 322144-322178 35 NC_011413 Escherichia coli SE11 plasmid pSE11-2, complete sequence 3807-3841 10 0.714
CP032308_1 1.2|322213|35|CP032308|CRT 322213-322247 35 NC_011413 Escherichia coli SE11 plasmid pSE11-2, complete sequence 3807-3841 10 0.714
CP032308_1 1.6|322489|35|CP032308|CRT 322489-322523 35 CP031730 Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence 136113-136147 10 0.714

1. spacer 1.3|322282|35|CP032308|CRT matches to AB711120 (Bacillus phage PM1 DNA, complete genome) position: , mismatch: 9, identity: 0.743

ttctcctgtaaattcagaataattaaaagcaccat	CRISPR spacer
atttcctgtaaattcataataattaaaaccgttta	Protospacer
 *.************* *********** *...  

2. spacer 1.5|322420|35|CP032308|CRT matches to NC_011413 (Escherichia coli SE11 plasmid pSE11-2, complete sequence) position: , mismatch: 9, identity: 0.743

acttcctgtaaatttagaaccactgaaagcactat	CRISPR spacer
acttactgtaaatttagaaccattggatatatggt	Protospacer
**** *****************.**.* ..*. .*

3. spacer 1.1|322144|35|CP032308|CRT matches to NC_011413 (Escherichia coli SE11 plasmid pSE11-2, complete sequence) position: , mismatch: 10, identity: 0.714

acttcctgtaaatttagaaccactgaaagcactac	CRISPR spacer
acttactgtaaatttagaaccattggatatatggt	Protospacer
**** *****************.**.* ..*. ..

4. spacer 1.2|322213|35|CP032308|CRT matches to NC_011413 (Escherichia coli SE11 plasmid pSE11-2, complete sequence) position: , mismatch: 10, identity: 0.714

acttcctgtaaatttagaaccactgaaagcagaag	CRISPR spacer
acttactgtaaatttagaaccattggatatatggt	Protospacer
**** *****************.**.* ..* .. 

5. spacer 1.6|322489|35|CP032308|CRT matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

ttctcctgaaaaattagggtattcaaaagcatgag	CRISPR spacer
tgctcttgaaaaattagggttttcaaatctttcta	Protospacer
* ***.************** ******  . *  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 316220 : 368425 47 Bacillus_phage(16.67%) integrase,transposase attL 315947:316006|attR 336919:337106
DBSCAN-SWA_2 643394 : 703887 59 Streptococcus_phage(18.75%) transposase,lysis,tRNA,protease NA
DBSCAN-SWA_3 1309926 : 1363066 53 unidentified_phage(27.27%) transposase NA
DBSCAN-SWA_4 1636002 : 1645041 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_5 2015084 : 2023799 10 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032307
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15753 : 58679 49 Streptococcus_phage(25.0%) protease,holin,transposase NA
DBSCAN-SWA_2 70273 : 128241 53 Streptococcus_phage(22.22%) integrase,transposase attL 75629:75651|attR 132825:132847
DBSCAN-SWA_3 131826 : 195717 56 Streptococcus_phage(35.71%) bacteriocin,integrase,transposase attL 132430:132489|attR 182465:182881
DBSCAN-SWA_4 207696 : 217450 9 Leptospira_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage